The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019753	Crinalium epipsammum PCC 9333, complete genome	5315554	272982	331280	5315554	tRNA,integrase,transposase	Klosneuvirus(25.0%)	47	283829:283857	349928:349956
WP_015201364.1|272982_274533_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	37.7	7.9e-79
WP_015201365.1|274804_275650_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_015201366.1|275950_277276_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_041226202.1|277450_282526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201368.1|282640_283750_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.6	1.5e-18
283829:283857	attL	TGTAGAGACGTTGCATACAACGTCTCTAC	NA	NA	NA	NA
WP_157462219.1|283858_284623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201370.1|284532_285693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201371.1|285868_286342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201372.1|286503_287040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201373.1|287316_288372_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_015201374.1|288452_290363_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_015201375.1|290569_290839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157462385.1|291098_292763_+	nucleoside:proton symporter	NA	NA	NA	NA	NA
WP_015201377.1|293038_293743_+	glycoside hydrolase family 104 protein	NA	A0A0A0P1Q4	Enterobacteria_phage	41.9	4.6e-18
WP_015201378.1|294012_294681_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015201379.1|294934_296491_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_015201380.1|296510_297065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157462220.1|297169_299356_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_157462221.1|299579_299894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201382.1|299871_301293_-	vanadium-dependent haloperoxidase	NA	A0A1V0SKZ4	Klosneuvirus	30.3	5.6e-31
WP_015201383.1|302072_302627_+	ferric reductase	NA	NA	NA	NA	NA
WP_015201384.1|302697_304116_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_015201385.1|304184_304502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201386.1|304703_305402_+	NGG1p interacting factor 3 protein, NIF3	NA	NA	NA	NA	NA
WP_015201387.1|305741_306158_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_015201388.1|306376_306871_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_015201389.1|306958_307741_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_015201390.1|308087_308342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201391.1|308494_309442_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	37.9	2.4e-46
WP_083890012.1|309589_310177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201328.1|310138_311347_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3UZC2	Geobacillus_virus	45.7	4.0e-78
WP_015201392.1|312946_314278_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_015201393.1|314677_316396_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_157462386.1|316482_317139_-	DUF3120 domain-containing protein	NA	NA	NA	NA	NA
WP_157462387.1|317611_318550_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_012411495.1|318845_319091_+	photosystem I iron-sulfur center protein PsaC	NA	C7EDU4	uncultured_marine_virus	92.6	5.3e-22
WP_015201396.1|319346_321245_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	39.1	3.7e-110
WP_015201397.1|321771_322023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201398.1|322248_323055_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_157462222.1|323088_323247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051035311.1|323314_325246_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015201399.1|325235_326834_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015201400.1|326848_327748_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041225819.1|328100_328412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201401.1|328431_329106_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_015201402.1|329102_330521_+|transposase	ISKra4-like element ISCep1 family transposase	transposase	NA	NA	NA	NA
WP_015201403.1|330647_331280_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
349928:349956	attR	GTAGAGACGTTGTATGCAACGTCTCTACA	NA	NA	NA	NA
>prophage 2
NC_019753	Crinalium epipsammum PCC 9333, complete genome	5315554	463266	513697	5315554	integrase,protease,transposase	Pectobacterium_phage(14.29%)	56	484077:484096	517239:517258
WP_157462228.1|463266_463479_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015201501.1|463813_464497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201503.1|465625_465943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201504.1|466095_466395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201505.1|466515_466845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201506.1|466845_468855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201507.1|468982_469483_+	DUF1273 family protein	NA	A0A1P8L625	Pectobacterium_phage	49.1	7.3e-34
WP_015201508.1|469856_470618_+	ParA family protein	NA	Q8JL10	Natrialba_phage	30.8	1.8e-15
WP_015201509.1|470618_471605_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHY8	Gordonia_phage	36.8	7.2e-09
WP_015201510.1|471668_471911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201511.1|472021_472420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201512.1|472472_473252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083890044.1|473248_474004_-	mobilization protein MobD	NA	NA	NA	NA	NA
