The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019702	Synechococcus sp. PCC 7502, complete sequence	3510253	914610	970962	3510253	tRNA,protease,transposase	Agrobacterium_phage(28.57%)	53	NA	NA
WP_015167696.1|914610_915636_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.3	2.4e-63
WP_144050172.1|915677_915860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015167697.1|916916_917216_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_015167698.1|917262_917511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015167699.1|917528_918299_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_015167700.1|918553_919483_+	heme A synthase	NA	NA	NA	NA	NA
WP_015167701.1|919524_920481_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_015167702.1|920628_923214_+	alpha-glucan family phosphorylase	NA	NA	NA	NA	NA
WP_015167703.1|923297_923879_-	dCTP deaminase	NA	A0A191SAT9	Nostoc_phage	62.9	1.7e-66
WP_015167704.1|924048_924624_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015167705.1|924627_925449_+	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_015167706.1|925546_927799_+	lysophospholipase L1-like esterase	NA	NA	NA	NA	NA
WP_015167707.1|927812_928967_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015167708.1|929174_930509_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015167709.1|930505_932320_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015167710.1|932312_934517_-	O-linked N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_015167711.1|935062_935725_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_041429896.1|935935_936586_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_168130308.1|937154_937319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041429164.1|937581_937893_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429717.1|937885_938431_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015167714.1|938449_939586_-	transaldolase	NA	NA	NA	NA	NA
WP_015167715.1|939737_941861_-	DUF4384 domain-containing protein	NA	NA	NA	NA	NA
WP_015167716.1|942175_943183_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A1V0SLA0	Klosneuvirus	40.5	2.3e-34
WP_015167717.1|943309_943522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015167718.1|943675_944557_-	asparaginase	NA	NA	NA	NA	NA
WP_015167719.1|944691_946038_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_015167720.1|946354_946657_+	small integral membrane protein	NA	NA	NA	NA	NA
WP_015167721.1|946697_948140_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_015167722.1|948125_949715_-	transglutaminase	NA	NA	NA	NA	NA
WP_015167723.1|949914_950541_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_015167724.1|950589_951231_-	ribonuclease D	NA	NA	NA	NA	NA
WP_015167725.1|951429_951951_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_041429902.1|951980_952859_-	ATP-sensitive inward rectifier potassium channel 10	NA	NA	NA	NA	NA
WP_015167727.1|953109_954621_+	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_015167728.1|954898_955690_+	ParA family protein	NA	A0A240F4U1	Ochrobactrum_phage	27.8	2.0e-06
WP_015167729.1|955682_956579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015167730.1|956599_957091_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_015167731.1|957387_958695_+	response regulator	NA	NA	NA	NA	NA
WP_015167732.1|958730_959147_+	chemotaxis signal transduction protein	NA	NA	NA	NA	NA
WP_015167733.1|959160_959598_-	DUF29 family protein	NA	NA	NA	NA	NA
WP_144050263.1|959658_961839_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_015167735.1|962040_962481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015167736.1|962684_962939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015167737.1|963004_964579_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015167738.1|964568_964742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015167739.1|964704_966594_-	EAL domain-containing response regulator	NA	W8CYM9	Bacillus_phage	41.5	6.8e-16
WP_015167740.1|966736_967948_-	peptidase M50	NA	NA	NA	NA	NA
WP_015167741.1|968042_968639_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	53.1	1.7e-45
WP_015167742.1|968714_969362_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	37.0	1.7e-27
WP_015167743.1|969428_969755_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_041429239.1|969758_970361_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_015167745.1|970380_970962_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NC_019702	Synechococcus sp. PCC 7502, complete sequence	3510253	1198406	1262309	3510253	tRNA,protease,transposase,integrase	Hokovirus(23.08%)	50	1221345:1221361	1266448:1266464
WP_015167949.1|1198406_1199921_-|protease	serine protease	protease	NA	NA	NA	NA
WP_144050269.1|1200190_1200541_+	ferredoxin	NA	NA	NA	NA	NA
WP_015167952.1|1200984_1202262_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_015167953.1|1202254_1202881_+	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_144050176.1|1202877_1203300_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_015167955.1|1203303_1204242_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	1.1e-06
WP_015167956.1|1204285_1204714_-	DUF29 family protein	NA	NA	NA	NA	NA
WP_015167957.1|1204868_1206863_-	transketolase	NA	NA	NA	NA	NA
WP_015167958.1|1206967_1207645_-	DUF4337 domain-containing protein	NA	NA	NA	NA	NA
WP_015167959.1|1207800_1209705_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	26.1	3.2e-45
WP_015167960.1|1209828_1210203_-	EamA family transporter	NA	NA	NA	NA	NA
WP_015167961.1|1210607_1211105_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_015167962.1|1211220_1211709_-	AAA family ATPase	NA	U5J9W1	Bacillus_phage	32.9	2.2e-11
WP_015167963.1|1211738_1213481_-	GGDEF domain-containing response regulator	NA	G3MA91	Bacillus_virus	31.1	2.2e-16
WP_015167964.1|1213546_1215916_-	response regulator	NA	A0A1V0SGX0	Hokovirus	38.2	2.1e-59
WP_015167965.1|1215927_1218858_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	2.0e-38
WP_015167966.1|1219009_1220707_+	circadian clock protein KaiC	NA	A0A1S5RGT0	Helicobacter_phage	47.3	2.9e-05
WP_015167967.1|1220747_1221068_+	KaiB domain-containing protein	NA	NA	NA	NA	NA
WP_015167968.1|1221145_1224955_-	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	32.7	1.7e-42
