The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019771	Anabaena cylindrica PCC 7122, complete sequence	6395836	230835	247310	6395836	plate,tail	Bacillus_phage(66.67%)	13	NA	NA
WP_015212455.1|230835_232725_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_015212456.1|232706_233690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015212457.1|233692_237271_-|plate	putative baseplate assembly protein	plate	A0A1J0GW37	Streptomyces_phage	23.9	7.8e-13
WP_015212458.1|237277_237664_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_015212459.1|237663_238371_-	Rhs element Vgr protein	NA	NA	NA	NA	NA
WP_015212460.1|238367_239435_-	phage late control D family protein	NA	NA	NA	NA	NA
WP_015212461.1|239447_240101_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015212462.1|240091_243184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015212463.1|243243_243711_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_015212465.1|244015_244378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015212466.1|244389_244833_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_015212467.1|244857_246012_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	29.6	6.6e-30
WP_015212468.1|246155_247310_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	35.7	1.6e-39
>prophage 2
NC_019771	Anabaena cylindrica PCC 7122, complete sequence	6395836	1396233	1475474	6395836	integrase,transposase	uncultured_Mediterranean_phage(20.0%)	36	1463737:1463751	1474949:1474963
WP_015213386.1|1396233_1397709_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015213387.1|1397701_1398163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015213388.1|1398174_1398459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015213389.1|1399387_1400020_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_015213390.1|1401182_1402703_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_015213391.1|1402853_1405646_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_015213392.1|1405897_1407742_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_015213393.1|1408581_1429275_-	DUF4347 domain-containing protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	33.1	5.3e-37
WP_015213394.1|1431054_1432140_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015213395.1|1432791_1433148_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_015213396.1|1433269_1435042_-	hypothetical protein	NA	U5PVT3	Acinetobacter_phage	26.7	1.8e-18
WP_015213397.1|1435031_1436096_-	AAA family ATPase	NA	H6WG28	Cyanophage	36.2	3.6e-30
WP_015213398.1|1436336_1436987_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_015213399.1|1436989_1437340_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015213400.1|1437452_1438268_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_015213401.1|1438264_1440487_+	stem cell self-renewal protein Piwi	NA	NA	NA	NA	NA
WP_015213402.1|1444612_1447591_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	50.4	1.8e-289
WP_015213403.1|1447701_1448163_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_171815780.1|1453609_1456255_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_015213407.1|1456218_1457007_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015213408.1|1457057_1457909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015213409.1|1458337_1458820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015213410.1|1458928_1459348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015213411.1|1459564_1460560_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_015213412.1|1460556_1462074_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.2	9.9e-50
1463737:1463751	attL	TTGAACAAATTAATA	NA	NA	NA	NA
WP_042464670.1|1465510_1466329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464673.1|1466339_1466705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171815781.1|1466707_1467538_-	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_085930372.1|1467650_1468848_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_015213413.1|1468835_1469015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015213414.1|1469241_1469763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150110992.1|1469906_1470383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015213416.1|1470491_1471109_-	TniQ family protein	NA	NA	NA	NA	NA
WP_015213417.1|1471092_1473567_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015213418.1|1473570_1474227_-	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_081593733.1|1474274_1475474_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
1474949:1474963	attR	TATTAATTTGTTCAA	NA	NA	NA	NA
>prophage 3
NC_019771	Anabaena cylindrica PCC 7122, complete sequence	6395836	1566089	1636719	6395836	tRNA,integrase,transposase	Bacillus_phage(20.0%)	57	1625516:1625534	1629137:1629155
WP_081593666.1|1566089_1567070_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015213487.1|1567307_1568216_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_015213488.1|1568260_1568932_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_042465790.1|1569303_1569648_+	DOPA 4,5-dioxygenase family protein	NA	NA	NA	NA	NA
WP_081593667.1|1569680_1570151_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_015213490.1|1570653_1570890_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015213491.1|1570966_1571173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015213492.1|1571467_1571608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015213493.1|1571604_1572006_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_015213494.1|1571998_1572271_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015213495.1|1572364_1572697_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015213496.1|1573320_1574664_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015213497.1|1574762_1576127_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015213498.1|1576378_1577917_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_015213499.1|1578147_1578810_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_015213500.1|1579037_1580036_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_015213501.1|1580163_1581204_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015213502.1|1581287_1583120_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	35.9	1.6e-33
