The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019386	Thermus oshimai JL-2, complete sequence	2072393	1249571	1293648	2072393	tRNA,integrase,transposase,protease	uncultured_Caudovirales_phage(20.0%)	46	1269808:1269829	1278304:1278325
WP_041436075.1|1249571_1249826_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144033097.1|1249857_1250070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016329528.1|1251036_1252224_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	33.0	4.7e-31
WP_016329529.1|1252616_1253207_+	helix-turn-helix domain-containing protein	NA	Q859R0	Thermus_virus	40.3	2.0e-06
WP_144033115.1|1253261_1253537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144033145.1|1254787_1255828_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_016329531.1|1255878_1257954_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_016329532.1|1257972_1259118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144033116.1|1259228_1259711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016329533.1|1259974_1261465_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_016329534.1|1261445_1262465_-	toprim domain-containing protein	NA	A0A2I6UGE7	Salinibacter_virus	50.8	2.3e-10
WP_016329535.1|1263040_1263841_+	helix-turn-helix domain-containing protein	NA	Q4ZD53	Staphylococcus_phage	24.2	4.6e-06
WP_016329536.1|1263842_1264985_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	29.0	4.4e-26
WP_016329537.1|1265329_1266151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187288194.1|1266574_1266841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016329539.1|1267146_1268517_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016329540.1|1268507_1269062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016329541.1|1269054_1269330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016329542.1|1269342_1269660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016329543.1|1269656_1269986_+	hypothetical protein	NA	NA	NA	NA	NA
1269808:1269829	attL	TCCGCCTCGAGGGCCGCCACCT	NA	NA	NA	NA
WP_016329544.1|1270005_1270434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016329545.1|1270423_1271125_+	site-specific DNA-methyltransferase	NA	A0A2I7QJ51	Vibrio_phage	26.0	5.6e-16
WP_016329546.1|1271190_1271952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016329547.1|1271955_1272438_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_016329548.1|1272672_1272909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187288195.1|1272905_1273043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144033117.1|1273033_1274221_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	27.6	5.2e-30
WP_016329550.1|1274536_1275310_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_016329551.1|1275306_1275897_+	translation elongation factor Ts	NA	NA	NA	NA	NA
WP_016329552.1|1275949_1276654_+	UMP kinase	NA	NA	NA	NA	NA
WP_016329553.1|1276664_1277222_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_016329554.1|1277256_1278081_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016329555.1|1278077_1279181_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
1278304:1278325	attR	AGGTGGCGGCCCTCGAGGCGGA	NA	NA	NA	NA
WP_016329556.1|1279177_1280188_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_016329557.1|1280189_1280816_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016329558.1|1280802_1281321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016329559.1|1281317_1282103_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.6	2.0e-22
WP_016329560.1|1282106_1283300_-|tRNA	tRNA/rRNA cytosine-C5-methylase	tRNA	NA	NA	NA	NA
WP_014515944.1|1283296_1283569_-	stage V sporulation protein S	NA	NA	NA	NA	NA
WP_016329561.1|1283653_1284124_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_016329562.1|1284179_1284911_-	aminotransferase class IV	NA	NA	NA	NA	NA
WP_041436215.1|1284907_1286788_-	chorismate-binding protein	NA	NA	NA	NA	NA
WP_016329564.1|1286786_1287308_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_016329565.1|1287304_1290856_-	methionine synthase	NA	NA	NA	NA	NA
WP_016329566.1|1290898_1292437_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	38.0	1.3e-78
WP_016329567.1|1292451_1293648_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.9	2.7e-111