1221345:1221361	attL	GGCATTTGAATATCCAT	NA	NA	NA	NA
WP_144050270.1|1224966_1227480_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	29.0	1.0e-35
WP_041429275.1|1230404_1230620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015167970.1|1230609_1232421_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.7	1.6e-25
WP_015167971.1|1232525_1233743_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase RibB/GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	1.1e-102
WP_015167972.1|1233833_1235006_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_015167973.1|1235150_1235963_+	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_015167974.1|1236108_1237221_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_015167975.1|1237517_1238027_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_015167976.1|1238097_1238343_-	TIGR02450 family Trp-rich protein	NA	NA	NA	NA	NA
WP_015167977.1|1238415_1239054_+	RDD family protein	NA	NA	NA	NA	NA
WP_015167978.1|1239075_1239465_-	RidA family protein	NA	NA	NA	NA	NA
WP_015167979.1|1239490_1240774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015167980.1|1240783_1241953_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_041429993.1|1242282_1243887_+	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
WP_015167982.1|1244040_1245291_-	DUF4912 domain-containing protein	NA	NA	NA	NA	NA
WP_015167983.1|1245744_1246227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015167984.1|1246238_1246862_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_015167985.1|1246902_1249416_-	DNA topoisomerase 4 subunit A	NA	G3M9Z5	Bacillus_virus	34.8	2.2e-102
WP_015167986.1|1249528_1249735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015167987.1|1250036_1251194_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.3	9.2e-56
WP_015167988.1|1251257_1251896_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_015168729.1|1254046_1254358_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081581045.1|1255506_1255740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041429278.1|1255736_1256039_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015167992.1|1256100_1257261_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_015167993.1|1257568_1257736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168135.1|1257786_1258098_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429994.1|1258090_1258636_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015167995.1|1258944_1260330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015167996.1|1260524_1261127_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_015167997.1|1261166_1262309_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1266448:1266464	attR	ATGGATATTCAAATGCC	NA	NA	NA	NA
>prophage 3
NC_019702	Synechococcus sp. PCC 7502, complete sequence	3510253	1393958	1422671	3510253	tRNA,transposase,integrase	Liberibacter_phage(50.0%)	29	1410538:1410596	1426800:1426858
WP_015168135.1|1393958_1394270_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015168114.1|1394415_1395798_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_015168115.1|1395893_1396328_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_015168116.1|1396324_1396804_-	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_015168117.1|1396884_1397253_+	DUF2237 domain-containing protein	NA	NA	NA	NA	NA
WP_015168118.1|1397242_1397659_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_015168119.1|1397858_1398569_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015168120.1|1398977_1402235_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_015168121.1|1402293_1402911_+	precorrin-8X methylmutase	NA	NA	NA	NA	NA
WP_015168122.1|1402936_1403758_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015168123.1|1403780_1404395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168124.1|1404428_1405670_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_015168125.1|1405760_1406630_+	6-pyruvoyltetrahydropterin synthase	NA	NA	NA	NA	NA
WP_015168126.1|1406650_1407352_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015168127.1|1407362_1407728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168128.1|1408795_1409434_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015168129.1|1409450_1410353_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
1410538:1410596	attL	GTTAGAGCACCGCCCTGTCACGGCGGAAGTTGCGGGTTCGAGCCCCGTCAATCCCGTTC	NA	NA	NA	NA
WP_015168130.1|1410769_1411873_+|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	21.9	2.8e-09
WP_015168131.1|1412278_1415014_+	hypothetical protein	NA	H9YS02	environmental_Halophage	31.1	1.5e-101
WP_051023590.1|1415288_1417226_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.1	9.4e-37
WP_041430016.1|1417222_1417768_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429164.1|1417760_1418072_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041430017.1|1418118_1419363_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.3	1.2e-24
WP_015168132.1|1419365_1419740_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_015168133.1|1419736_1420060_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015168134.1|1420065_1421319_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_144050178.1|1421326_1421758_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_015168135.1|1421767_1422079_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429717.1|1422125_1422671_-|transposase	transposase	transposase	NA	NA	NA	NA
1426800:1426858	attR	GTTAGAGCACCGCCCTGTCACGGCGGAAGTTGCGGGTTCGAGCCCCGTCAATCCCGTTC	NA	NA	NA	NA
>prophage 4
NC_019702	Synechococcus sp. PCC 7502, complete sequence	3510253	1459695	1502589	3510253	integrase,transposase	Planktothrix_phage(66.67%)	56	1494406:1494420	1504414:1504428
WP_041429297.1|1459695_1459998_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168130331.1|1461279_1461426_+	DUF4326 domain-containing protein	NA	NA	NA	NA	NA