WP_015201514.1|474633_475092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201515.1|475091_476321_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_157462229.1|476746_476947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201516.1|477008_477395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201517.1|477626_477938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051035327.1|478996_479338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201518.1|479521_480628_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_051035328.1|480599_481007_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015201519.1|481583_482411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201520.1|482561_482969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157462391.1|483774_484266_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
484077:484096	attL	AAACCAAATCAGTGATGTGA	NA	NA	NA	NA
WP_157462392.1|484433_484967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201523.1|485278_485692_+	XisH protein	NA	NA	NA	NA	NA
WP_015201524.1|485679_486042_+	XisI protein	NA	NA	NA	NA	NA
WP_015201525.1|486101_486437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083890046.1|486854_488153_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_015201527.1|489367_489748_-|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_015201528.1|489744_490017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051035329.1|490252_491707_+	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	25.5	1.7e-14
WP_015201529.1|491678_492785_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_083890015.1|492783_493056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201530.1|493143_494541_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	37.5	7.4e-52
WP_015201531.1|494537_495491_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_157462231.1|495644_495863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201532.1|495985_496387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201533.1|496506_496875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201534.1|496892_497603_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_015201535.1|497586_497985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201536.1|498120_498765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201537.1|498815_500795_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_157462393.1|501182_502151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201539.1|502360_502540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201540.1|502563_502743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201541.1|502839_503574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157462394.1|503575_505399_-	M23 family peptidase	NA	NA	NA	NA	NA
WP_041225841.1|505795_506143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201544.1|506244_506622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015180083.1|506899_507349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157462388.1|508689_509019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201545.1|509278_509890_+	class I SAM-dependent methyltransferase	NA	A0A2I7RNS1	Vibrio_phage	36.3	2.2e-24
WP_041225843.1|510246_511578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201547.1|511735_512578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201548.1|512611_513697_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	33.7	3.5e-09
517239:517258	attR	TCACATCACTGATTTGGTTT	NA	NA	NA	NA
>prophage 3
NC_019753	Crinalium epipsammum PCC 9333, complete genome	5315554	548288	584897	5315554	integrase,protease,transposase	uncultured_Mediterranean_phage(33.33%)	24	571553:571567	588059:588073
WP_015179980.1|548288_549188_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_051035332.1|551762_552074_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_015201581.1|552108_552459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083890046.1|552475_553774_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_015201582.1|554159_554672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201583.1|554935_557587_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015201584.1|557854_561433_-|protease	serine protease	protease	NA	NA	NA	NA
WP_015201585.1|561567_562128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201586.1|562230_562416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201587.1|562632_563775_-|protease	serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	30.8	7.8e-07
WP_157462238.1|563915_564137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041226258.1|565543_567091_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_015201591.1|567716_569495_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.0	2.6e-25
WP_015201592.1|569491_570766_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_015201593.1|570784_572185_+	tetratricopeptide repeat protein	NA	A0A2H4UTU3	Bodo_saltans_virus	29.2	1.3e-35
571553:571567	attL	ACAGGCAAACCTGTT	NA	NA	NA	NA
WP_015201594.1|573252_573960_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	39.8	1.8e-14
WP_015201595.1|573961_574708_+	NAD(P)-dependent oxidoreductase	NA	A0A1V0SKV4	Klosneuvirus	25.8	2.7e-08
WP_083890046.1|575143_576442_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_015201596.1|576458_576842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201597.1|576862_577279_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_015201598.1|577265_577523_-	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