WP_015213503.1|1583100_1583469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015213504.1|1583461_1583707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015213506.1|1585064_1585310_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015213507.1|1585794_1585992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015213508.1|1585979_1586168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015213509.1|1586257_1586533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015213510.1|1586830_1587226_+	Nuclease A inhibitor family protein	NA	NA	NA	NA	NA
WP_015213511.1|1587383_1587755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015213512.1|1588056_1589370_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_042464702.1|1589469_1589667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015213513.1|1589743_1589992_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015213514.1|1589991_1590249_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_015213515.1|1593281_1594949_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_015213516.1|1595112_1595688_+	TniQ family protein	NA	NA	NA	NA	NA
WP_015213515.1|1595831_1597499_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_085930359.1|1597920_1599418_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015213517.1|1599683_1600850_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015213518.1|1601224_1601707_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_015213520.1|1601781_1602900_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_015213523.1|1606240_1606759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015213525.1|1608057_1609191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015213526.1|1609329_1611393_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_042464705.1|1611508_1611703_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015213527.1|1612522_1616734_-	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	28.1	1.8e-40
WP_015213529.1|1617235_1617838_-	GUN4 domain-containing protein	NA	NA	NA	NA	NA
WP_015213530.1|1618229_1619339_+	alkene reductase	NA	NA	NA	NA	NA
WP_015213531.1|1619982_1620684_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015213532.1|1620842_1621757_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_015213533.1|1621816_1622824_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015213534.1|1623290_1624856_+	B12-binding domain-containing radical SAM protein	NA	A0A0M4R1U9	Streptomyces_phage	24.2	7.9e-10
WP_015213535.1|1625013_1625463_+	SRPBCC family protein	NA	NA	NA	NA	NA
1625516:1625534	attL	AACCAGGATTAAATGCAAC	NA	NA	NA	NA
WP_015213536.1|1625877_1626447_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.4	1.6e-40
WP_085930373.1|1626451_1628098_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015213538.1|1628087_1629059_+	ExeA family protein	NA	NA	NA	NA	NA
WP_015213539.1|1629605_1630211_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
1629137:1629155	attR	GTTGCATTTAATCCTGGTT	NA	NA	NA	NA
WP_015213540.1|1630361_1630904_+	DUF2231 domain-containing protein	NA	NA	NA	NA	NA
WP_081593738.1|1631239_1633225_-	hypothetical protein	NA	E5ES62	Bathycoccus_sp._RCC1105_virus	30.9	3.4e-50
WP_015213542.1|1633617_1634919_-	EndoU domain-containing protein	NA	NA	NA	NA	NA
WP_150111077.1|1635495_1636719_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_019771	Anabaena cylindrica PCC 7122, complete sequence	6395836	2393342	2430932	6395836	integrase,tail,transposase	unidentified_phage(25.0%)	31	2421938:2421956	2439199:2439217
WP_171815821.1|2393342_2398550_-|tail	lamin tail domain-containing protein	tail	NA	NA	NA	NA
WP_015214224.1|2400361_2401327_-	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_015214225.1|2401544_2401730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214226.1|2402454_2403915_+	nitrogenase cofactor biosynthesis protein NifB	NA	NA	NA	NA	NA
WP_015214227.1|2404017_2404356_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_042465921.1|2404519_2405785_+	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	40.8	2.9e-39
WP_015214229.1|2405893_2406808_+	Fe-S cluster assembly protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	47.2	6.2e-23
WP_081593676.1|2407011_2407452_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015214230.1|2407837_2408236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015212319.1|2408380_2409601_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_150111003.1|2409786_2410053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214231.1|2410214_2410493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465925.1|2410582_2410843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214233.1|2410835_2411255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214234.1|2411403_2411646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214235.1|2411638_2413066_-|integrase	phage integrase XisA	integrase	NA	NA	NA	NA
WP_015214236.1|2413774_2414704_+	nitrogenase	NA	NA	NA	NA	NA
WP_015214237.1|2414798_2416202_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015213536.1|2418678_2419248_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.4	1.6e-40
WP_085930373.1|2419252_2420899_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015213538.1|2420888_2421860_+	ExeA family protein	NA	NA	NA	NA	NA
2421938:2421956	attL	GTTGCATTTAATCCTGGTT	NA	NA	NA	NA
WP_042464840.1|2422162_2422351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015214239.1|2422387_2422804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214240.1|2422901_2423372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015214241.1|2423713_2424988_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_150111088.1|2425436_2427335_+	plasmid recombination protein	NA	NA	NA	NA	NA