WP_015168165.1|1461850_1462090_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015168166.1|1462082_1462463_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_144050180.1|1462502_1463066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168135.1|1464240_1464552_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429994.1|1464544_1465090_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429301.1|1465073_1465496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041430023.1|1465800_1466844_-	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_015168168.1|1466930_1467551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168130333.1|1467581_1467743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168170.1|1467847_1468432_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_015168171.1|1468649_1469555_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015168172.1|1469765_1469948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168173.1|1470068_1470713_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015168174.1|1470905_1471307_+	response regulator	NA	W8CYM9	Bacillus_phage	33.3	1.4e-11
WP_015168175.1|1471635_1475763_+	WD40 repeat-containing protein	NA	NA	NA	NA	NA
WP_015168176.1|1475747_1476038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168177.1|1476077_1477178_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015168178.1|1477499_1478573_-	DUF2817 domain-containing protein	NA	NA	NA	NA	NA
WP_144050181.1|1478582_1479509_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_015168180.1|1479533_1480973_-	MFS transporter	NA	NA	NA	NA	NA
WP_015168181.1|1480984_1481167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168182.1|1481637_1481916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144050182.1|1481936_1482182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168184.1|1483324_1483651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168186.1|1484728_1485736_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144050183.1|1485841_1486039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051023593.1|1486069_1486453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168187.1|1486538_1487234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168188.1|1487268_1487505_+	toxin-antitoxin (TA) system antitoxin	NA	NA	NA	NA	NA
WP_015168189.1|1487511_1487898_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_015168190.1|1487932_1488454_+	siphovirus Gp157 family protein	NA	NA	NA	NA	NA
WP_015168191.1|1488498_1488846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168192.1|1488867_1489212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168193.1|1489277_1489460_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015168194.1|1489584_1490316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081581090.1|1491055_1491415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168196.1|1491418_1491919_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_168130335.1|1491923_1492085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168198.1|1492081_1492330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168199.1|1492326_1493079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168200.1|1493235_1494357_-|integrase	site-specific integrase	integrase	G9BWC1	Planktothrix_phage	41.9	1.4e-72
1494406:1494420	attL	ATCGGGTAATTCCCA	NA	NA	NA	NA
WP_041429305.1|1494672_1494870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168202.1|1494898_1495183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168203.1|1495172_1495394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168204.1|1495497_1496196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168205.1|1496420_1496606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168206.1|1496754_1497090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168207.1|1497279_1497918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168208.1|1497960_1498236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168209.1|1498262_1498475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168210.1|1498487_1499009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168211.1|1499232_1500099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168212.1|1500102_1501206_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015168213.1|1501488_1502589_+|integrase	tyrosine-type recombinase/integrase	integrase	G9BWC1	Planktothrix_phage	35.8	1.7e-59
1504414:1504428	attR	TGGGAATTACCCGAT	NA	NA	NA	NA
>prophage 5
NC_019702	Synechococcus sp. PCC 7502, complete sequence	3510253	1992107	2046296	3510253	tRNA,protease,transposase	Cafeteria_roenbergensis_virus(12.5%)	48	NA	NA
WP_015168672.1|1992107_1994138_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015168673.1|1994175_1995708_-	deoxyribodipyrimidine photolyase-like protein	NA	E3T4R9	Cafeteria_roenbergensis_virus	31.1	2.5e-69
WP_015168674.1|1995796_1996732_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	31.8	2.6e-40
WP_015168675.1|1996743_1999449_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.7	1.0e-44
WP_015168676.1|1999543_1999834_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015168677.1|1999833_2000061_-	addiction module protein	NA	NA	NA	NA	NA
WP_015168678.1|2000273_2002673_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.6	6.2e-155
WP_015168679.1|2003092_2004478_+	ATP-binding protein	NA	A0A2I7RNF1	Vibrio_phage	28.7	6.5e-48
WP_015168680.1|2004477_2004942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041429717.1|2004912_2005458_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429164.1|2005450_2005762_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015168681.1|2006175_2009700_-	methionine synthase	NA	NA	NA	NA	NA
WP_015168682.1|2009961_2010447_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_015168683.1|2010508_2010880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168684.1|2010876_2011479_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015168685.1|2011655_2012285_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_015168686.1|2012287_2012755_-	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_015168687.1|2012953_2016670_+	cobaltochelatase subunit CobN	NA	NA	NA	NA	NA
WP_015168688.1|2016820_2017573_+	glycoside hydrolase family 104 protein	NA	NA	NA	NA	NA
WP_015168689.1|2017732_2018692_+	NTF2 domain-containing protein	NA	NA	NA	NA	NA
WP_015168690.1|2018865_2019876_-	adenosyl-hopene transferase HpnH	NA	NA	NA	NA	NA
WP_015168691.1|2019977_2020964_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2C9DSV6	Western_grey_kangaroopox_virus	27.6	6.3e-13
WP_015168692.1|2021074_2021365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041429353.1|2021447_2021873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168693.1|2021856_2022360_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041429717.1|2022343_2022889_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429164.1|2022881_2023193_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015167904.1|2023269_2023836_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_015168694.1|2024105_2024771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168695.1|2025042_2027658_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_015168696.1|2027669_2028149_-	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_015168697.1|2028188_2028461_+	chlororespiratory reduction protein 7	NA	NA	NA	NA	NA
WP_015168698.1|2028434_2029679_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015168699.1|2029913_2030081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168700.1|2030120_2030393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168701.1|2030481_2030886_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_015168702.1|2031206_2031668_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041430102.1|2031704_2032643_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_081581093.1|2033083_2033725_-	CIA30 family protein	NA	NA	NA	NA	NA
WP_015168705.1|2034147_2035470_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015168706.1|2035484_2036108_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_015168707.1|2036258_2037674_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	M4QGJ9	Cyanophage	31.6	9.0e-29
WP_015168708.1|2037859_2039797_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_015168709.1|2039808_2040408_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_015168710.1|2040774_2041170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168711.1|2041220_2042465_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_015168713.1|2043161_2044079_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_015168714.1|2044409_2046296_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	49.3	4.1e-130
>prophage 6
NC_019702	Synechococcus sp. PCC 7502, complete sequence	3510253	2051234	2084492	3510253	transposase,tail	Hokovirus(50.0%)	41	NA	NA
WP_015168723.1|2051234_2052557_-|tail	low-complexity tail membrane protein	tail	NA	NA	NA	NA
WP_015168724.1|2052610_2054164_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_015168725.1|2054280_2055516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168726.1|2055508_2056102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144050197.1|2056085_2056652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168728.1|2056680_2057103_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_015168729.1|2057267_2057579_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081581052.1|2058125_2058278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168730.1|2058288_2058753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168731.1|2058800_2059295_-	DUF1269 domain-containing protein	NA	NA	NA	NA	NA
WP_015168732.1|2059354_2060764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168733.1|2060858_2061059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168734.1|2061195_2061477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168735.1|2061533_2061977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168736.1|2062275_2062746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168737.1|2062816_2063062_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_015168738.1|2063116_2063707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168739.1|2064096_2066424_+	NACHT domain-containing NTPase	NA	NA	NA	NA	NA
WP_015168740.1|2066631_2067111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168741.1|2067171_2067675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168742.1|2067730_2068291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168743.1|2068430_2068937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041429360.1|2068988_2069606_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_015168744.1|2069588_2072243_-	response regulator	NA	A0A1V0SGX0	Hokovirus	36.3	1.8e-54
WP_015168745.1|2072403_2073375_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015168746.1|2073391_2074606_-	dihydroorotase	NA	NA	NA	NA	NA
WP_015168747.1|2074609_2075464_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_015168748.1|2075468_2076179_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_015168749.1|2076175_2076685_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_015168750.1|2076685_2076901_-	DUF2839 domain-containing protein	NA	NA	NA	NA	NA
WP_015168751.1|2077120_2077510_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_015168752.1|2077493_2077703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168753.1|2077882_2078206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051023612.1|2078211_2078643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051023613.1|2078721_2078946_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015168754.1|2079209_2079929_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	40.7	3.0e-41
WP_015168755.1|2080090_2082043_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_015168756.1|2082043_2082802_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_015168757.1|2082841_2083624_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_041429717.1|2083642_2084188_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429164.1|2084180_2084492_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_019702	Synechococcus sp. PCC 7502, complete sequence	3510253	2305546	2354055	3510253	transposase	Streptococcus_phage(14.29%)	46	NA	NA
WP_015168135.1|2305546_2305858_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168130285.1|2305881_2306043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168967.1|2306069_2306504_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_144050290.1|2306873_2307869_-	magnesium chelatase ATPase subunit I	NA	NA	NA	NA	NA
WP_015168969.1|2308259_2309561_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.9	5.7e-38
WP_041430132.1|2309630_2310824_-	glycosyltransferase	NA	G9E5U5	Micromonas_pusilla_virus	39.0	4.0e-06