WP_015201601.1|577886_581780_-	N-6 DNA methylase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	24.8	2.3e-50
WP_015201602.1|581776_583261_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_083890048.1|583250_584897_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
588059:588073	attR	ACAGGCAAACCTGTT	NA	NA	NA	NA
>prophage 4
NC_019753	Crinalium epipsammum PCC 9333, complete genome	5315554	705439	739903	5315554	integrase,transposase	Bacillus_phage(50.0%)	39	725518:725532	744443:744457
WP_015201693.1|705439_706546_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_041225895.1|706577_707399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201694.1|707515_709063_+	hypothetical protein	NA	A7KV72	Bacillus_phage	32.6	1.2e-34
WP_157462256.1|709074_709623_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_015201696.1|709726_709999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041225897.1|710313_711414_+	SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	40.8	6.7e-40
WP_015201698.1|711523_711916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201699.1|711993_713448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201700.1|713743_714661_+	phage Gp37/Gp68 family protein	NA	U5XHW5	Phormidium_phage	42.4	1.4e-54
WP_015201701.1|714812_715322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201702.1|715458_715659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201703.1|715798_716059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201704.1|716249_716531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201705.1|716918_717224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201706.1|717449_717695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201707.1|717738_717981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201708.1|718068_718398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041226286.1|721812_722124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201711.1|722467_723550_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLI2	Bacillus_phage	32.6	2.4e-10
WP_015201712.1|723554_725438_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015201713.1|725421_726450_+	hypothetical protein	NA	NA	NA	NA	NA
725518:725532	attL	ATTAAAGAAGGTCGT	NA	NA	NA	NA
WP_015201714.1|726492_726972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201715.1|727528_728311_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_015201716.1|728466_728886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201717.1|729113_729653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201718.1|730415_730868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157462257.1|730938_731502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201720.1|731660_731981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083890022.1|732017_732161_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_015201721.1|732274_732565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201722.1|732780_733020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201724.1|733412_734408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015201725.1|734460_734769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015201727.1|735471_735849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157462258.1|735920_736103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157462259.1|736380_736539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157462398.1|736673_737738_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_157462260.1|738241_738799_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015201400.1|739003_739903_-|transposase	transposase	transposase	NA	NA	NA	NA
744443:744457	attR	ACGACCTTCTTTAAT	NA	NA	NA	NA
>prophage 5
NC_019753	Crinalium epipsammum PCC 9333, complete genome	5315554	2310007	2356873	5315554	tRNA,protease,transposase	Bacillus_phage(13.33%)	48	NA	NA
WP_015203025.1|2310007_2311894_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	50.2	7.8e-129
WP_015203026.1|2312675_2313932_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_015203027.1|2314265_2314433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157462307.1|2315220_2315580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015203030.1|2315667_2316126_+	peptidase	NA	NA	NA	NA	NA
WP_015203031.1|2316166_2316952_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_015203032.1|2317181_2317631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015203033.1|2317821_2318958_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.3	5.6e-74
WP_015203034.1|2319004_2319142_+	photosystem II reaction center protein K	NA	NA	NA	NA	NA
WP_015203035.1|2319342_2319900_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_015203036.1|2319916_2320381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015203037.1|2320723_2321116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015203038.1|2321342_2321438_-	photosystem I reaction center subunit XII	NA	NA	NA	NA	NA
WP_015203039.1|2321698_2322454_+	DUF475 domain-containing protein	NA	S5MAL1	Bacillus_phage	32.6	1.9e-22
WP_041226544.1|2322515_2322965_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.7	5.9e-27
WP_015203041.1|2323062_2324130_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_015203042.1|2324221_2325418_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D9J0Y9	Brochothrix_phage	41.1	7.7e-74
WP_015203043.1|2325909_2327286_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_041226008.1|2327477_2327786_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_015203044.1|2327846_2329280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015203045.1|2329430_2332265_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	31.5	8.4e-26
WP_015203046.1|2332380_2332836_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_157462308.1|2333048_2334338_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.4	3.0e-132
WP_015203048.1|2334522_2335767_-|transposase	transposase	transposase	A0A1L2BWT9	Bacteriophage	57.7	1.6e-34
WP_015203049.1|2335971_2337030_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_015203050.1|2337257_2338946_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase RibB/GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	47.5	8.9e-100
WP_015203051.1|2338942_2339974_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015203052.1|2339973_2340282_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_015203053.1|2340522_2341245_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_015203054.1|2341270_2341600_+	DUF2488 family protein	NA	NA	NA	NA	NA
WP_083890060.1|2341703_2342408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041226550.1|2342435_2342891_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_015203057.1|2342925_2343864_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_041226009.1|2343966_2344845_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	3.9e-30
WP_015203059.1|2344943_2345414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015203060.1|2345410_2345854_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_015203061.1|2345940_2346798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157462425.1|2347088_2349755_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.1	1.3e-41
WP_015203063.1|2349853_2350084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015203064.1|2350234_2350453_-	type II toxin-antitoxin system HicB family antitoxin	NA	G9BWD3	Planktothrix_phage	86.1	1.8e-29
WP_015203065.1|2350786_2351152_-|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_015203066.1|2351148_2351421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157462309.1|2351551_2351737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015203068.1|2351844_2353164_-	serine/threonine protein kinase	NA	S4W2F5	Pandoravirus	29.5	2.6e-06
WP_015203069.1|2353312_2354515_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041226010.1|2354810_2355023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015203071.1|2355157_2355553_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	49.2	5.0e-30
WP_015203072.1|2355607_2356873_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	66.7	4.2e-163
>prophage 6
NC_019753	Crinalium epipsammum PCC 9333, complete genome	5315554	4081153	4125722	5315554	integrase,transposase	Microcystis_virus(20.0%)	33	4093884:4093905	4111984:4112005
WP_157462346.1|4081153_4081510_-|transposase	IS200/IS605 family transposase	transposase	A0A7E6	Microcystis_virus	49.2	2.0e-25
WP_015204566.1|4082776_4083964_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A068A1P5	Thermus_phage	33.4	6.5e-49
WP_015204567.1|4084013_4085057_-	hemerythrin	NA	NA	NA	NA	NA
WP_015204568.1|4085271_4086309_-	hemerythrin	NA	NA	NA	NA	NA
WP_015204569.1|4086814_4087558_+	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_015204570.1|4087668_4088187_+	DUF2231 domain-containing protein	NA	NA	NA	NA	NA
WP_015204571.1|4088415_4088838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015204572.1|4089014_4089308_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_015204573.1|4089404_4090319_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015204574.1|4090765_4091863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015204575.1|4091943_4092636_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_015204576.1|4092872_4093334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015204577.1|4093701_4097691_+	cobaltochelatase subunit CobN	NA	NA	NA	NA	NA
4093884:4093905	attL	ACAGTTACAACAACAGTTAACT	NA	NA	NA	NA
WP_015204578.1|4097687_4098479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015204579.1|4098493_4098973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015204580.1|4099233_4101057_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_041226793.1|4101053_4101992_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015179980.1|4105031_4105931_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015179979.1|4106012_4106480_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083890034.1|4106507_4106744_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	47.0	1.8e-11
WP_015204582.1|4106786_4108034_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	27.0	8.8e-20
WP_157462462.1|4108081_4109521_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_015204584.1|4109919_4112964_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	33.7	9.3e-23
4111984:4112005	attR	AGTTAACTGTTGTTGTAACTGT	NA	NA	NA	NA
WP_015204585.1|4113285_4113690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157462347.1|4113962_4114586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015204587.1|4114928_4115495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015204588.1|4115643_4116096_-	nitrate reductase maturation protein NarM	NA	NA	NA	NA	NA
WP_041226794.1|4116119_4116575_-	membrane protein	NA	NA	NA	NA	NA
WP_015204590.1|4116595_4118845_-	nitrate reductase	NA	NA	NA	NA	NA
