The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019395	Acidipropionibacterium acidipropionici ATCC 4875, complete sequence	3656170	153520	162395	3656170		Brucella_phage(33.33%)	9	NA	NA
WP_051143604.1|153520_154177_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.3e-34
WP_015068914.1|154634_155294_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_095532338.1|155430_155781_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015068915.1|155777_156077_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015068916.1|156165_156468_-	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	41.9	3.7e-09
WP_081583295.1|156464_156701_-	addiction module killer protein	NA	A0A141GEX6	Brucella_phage	50.8	1.1e-13
WP_015068918.1|156898_158110_-	RtcB family protein	NA	A0A1I9SAD2	Rhodococcus_phage	51.6	5.4e-107
WP_148279597.1|158677_160102_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.6	3.0e-32
WP_015068920.1|160592_162395_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	7.9e-30
>prophage 2
NC_019395	Acidipropionibacterium acidipropionici ATCC 4875, complete sequence	3656170	344518	410048	3656170	holin,transposase	Mycobacterium_phage(30.0%)	44	NA	NA
WP_015069088.1|344518_345826_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	70.2	2.6e-171
WP_041707360.1|346356_348264_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_041707361.1|348434_348998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015069091.1|349271_352175_+	DEAD/DEAH box helicase family protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	25.6	2.3e-39
WP_015069092.1|352176_356961_+	type II restriction enzyme, methylase subunit	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	22.8	3.6e-13
WP_015069093.1|356957_363413_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	23.9	3.1e-68
WP_015069094.1|363405_365655_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_081583301.1|365813_366737_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_148279472.1|367482_368022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148279473.1|368022_368868_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_015069095.1|368871_370545_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	22.4	3.2e-09
WP_015069096.1|371102_372494_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	51.4	8.6e-117
WP_148279474.1|372715_373720_+|transposase	IS481-like element ISPfr15 family transposase	transposase	NA	NA	NA	NA
WP_041707363.1|373806_375066_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.4	4.6e-77
WP_154662070.1|375298_375460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015069099.1|375432_376101_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148279475.1|376280_377036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015069101.1|377057_377201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015069102.1|377264_378524_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_051143449.1|379127_382565_+	AAA family ATPase	NA	V5UQM2	Mycobacterium_phage	42.4	1.2e-37
WP_015069104.1|382612_383326_+	type 1 glutamine amidotransferase	NA	A0A2K9L2L9	Tupanvirus	24.7	3.5e-05
WP_148279476.1|383288_383909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081583303.1|383940_384279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160165417.1|384293_384878_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_041707366.1|384995_385676_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015069106.1|385943_386978_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_148279478.1|387328_388099_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_015069108.1|388107_389421_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_015069109.1|389420_390824_-	peptidase M14	NA	NA	NA	NA	NA
WP_015069110.1|390896_391484_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041707369.1|391737_393075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081583305.1|393276_394656_-	xylulose kinase	NA	NA	NA	NA	NA
WP_041707370.1|394648_396022_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_015069114.1|396182_397529_-	xylose isomerase	NA	NA	NA	NA	NA
WP_041707372.1|397865_399083_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_015069116.1|399092_399707_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_015069117.1|399832_400642_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_015069118.1|400750_402001_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_148279606.1|402051_402729_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	3.4e-34
WP_015069120.1|402725_403958_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_015069121.1|404007_404925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015069122.1|404941_406672_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_148279479.1|406766_408014_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_015069124.1|408449_410048_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
>prophage 3
NC_019395	Acidipropionibacterium acidipropionici ATCC 4875, complete sequence	3656170	434036	462983	3656170	transposase	Mycobacterium_phage(20.0%)	18	NA	NA
WP_015069096.1|434036_435428_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	51.4	8.6e-117
WP_015069146.1|437316_438672_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	42.6	7.9e-91
WP_015069147.1|438821_440240_-|transposase	IS30-like element ISPfr9 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.3	4.6e-33
WP_015069148.1|441758_442754_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	33.2	2.7e-40
WP_015069149.1|442799_444188_-	MFS transporter	NA	NA	NA	NA	NA
WP_015069150.1|444210_447279_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.7	3.6e-139
WP_041707378.1|447783_449043_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.4	4.6e-77
WP_015069153.1|449404_451114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041707379.1|451125_453207_-	amino acid decarboxylase	NA	NA	NA	NA	NA
WP_015069155.1|453199_454387_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	33.6	2.8e-31
WP_015069156.1|454685_455171_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_015069157.1|455578_457246_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_015069158.1|457242_458052_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.1	1.7e-32