WP_015168971.1|2310999_2311536_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_015168972.1|2311602_2311788_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015168973.1|2311784_2312924_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_015168974.1|2313134_2313656_+	KGK domain-containing protein	NA	NA	NA	NA	NA
WP_015168975.1|2313898_2315665_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015168976.1|2315818_2318008_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_015168977.1|2318059_2318179_+	photosystem II reaction centre X protein (PsbX)	NA	NA	NA	NA	NA
WP_015168978.1|2318418_2319123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168979.1|2319283_2320975_+	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	25.6	1.2e-11
WP_015168980.1|2320974_2321355_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_015168981.1|2321467_2321908_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_015168982.1|2321960_2323199_+	transcription termination factor NusA	NA	NA	NA	NA	NA
WP_015168983.1|2323188_2323434_+	YlxR family protein	NA	NA	NA	NA	NA
WP_015168984.1|2323426_2325085_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_015168985.1|2325238_2328880_+	N-6 DNA methylase	NA	A0A2I6UHU5	Bacillus_phage	31.4	6.3e-10
WP_015168986.1|2328942_2329185_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_015168987.1|2329181_2329547_+	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_015168988.1|2329670_2331257_+	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	33.7	1.3e-12
WP_015168989.1|2331300_2331873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144050291.1|2332157_2332301_-	lmo0937 family membrane protein	NA	NA	NA	NA	NA
WP_015168991.1|2333555_2333738_-	CsbD family protein	NA	NA	NA	NA	NA
WP_015168992.1|2333901_2334660_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_015168993.1|2334692_2335160_-	DUF29 domain-containing protein	NA	NA	NA	NA	NA
WP_144050209.1|2335300_2335498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168995.1|2336166_2338194_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	46.4	3.1e-131
WP_144050210.1|2338671_2339535_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_041430135.1|2339522_2340395_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_015168998.1|2340529_2341402_-	vitamin K epoxide reductase family protein	NA	NA	NA	NA	NA
WP_015168999.1|2341776_2343207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169000.1|2343203_2343845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015168729.1|2343914_2344226_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081581058.1|2344167_2344764_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429423.1|2344734_2345196_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041429425.1|2345303_2345615_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429717.1|2345607_2346153_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015169001.1|2346136_2347702_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_144050212.1|2348253_2348607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169003.1|2348606_2348798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169005.1|2351339_2353364_-	DNA primase	NA	C7F4F5	Cyanophage	27.1	3.3e-40
WP_015168729.1|2353743_2354055_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_019702	Synechococcus sp. PCC 7502, complete sequence	3510253	2477400	2531313	3510253	transposase	Ralstonia_phage(20.0%)	59	NA	NA
WP_015168135.1|2477400_2477712_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015169129.1|2478400_2479408_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_015169130.1|2479589_2479811_+	DUF4327 family protein	NA	NA	NA	NA	NA
WP_041430157.1|2480100_2480949_+	cyanophycinase	NA	NA	NA	NA	NA
WP_015169132.1|2480982_2482209_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_015169133.1|2483421_2484198_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015169134.1|2484350_2484605_-	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_015169135.1|2484912_2485827_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_015169136.1|2485904_2486369_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_015169137.1|2486738_2487137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169138.1|2487286_2487742_-	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	32.9	7.1e-12
WP_015169139.1|2487999_2488938_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015169140.1|2488959_2489706_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	27.7	6.4e-10
WP_015169141.1|2489708_2490545_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_015169142.1|2490702_2491560_-	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	51.6	3.0e-27
WP_015169143.1|2491707_2492946_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_015169144.1|2492973_2493987_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_015169145.1|2494187_2494781_-	hypothetical protein	NA	A0A1D7SF33	Cyanophage	31.7	9.6e-17
WP_015169146.1|2494857_2495448_-	DUF3177 family protein	NA	NA	NA	NA	NA
WP_015169147.1|2495653_2496199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169148.1|2496236_2496818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041429452.1|2496944_2497454_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_015169150.1|2497710_2498154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169151.1|2498174_2500292_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1W6JK23	Lactococcus_phage	25.8	3.5e-29
WP_015169152.1|2500436_2501012_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_015169153.1|2501048_2501444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169154.1|2501650_2501953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168130364.1|2502053_2502206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169155.1|2502281_2502842_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_015169156.1|2502975_2503665_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_015169157.1|2503716_2505075_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_015169158.1|2505514_2507224_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_015169159.1|2507388_2507625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169160.1|2507614_2509240_-	citramalate synthase	NA	NA	NA	NA	NA
WP_015169161.1|2509374_2511111_-	K+ transport system, NAD-binding protein	NA	NA	NA	NA	NA
WP_015169162.1|2511220_2512243_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_015169163.1|2512685_2513555_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_015169164.1|2513732_2515301_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_015169165.1|2515305_2516625_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_015169166.1|2516734_2517232_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015169167.1|2517281_2517860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169168.1|2518056_2518614_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_015169169.1|2518671_2518920_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_015169170.1|2519218_2519719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169171.1|2520070_2520652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169172.1|2520860_2521259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169173.1|2521353_2522682_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_015169174.1|2522809_2523895_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_015169175.1|2524115_2524808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169176.1|2524828_2525737_-	GTPase Era	NA	NA	NA	NA	NA
WP_015169177.1|2525778_2526402_-	DUF2232 domain-containing protein	NA	NA	NA	NA	NA
WP_015169178.1|2526406_2527261_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_144050216.1|2527694_2528123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144050217.1|2528228_2528961_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_051023628.1|2529075_2529837_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_015168729.1|2529945_2530257_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_068841729.1|2530198_2530795_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081581064.1|2530778_2530955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041429296.1|2531010_2531313_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_019702	Synechococcus sp. PCC 7502, complete sequence	3510253	2680143	2690388	3510253		uncultured_virus(42.86%)	12	NA	NA
WP_015169313.1|2680143_2680455_+	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	41.3	1.2e-13
WP_015169314.1|2680526_2682176_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.9	2.4e-158
WP_015169315.1|2682261_2682948_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	33.0	9.4e-24
WP_015169316.1|2682947_2683565_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A142F2D5	Mycobacterium_phage	28.9	1.2e-14
WP_015169317.1|2683599_2683806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169318.1|2683802_2684144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169319.1|2684297_2685029_-	uracil-DNA glycosylase	NA	A0A218MKQ4	uncultured_virus	40.4	1.8e-17
WP_015169320.1|2685118_2685886_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	61.7	1.8e-71
WP_015169321.1|2685843_2687112_-	UbiH/UbiF/VisC/COQ6 family Ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_015169323.1|2687527_2688340_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015169324.1|2688412_2688763_-	DUF1257 domain-containing protein	NA	NA	NA	NA	NA
WP_015169325.1|2688864_2690388_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	41.5	2.0e-103
>prophage 10
NC_019702	Synechococcus sp. PCC 7502, complete sequence	3510253	2895825	2993197	3510253	tRNA,protease,transposase	Catovirus(12.5%)	92	NA	NA
WP_015169525.1|2895825_2897352_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y4Q1	Acanthamoeba_polyphaga_mimivirus	33.0	4.2e-48
WP_015169526.1|2897361_2898393_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_015169527.1|2898397_2899369_+	Fe-S-cluster-containing hydrogenase subunit	NA	NA	NA	NA	NA
WP_015169528.1|2899411_2900113_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_015169529.1|2900164_2901148_-	DMT family transporter	NA	NA	NA	NA	NA
WP_041430214.1|2901275_2901875_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_015169531.1|2901910_2902153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169532.1|2902168_2902951_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_015169533.1|2903035_2903761_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_051023639.1|2903909_2904266_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_015169535.1|2904395_2904851_-	Oxygen evolving enhancer protein 3 (PsbQ)	NA	NA	NA	NA	NA
WP_015169536.1|2904946_2905318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169537.1|2905321_2906263_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.8	1.7e-31
WP_015169538.1|2906259_2907726_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_015169539.1|2908250_2908826_+	photosystem I reaction centre subunit III	NA	NA	NA	NA	NA
WP_015169540.1|2908838_2908964_+	photosystem I reaction center subunit IX	NA	NA	NA	NA	NA
WP_015169541.1|2908982_2909429_+	photosystem I reaction centre subunit XI	NA	NA	NA	NA	NA
WP_168130374.1|2909514_2909667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168135.1|2909670_2909982_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081581073.1|2910503_2910956_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015169542.1|2911006_2911606_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015169543.1|2911925_2912759_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.3	2.6e-20
WP_015169544.1|2912851_2913409_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015169545.1|2913462_2913642_-	proto-chlorophyllide reductase 57 kD subunit	NA	NA	NA	NA	NA
WP_015169546.1|2913773_2914205_-	DUF4168 domain-containing protein	NA	NA	NA	NA	NA
WP_144050227.1|2914248_2915356_-	peptide chain release factor 2	NA	A0A2I2MPK0	Mycobacterium_phage	45.3	3.4e-07
WP_015169547.1|2915461_2915683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051023642.1|2917208_2917763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041429525.1|2917965_2918268_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015169548.1|2919082_2920432_-	cytochrome P450	NA	I6XNL0	Cotesia_sesamiae_Mombasa_bracovirus	24.1	7.3e-20
WP_015169549.1|2920555_2921170_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015169550.1|2921233_2922028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169551.1|2922011_2922626_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015169553.1|2923136_2924123_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_015169554.1|2924600_2926775_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_168130376.1|2927213_2927372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041429527.1|2928050_2928557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169557.1|2928778_2930284_+	DASH family cryptochrome	NA	A0A1V0S949	Catovirus	26.8	3.2e-40
WP_015169558.1|2930289_2930868_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015169559.1|2930884_2932702_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	3.1e-42
WP_081581074.1|2932778_2932955_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081581075.1|2933140_2933419_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015168135.1|2933442_2933754_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429994.1|2933746_2934292_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051023689.1|2934308_2934875_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_144050228.1|2934832_2935186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169561.1|2935326_2942604_-	non-ribosomal peptide synthase	NA	A0A2K9KZV5	Tupanvirus	30.3	2.3e-205
WP_015169562.1|2942627_2944490_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	31.2	1.7e-59
WP_015169563.1|2944503_2945277_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015169564.1|2945280_2946324_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_168130378.1|2946595_2948116_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_015169566.1|2948118_2948922_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_051023646.1|2949812_2950793_-	non-ribosomal peptide synthetase	NA	NA	NA	NA	NA
WP_015169568.1|2952442_2952928_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_015169569.1|2953041_2954331_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_015169570.1|2954506_2955511_+	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
WP_015169571.1|2955572_2956022_+	NAD(P)H-quinone oxidoreductase subunit N	NA	NA	NA	NA	NA
WP_015169572.1|2956048_2956600_+	nucleoside monophosphate kinase	NA	NA	NA	NA	NA
WP_015169573.1|2956603_2957773_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_015169574.1|2957825_2958359_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015169575.1|2958451_2959255_-	DUF928 domain-containing protein	NA	NA	NA	NA	NA
WP_015169576.1|2959464_2960361_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015169577.1|2960452_2961883_+	trigger factor	NA	NA	NA	NA	NA
WP_015169578.1|2961956_2962601_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	9.6e-55
WP_015169579.1|2962614_2963940_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.5	8.4e-138
WP_144050301.1|2963968_2964490_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_015169581.1|2964528_2964885_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_015169582.1|2964914_2965637_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_015169583.1|2965639_2966839_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_144050230.1|2966956_2968429_-	RNA-directed DNA polymerase	NA	Q2P9X6	Enterobacteria_phage	36.1	1.3e-78
WP_015168729.1|2968479_2968791_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081581058.1|2968732_2969329_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015169585.1|2969676_2972238_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.0	2.9e-25
WP_015168135.1|2973109_2973421_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081581039.1|2973577_2973955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169586.1|2975063_2975375_+	DUF2499 domain-containing protein	NA	NA	NA	NA	NA
WP_015169587.1|2975399_2976188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169588.1|2976220_2976970_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_015169589.1|2977434_2978970_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	31.4	5.0e-49
WP_144050302.1|2979097_2980279_+	MFS transporter	NA	NA	NA	NA	NA
WP_015169591.1|2980461_2980863_+	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_015169592.1|2981032_2981173_+	photosystem II protein Y	NA	NA	NA	NA	NA
WP_015169593.1|2981338_2982475_+	citrate synthase	NA	NA	NA	NA	NA
WP_015169594.1|2982461_2983409_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_015169595.1|2983632_2984229_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015169596.1|2984225_2986004_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	4.0e-50
WP_015169597.1|2986178_2988110_+	sulfite reductase, ferredoxin dependent	NA	NA	NA	NA	NA
WP_015169598.1|2988158_2988947_+	DUF1350 family protein	NA	NA	NA	NA	NA
WP_015169599.1|2988952_2989621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169601.1|2989888_2991637_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	37.7	2.4e-100
WP_015169602.1|2991743_2992247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051023647.1|2992849_2993197_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_019702	Synechococcus sp. PCC 7502, complete sequence	3510253	3077059	3094200	3510253	transposase	Gordonia_phage(100.0%)	21	NA	NA
WP_041429164.1|3077059_3077371_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429717.1|3077363_3077909_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144050232.1|3078099_3078261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429550.1|3078232_3078844_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015169679.1|3079105_3079378_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_015169680.1|3079381_3081178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169681.1|3081174_3081558_-	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_015169682.1|3081554_3081812_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_015169683.1|3081914_3082358_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_015169684.1|3082354_3082804_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015169685.1|3083033_3083885_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_015169686.1|3084276_3084885_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_168130287.1|3085443_3085632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168130289.1|3085616_3085964_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_015169688.1|3086188_3087031_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041430242.1|3087090_3088149_-	hydrolase	NA	NA	NA	NA	NA
WP_041430243.1|3088210_3088669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169691.1|3089702_3090464_-	AIM24 family protein	NA	NA	NA	NA	NA
WP_015169692.1|3090872_3091379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169693.1|3091362_3092466_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	28.4	8.9e-16
WP_015168135.1|3093888_3094200_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NC_019702	Synechococcus sp. PCC 7502, complete sequence	3510253	3122569	3142625	3510253	transposase	Ralstonia_phage(50.0%)	22	NA	NA
WP_041429994.1|3122569_3123115_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015168135.1|3123107_3123419_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015169720.1|3123476_3124325_-	pirin family protein	NA	NA	NA	NA	NA
WP_015169721.1|3124450_3125356_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041429717.1|3125352_3125898_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429164.1|3125890_3126202_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015169722.1|3126420_3127035_-	ACP phosphodiesterase	NA	NA	NA	NA	NA
WP_015169723.1|3127091_3127685_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_015169724.1|3127695_3127944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169725.1|3128471_3129455_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_015169726.1|3129461_3130934_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_015169727.1|3130930_3131557_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041429717.1|3132202_3132748_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429164.1|3132740_3133052_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015169729.1|3133296_3133734_+	polyketide cyclase / dehydrase and lipid transport	NA	NA	NA	NA	NA
WP_015169730.1|3133854_3134850_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_081581078.1|3135088_3135784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169732.1|3136361_3137537_+	RtcB family protein	NA	B2ZXV2	Ralstonia_phage	52.0	1.1e-104
WP_015169733.1|3137547_3140205_-	AAA domain-containing protein	NA	K4FB40	Cronobacter_phage	35.4	2.4e-115
WP_015169734.1|3140286_3141366_-	potassium channel protein	NA	NA	NA	NA	NA
WP_015169736.1|3141619_3141808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015168135.1|3142313_3142625_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NC_019702	Synechococcus sp. PCC 7502, complete sequence	3510253	3161920	3194431	3510253	integrase,transposase	Staphylococcus_phage(25.0%)	40	3161870:3161890	3185875:3185895
3161870:3161890	attL	TATAGAGCCTGTTTCATATCT	NA	NA	NA	NA
WP_015168135.1|3161920_3162232_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429994.1|3162224_3162770_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015169753.1|3162927_3163131_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015169754.1|3163209_3163398_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_015169755.1|3163485_3163770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015169756.1|3163741_3164086_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	59.3	1.3e-21
WP_015169757.1|3164092_3164524_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	42.6	5.1e-20
WP_081581079.1|3164639_3165293_-|integrase	site-specific integrase	integrase	G9BWC1	Planktothrix_phage	53.1	1.4e-56
WP_015169758.1|3165331_3165715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169759.1|3165817_3167353_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.3	1.5e-53
WP_144050307.1|3167974_3169405_+	putative bicarbonate transporter, IctB family	NA	NA	NA	NA	NA
WP_015169761.1|3169572_3170124_+	photosystem I assembly protein Ycf4	NA	NA	NA	NA	NA
WP_015169762.1|3170127_3170931_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_015169763.1|3170934_3172071_+	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_015169764.1|3172145_3172829_-	iron-sulfur cluster biosynthesis transcriptional regulator SufR	NA	NA	NA	NA	NA
WP_015169765.1|3172933_3173830_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_015169766.1|3173928_3176145_-	phosphoketolase	NA	NA	NA	NA	NA
WP_015169767.1|3176443_3177268_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015169768.1|3177300_3177882_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_015169769.1|3177901_3179191_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-11
WP_168130382.1|3179313_3179916_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015169771.1|3179919_3180627_+	FkbM family methyltransferase	NA	F2Y1T8	Organic_Lake_phycodnavirus	28.7	6.5e-12
WP_015169772.1|3180820_3181735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015169773.1|3181755_3182370_+	acetyltransferase	NA	NA	NA	NA	NA
WP_015169774.1|3182359_3183205_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015169775.1|3183201_3183654_+	DUF29 domain-containing protein	NA	NA	NA	NA	NA
WP_015169776.1|3183676_3184603_+	SDR family oxidoreductase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	26.6	8.2e-15
WP_015169777.1|3184595_3185807_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_071880388.1|3185887_3186433_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
3185875:3185895	attR	TATAGAGCCTGTTTCATATCT	NA	NA	NA	NA
WP_015168135.1|3186425_3186737_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015169778.1|3187073_3187790_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_015169779.1|3187804_3188695_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	35.8	2.2e-09
WP_015169780.1|3188777_3190799_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_144050235.1|3191311_3192045_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_081581080.1|3192131_3192296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144050236.1|3192395_3192518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144050308.1|3192549_3192669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071880389.1|3192784_3193330_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_041429573.1|3193359_3193608_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041429575.1|3194119_3194431_-|transposase	transposase	transposase	NA	NA	NA	NA