WP_015204591.1|4119242_4120751_-	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_015204592.1|4120850_4122827_-	ferredoxin--nitrite reductase	NA	NA	NA	NA	NA
WP_015204593.1|4123358_4124693_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015204594.1|4124828_4125722_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_019753	Crinalium epipsammum PCC 9333, complete genome	5315554	4641174	4694588	5315554	transposase	Nostoc_phage(20.0%)	54	NA	NA
WP_083890046.1|4641174_4642473_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157462358.1|4642555_4643464_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015205007.1|4644088_4645567_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.9	6.0e-52
WP_015205008.1|4645683_4646748_-	LOG family protein	NA	NA	NA	NA	NA
WP_157462359.1|4646939_4648091_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A191SB13	Nostoc_phage	81.8	1.2e-180
WP_015205009.1|4648494_4648821_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.6	2.1e-21
WP_015205010.1|4649129_4650293_-	GuaB3 family IMP dehydrogenase-related protein	NA	A0A1B1IS93	uncultured_Mediterranean_phage	33.3	4.8e-12
WP_051035415.1|4650438_4651026_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_015205011.1|4651626_4652178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041226136.1|4652266_4652515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015205012.1|4652529_4652730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083890037.1|4652680_4653001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015205013.1|4653095_4653311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015205014.1|4653307_4653592_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_083890046.1|4655655_4656954_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_051035416.1|4656984_4657848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041226137.1|4657945_4658536_+	DUF3038 domain-containing protein	NA	NA	NA	NA	NA
WP_015205016.1|4658649_4660488_+	DUF4335 domain-containing protein	NA	NA	NA	NA	NA
WP_015205017.1|4660732_4661047_-	carbon dioxide-concentrating mechanism protein CcmK	NA	NA	NA	NA	NA
WP_015205018.1|4661192_4661402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015205019.1|4661466_4661949_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_015205020.1|4661967_4663131_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_015205021.1|4663446_4663830_+	DUF4112 domain-containing protein	NA	NA	NA	NA	NA
WP_015205022.1|4663960_4664380_-	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	42.4	6.8e-17
WP_015205023.1|4664521_4666459_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	5.0e-54
WP_015205024.1|4666758_4668681_+	serine/threonine protein kinase	NA	A0A1V0SBL0	Catovirus	22.5	1.1e-08
WP_015205025.1|4668799_4669480_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_015205026.1|4669525_4670755_+	amidohydrolase	NA	NA	NA	NA	NA
WP_015205027.1|4670930_4671485_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_015205028.1|4671826_4672069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015205029.1|4672156_4672813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015205030.1|4672972_4673788_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_015205031.1|4673957_4674692_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	6.5e-23
WP_083890038.1|4674699_4675512_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_083890046.1|4675726_4677025_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_015205032.1|4677041_4677197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015205033.1|4677590_4678727_-	endoribonuclease L-PSP	NA	NA	NA	NA	NA
WP_015205034.1|4678872_4679304_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_015205035.1|4679501_4681007_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_015205036.1|4681070_4681895_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015205037.1|4681891_4682677_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_157462360.1|4682748_4683486_+	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_015205039.1|4683525_4684404_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_015205040.1|4684510_4685113_-	precorrin-6Y C5,15-methyltransferase subunit CbiT	NA	NA	NA	NA	NA
WP_015205041.1|4685165_4686701_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_015205042.1|4686972_4687203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015205043.1|4687238_4688330_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_015205044.1|4688402_4689059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015205045.1|4689299_4689827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157462470.1|4690044_4690506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015205047.1|4690746_4691097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015205048.1|4691175_4692687_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	39.5	1.0e-99
WP_015205049.1|4692817_4693171_+	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_015205050.1|4693364_4694588_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A191SB13	Nostoc_phage	66.7	2.7e-151
>prophage 8
NC_019753	Crinalium epipsammum PCC 9333, complete genome	5315554	4698168	4763221	5315554	holin,transposase	Bacillus_phage(20.0%)	56	NA	NA
WP_041226862.1|4698168_4698582_+|transposase	IS200/IS605 family transposase	transposase	A0A7E6	Microcystis_virus	47.4	1.2e-29
WP_015205055.1|4698718_4701115_-	NACHT domain-containing NTPase	NA	NA	NA	NA	NA
WP_015205056.1|4701274_4705618_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	38.5	2.2e-57
WP_041226138.1|4705614_4705896_+	response regulator	NA	W8CYM9	Bacillus_phage	40.3	1.7e-08
WP_083890046.1|4705920_4707219_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_071881132.1|4707397_4707646_+	response regulator	NA	NA	NA	NA	NA
WP_015205057.1|4707930_4708248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015205058.1|4708404_4708740_-	ribulose bisphosphate carboxylase small subunit	NA	NA	NA	NA	NA
WP_015205059.1|4708786_4709197_-	chaperonin family protein RbcX	NA	NA	NA	NA	NA
WP_015205060.1|4709289_4710720_-	form I ribulose bisphosphate carboxylase large subunit	NA	NA	NA	NA	NA
WP_015205061.1|4711217_4711991_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_015205062.1|4712469_4712670_+	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	54.4	4.5e-11
WP_015205063.1|4712659_4712878_+	HicB family protein	NA	A0A0A7S1E5	Clostridium_phage	49.2	1.6e-06
WP_015205064.1|4712966_4714730_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_015205065.1|4714972_4715494_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_015205066.1|4715664_4717224_+	DUF697 domain-containing protein	NA	NA	NA	NA	NA
WP_015205067.1|4717414_4717990_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015205069.1|4718310_4719249_-	putative 2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_015205071.1|4719612_4720614_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.2	2.6e-30
WP_015205072.1|4720901_4721318_+	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_015205073.1|4721434_4722892_-	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_015205074.1|4723514_4723913_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041226140.1|4723997_4724177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015205076.1|4724219_4724480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015205077.1|4724685_4725240_+	DUF2854 domain-containing protein	NA	NA	NA	NA	NA
WP_015205078.1|4725412_4725670_-	chlororespiratory reduction protein 7	NA	NA	NA	NA	NA
WP_015205079.1|4725751_4727191_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	61.6	9.1e-170
WP_015205080.1|4727238_4727949_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_051035467.1|4728131_4728773_+	VanW family protein	NA	NA	NA	NA	NA
WP_015205082.1|4728882_4731534_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	33.8	1.5e-114
WP_083890071.1|4731864_4732959_-|transposase	transposase	transposase	A0A1V0S8G3	Catovirus	31.2	6.1e-25
WP_015205084.1|4732936_4733512_-|transposase	IS607 family transposase	transposase	A7RAM3	Paramecium_bursaria_Chlorella_virus	44.3	5.2e-36
WP_015205085.1|4733553_4733883_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015205086.1|4733925_4734267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015205087.1|4734337_4738660_-	response regulator	NA	W8CYF6	Bacillus_phage	34.5	7.5e-26
WP_015205088.1|4738769_4741043_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	32.3	1.3e-24
WP_071881134.1|4741097_4741292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015205089.1|4741487_4741853_+	DUF1830 domain-containing protein	NA	NA	NA	NA	NA
WP_015205090.1|4741909_4742212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157462361.1|4742274_4742475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015205091.1|4742485_4743172_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015205092.1|4743375_4744953_+	NAD(P)H-quinone oxidoreductase subunit N	NA	NA	NA	NA	NA
WP_015205093.1|4745251_4745578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015205094.1|4745815_4748140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015205095.1|4748341_4749628_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_015205096.1|4749620_4750226_+	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_015205097.1|4750435_4751275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041226142.1|4751271_4752333_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_015205098.1|4752668_4754714_-	restriction endonuclease subunit M	NA	A0A142K7G3	Mycobacterium_phage	29.0	4.0e-38
WP_015205099.1|4754927_4756907_+	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_015205100.1|4756994_4757342_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_015205101.1|4757434_4758562_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_015205102.1|4759016_4760288_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	25.7	1.4e-33
WP_015205103.1|4760355_4761660_+	insulinase family protein	NA	NA	NA	NA	NA
WP_015205104.1|4761734_4761896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015205105.1|4761925_4763221_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWT9	Bacteriophage	34.6	9.4e-09
>prophage 9
NC_019753	Crinalium epipsammum PCC 9333, complete genome	5315554	5309437	5315487	5315554	tRNA	Caulobacter_phage(50.0%)	6	NA	NA
WP_015205565.1|5309437_5311195_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	37.3	1.1e-97
WP_015205567.1|5311421_5312675_-	stress protein	NA	K4JRX3	Caulobacter_phage	41.2	1.1e-33
WP_015205568.1|5312798_5313371_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	44.9	1.9e-38
WP_015205569.1|5313428_5314031_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	29.2	2.6e-17
WP_015205570.1|5314043_5314619_-	TerD family protein	NA	A0A2I7QY15	Vibrio_phage	34.0	6.9e-20
WP_015205571.1|5314962_5315487_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	34.6	2.0e-13