WP_041707381.1|458125_459886_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_008598604.1|459914_460337_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_002546835.1|460449_460797_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_160165419.1|461045_461657_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.7	1.1e-34
WP_015069163.1|461651_462983_+|transposase	ISL3-like element ISPfr3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	76.7	1.2e-195
>prophage 4
NC_019395	Acidipropionibacterium acidipropionici ATCC 4875, complete sequence	3656170	2388741	2470159	3656170	tRNA,transposase,protease,integrase	Mycobacterium_phage(13.64%)	65	2395701:2395751	2430704:2430754
WP_138575414.1|2388741_2389947_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015070936.1|2390181_2391435_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_028701078.1|2391528_2393142_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015070939.1|2393143_2394049_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_015070940.1|2394050_2394308_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_041707560.1|2394440_2395700_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.4	6.0e-77
2395701:2395751	attL	CCCCGTATCGAAAGATCACGAAACGGATACACCACTACCAGGGACTTGACC	NA	NA	NA	NA
WP_015070942.1|2395806_2396517_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_095532332.1|2396778_2399361_+	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
WP_051143666.1|2399461_2400169_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	6.7e-17
WP_015070946.1|2400170_2400935_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_036937419.1|2400940_2401816_+	cytochrome oxidase assembly protein	NA	NA	NA	NA	NA
WP_036937420.1|2401825_2402815_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_015070949.1|2403080_2404631_+	glucose-6-phosphate dehydrogenase	NA	A0A1D8KRR5	Synechococcus_phage	38.0	1.0e-81
WP_015070950.1|2404654_2405674_+	glucose-6-phosphate dehydrogenase assembly protein OpcA	NA	NA	NA	NA	NA
WP_015070951.1|2405670_2406405_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_015070952.1|2406455_2407247_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_015070953.1|2407287_2409897_+|tRNA	valine--tRNA ligase	tRNA	A0A2K9L2Y7	Tupanvirus	40.2	4.5e-159
WP_036937426.1|2409897_2410461_-	adenylate kinase	NA	NA	NA	NA	NA
WP_138573136.1|2410494_2411169_-	DinB family protein	NA	NA	NA	NA	NA
WP_015070956.1|2411084_2414408_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_015070957.1|2414539_2414950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015070958.1|2414989_2416279_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.0	2.8e-138
WP_076692561.1|2416416_2417109_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A248SJ97	Salicola_phage	42.1	2.1e-31
WP_036937429.1|2417117_2417714_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.3	7.6e-38
WP_036937432.1|2417862_2419122_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_015070962.1|2419479_2420913_-	trigger factor	NA	NA	NA	NA	NA
WP_081583390.1|2421336_2422050_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_041707562.1|2422128_2422533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041707563.1|2422581_2423484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148279560.1|2423578_2423827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081583391.1|2423887_2424313_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041707566.1|2424170_2425055_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.1	8.0e-52
WP_015070969.1|2425286_2426483_-	AAA_4 multi-domain protein	NA	NA	NA	NA	NA
WP_015070971.1|2426725_2427940_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_015069096.1|2428109_2429501_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	51.4	8.6e-117
WP_148279561.1|2429752_2430124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041707568.1|2430754_2432014_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.4	4.6e-77
2430704:2430754	attR	GGTCAAGTCCCTGGTAGTGGTGTATCCGTTTCGTGATCTTTCGATACGGGG	NA	NA	NA	NA
WP_015070975.1|2432390_2433722_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	70.6	4.7e-173
WP_015070976.1|2433855_2435187_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	76.7	1.2e-195
WP_041707569.1|2435337_2436177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015070979.1|2436166_2437105_-	type II site-specific deoxyribonuclease	NA	A0A0P0ZG22	Escherichia_phage	52.3	6.2e-95
WP_041707570.1|2437101_2438463_-	methyltransferase	NA	A0A2L1IV91	Escherichia_phage	38.4	5.7e-73
WP_015070981.1|2438832_2439657_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015070982.1|2439653_2442899_-|tRNA	bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX	tRNA	A0A2K9KZX5	Tupanvirus	37.3	3.8e-75
WP_015070983.1|2443006_2444413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015070984.1|2444409_2445225_-	Fpg/Nei family DNA glycosylase	NA	A0A1V0CNR6	Kaumoebavirus	27.6	7.3e-07
WP_051143669.1|2445252_2445474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015070986.1|2445474_2445945_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_015070987.1|2446033_2447320_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015070988.1|2447319_2447919_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015070989.1|2447923_2450128_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	34.8	3.4e-99
WP_041707573.1|2450261_2450798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015070991.1|2451070_2453665_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	30.9	1.6e-47
WP_015070992.1|2453673_2453940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015070993.1|2454049_2455495_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QGJ9	Cyanophage	31.3	2.8e-30
WP_015070994.1|2455606_2456131_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015070995.1|2456115_2457309_-	MFS transporter	NA	NA	NA	NA	NA
WP_041708308.1|2457305_2457650_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015070997.1|2457927_2458800_-	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_015070998.1|2458799_2460716_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	1.4e-32
WP_015070999.1|2460761_2462627_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	4.2e-42
WP_015071000.1|2462863_2463352_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015071001.1|2463382_2466250_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_015071002.1|2466318_2468007_-	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	29.0	1.8e-44
WP_015071004.1|2468821_2470159_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