WP_015214243.1|2427586_2427808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464843.1|2427797_2428217_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_015214245.1|2428597_2428891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214246.1|2428964_2429717_-	sigma-70 region 4 domain-containing protein	NA	NA	NA	NA	NA
WP_015214247.1|2429912_2430932_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H3V0V1	Geobacillus_virus	21.8	5.0e-05
2439199:2439217	attR	AACCAGGATTAAATGCAAC	NA	NA	NA	NA
>prophage 5
NC_019771	Anabaena cylindrica PCC 7122, complete sequence	6395836	2440309	2503104	6395836	integrase,transposase	Enterobacteria_phage(20.0%)	59	2432104:2432155	2495008:2495059
2432104:2432155	attL	CAGGGTTAGCGCATCTCAAACCCTATTGACAGGGGAATTACAGTAGAGGAGA	NA	NA	NA	NA
WP_085930373.1|2440309_2441956_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015213536.1|2441960_2442530_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.4	1.6e-40
WP_015214253.1|2442922_2443345_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015214254.1|2443971_2444364_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	35.0	2.3e-06
WP_015214255.1|2444360_2444585_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015214256.1|2444881_2446606_+	VWD domain-containing protein	NA	NA	NA	NA	NA
WP_081593742.1|2446969_2447221_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_015214259.1|2447460_2448189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214260.1|2448185_2449142_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_052334519.1|2449237_2450872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171815786.1|2454952_2455120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214261.1|2455422_2455665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214263.1|2456121_2456775_+	AAA family ATPase	NA	B0ZSI1	Halomonas_phage	44.5	1.1e-42
WP_015214264.1|2456761_2457031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214265.1|2457156_2457429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214267.1|2457912_2458995_-	photosystem II q(b) protein	NA	A0A127KM98	Cyanophage	88.0	1.6e-190
WP_150111091.1|2459209_2459518_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_015214269.1|2459976_2460486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214270.1|2461138_2461936_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_150111092.1|2461984_2463208_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_015214272.1|2463929_2464526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214273.1|2464787_2465228_+	cyanase	NA	NA	NA	NA	NA
WP_150111005.1|2465458_2465764_+	fertility inhibition FinO-like protein	NA	A0A2H4PAR5	Aphanizomenon_phage	50.9	8.7e-22
WP_150111093.1|2466513_2469597_+	DUF3854 domain-containing protein	NA	B0ZSI4	Halomonas_phage	23.2	1.1e-10
WP_015214276.1|2470362_2470899_+	HNH endonuclease	NA	F5B475	Synechococcus_phage	38.5	1.3e-20
WP_015214277.1|2472086_2472863_+	HNH endonuclease	NA	W0TWB1	Staphylococcus_phage	60.5	7.9e-19
WP_015213536.1|2474102_2474672_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.4	1.6e-40
WP_085930377.1|2474676_2476323_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_015214279.1|2477479_2478643_-	DUF3854 domain-containing protein	NA	NA	NA	NA	NA
WP_015214280.1|2478914_2479235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015214281.1|2479968_2480235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214282.1|2480395_2480665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214283.1|2480712_2480982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464852.1|2481063_2481390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214284.1|2481649_2482054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015214286.1|2482360_2482660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015214287.1|2482663_2482981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015214288.1|2482980_2483253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015214289.1|2483230_2483821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015214290.1|2483861_2484227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015214291.1|2484412_2485057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015214292.1|2485058_2485940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171815822.1|2485940_2487950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015214294.1|2488480_2489029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015214295.1|2489028_2489343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015214296.1|2490591_2491215_+	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_015214297.1|2491390_2492125_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015214298.1|2492190_2492766_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015214299.1|2492871_2493387_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	36.4	4.6e-15
WP_015214300.1|2493542_2494121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171815787.1|2495050_2496583_-	slipin family protein	NA	NA	NA	NA	NA
2495008:2495059	attR	TCTCCTCTACTGTAATTCCCCTGTCAATAGGGTTTGAGATGCGCTAACCCTG	NA	NA	NA	NA
WP_015214302.1|2497373_2497619_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_015214303.1|2497615_2498020_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_015214305.1|2498645_2499248_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_015214306.1|2499260_2499485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015214307.1|2499484_2499904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465955.1|2499896_2500112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015214309.1|2500235_2501465_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_150111077.1|2501880_2503104_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA

