The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006690	Lactobacillus casei 12A chromosome, complete genome	2907892	15068	49399	2907892	protease,bacteriocin,transposase	Lactobacillus_phage(33.33%)	39	NA	NA
WP_123796592.1|15068_15932_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.3	9.0e-24
WP_079322958.1|15928_16225_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003568474.1|16730_16925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568475.1|16997_17591_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003659007.1|17987_18383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003568478.1|18595_18898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003568480.1|19176_20034_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003568482.1|20113_20296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003659010.1|20346_20526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003568484.1|21014_22250_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_003568486.1|22453_25027_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003568488.1|25039_25741_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_003568490.1|26020_26572_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568492.1|26615_27422_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003568494.1|27426_27747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003659016.1|28586_29090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038410334.1|29109_31260_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_003568499.1|31604_32378_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003568500.1|32555_33161_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003568502.1|33500_33725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568504.1|33880_34558_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003568507.1|34722_35616_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003568509.1|35664_36303_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568512.1|36531_37908_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_038410343.1|38099_39344_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.7	2.2e-10
WP_003562527.1|39600_39945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562540.1|40020_40380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562542.1|40620_42063_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003562544.1|42257_42893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562546.1|42942_43254_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003562548.1|43422_43611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562550.1|43742_44354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025600126.1|44711_45185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568611.1|45382_45721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562555.1|46054_46765_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003562558.1|46751_47081_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_003659037.1|47318_47609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562560.1|47961_48177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562562.1|48523_49399_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP006690	Lactobacillus casei 12A chromosome, complete genome	2907892	889199	898458	2907892	integrase	Streptococcus_phage(33.33%)	8	882028:882041	898898:898911
882028:882041	attL	AGCAGCTCATTTTA	NA	NA	NA	NA
WP_003564244.1|889199_892091_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	1.9e-307
WP_003564246.1|892441_892981_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003564248.1|893143_894031_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
WP_003564250.1|894027_895056_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.2	2.3e-90
WP_003564251.1|895060_896008_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	9.2e-54
WP_003564253.1|896393_896849_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003564255.1|896965_897556_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	1.1e-52
WP_003564258.1|897960_898458_-|integrase	tyrosine-type recombinase/integrase	integrase	U5U4L5	Lactobacillus_phage	87.9	2.2e-59
898898:898911	attR	TAAAATGAGCTGCT	NA	NA	NA	NA
>prophage 3
NZ_CP006690	Lactobacillus casei 12A chromosome, complete genome	2907892	1062859	1104295	2907892	integrase,head,holin,capsid,tail,portal,terminase	Lactobacillus_phage(87.5%)	63	1050907:1050920	1093102:1093115
1050907:1050920	attL	CAAAAAGGATGGCC	NA	NA	NA	NA
WP_003566493.1|1062859_1064044_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.0	4.0e-224
WP_003566492.1|1064134_1064338_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	94.0	6.1e-32
WP_025598233.1|1064362_1064788_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	85.1	1.7e-60
WP_003566491.1|1064851_1065385_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_003566489.1|1065534_1065792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025598235.1|1065781_1066663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566484.1|1066732_1068076_-	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	98.2	1.3e-189
WP_020967497.1|1068165_1068516_-	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	93.1	4.9e-53
WP_003566479.1|1068574_1069228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025598239.1|1069282_1069705_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	92.8	4.3e-72
WP_025598240.1|1069694_1070033_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	97.3	5.0e-55
WP_003566474.1|1070172_1070373_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2Q9	Lactobacillus_phage	98.5	3.1e-28
WP_003566473.1|1070409_1070643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566471.1|1070632_1070830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566469.1|1070917_1071076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025598242.1|1071141_1071690_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	96.7	8.7e-97
WP_003566467.1|1071668_1071890_+	helix-turn-helix domain-containing protein	NA	A0A1B0Y6A3	Lactobacillus_phage	94.5	4.9e-35
WP_080661669.1|1072018_1072270_+	hypothetical protein	NA	A0A0P0I7L5	Lactobacillus_phage	71.4	6.5e-07
WP_025598246.1|1072256_1072460_+	hypothetical protein	NA	A8YQL1	Lactobacillus_phage	51.6	2.3e-10
WP_003566461.1|1072471_1073458_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	49.1	1.7e-47
WP_003566459.1|1073477_1074242_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	56.3	6.0e-80
WP_003566457.1|1074253_1075252_+	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	61.8	3.1e-100
WP_003566455.1|1075264_1075750_+	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	83.9	3.4e-60
WP_003566453.1|1075765_1075963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566452.1|1075963_1076218_+	hypothetical protein	NA	U5U728	Lactobacillus_phage	89.3	2.2e-34
WP_003566451.1|1076214_1076580_+	hypothetical protein	NA	A0A0P0HRU0	Lactobacillus_phage	99.2	3.1e-66
WP_003566448.1|1076714_1077275_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	43.0	5.3e-25
WP_025598249.1|1077264_1077582_+	hypothetical protein	NA	C1KFT5	Lactobacillus_virus	42.1	1.5e-16
WP_003566444.1|1077578_1077854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566440.1|1078043_1078475_+	YopX family protein	NA	A0A2D1GPA7	Lactobacillus_phage	57.6	1.0e-36
WP_003566436.1|1079334_1079688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566434.1|1079716_1079869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025598254.1|1079951_1080389_+	hypothetical protein	NA	A0A2H4J7Z8	uncultured_Caudovirales_phage	28.6	7.3e-06
WP_003566430.1|1080635_1081163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566428.1|1081604_1082753_+	phage protein	NA	A0A0P0I3G0	Lactobacillus_phage	94.5	4.8e-214
WP_003566426.1|1082762_1082900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025598257.1|1082899_1083484_+|terminase	terminase small subunit	terminase	A0A0P0ID78	Lactobacillus_phage	92.3	2.0e-83
WP_003566422.1|1083467_1084721_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	98.6	9.4e-248
WP_003566420.1|1084725_1086153_+|portal	phage portal protein	portal	A0A0P0IQQ3	Lactobacillus_phage	91.2	2.6e-249
WP_003566418.1|1086118_1087105_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	94.5	2.6e-176
WP_003566416.1|1087114_1087441_+	hypothetical protein	NA	A0A0P0IJR5	Lactobacillus_phage	78.7	3.9e-44
WP_003566414.1|1087437_1087803_+	hypothetical protein	NA	A0A1Q1PVR6	Bacillus_phage	53.4	5.9e-17
WP_003566412.1|1087919_1088552_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	86.3	9.4e-79
WP_003566410.1|1088564_1088879_+	hypothetical protein	NA	A0A0P0IJQ8	Lactobacillus_phage	94.2	5.5e-48
WP_003566408.1|1088892_1089912_+|capsid	major capsid protein	capsid	A0A0P0IZJ7	Lactobacillus_phage	99.1	9.5e-190
WP_080661671.1|1089926_1090178_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_003566406.1|1090247_1090622_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	91.9	1.1e-58
WP_003566404.1|1090626_1090929_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	91.0	3.1e-48
WP_003566402.1|1090925_1091291_+	hypothetical protein	NA	A0A0P0IUZ3	Lactobacillus_phage	95.9	1.2e-57
WP_003566400.1|1091291_1091696_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	100.0	4.6e-71
WP_003566399.1|1091707_1092313_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	93.5	1.5e-102
WP_003566397.1|1092399_1092735_+|tail	tail assembly chaperone	tail	A0A0P0IJV9	Lactobacillus_phage	100.0	9.4e-54
WP_003566394.1|1092833_1093187_+	hypothetical protein	NA	A0A0P0ID51	Lactobacillus_phage	94.0	1.5e-54
1093102:1093115	attR	CAAAAAGGATGGCC	NA	NA	NA	NA
WP_003566392.1|1093179_1096515_+|tail	phage tail tape measure protein	tail	A0A0P0IQK3	Lactobacillus_phage	89.0	1.6e-302
WP_003566390.1|1096515_1098504_+|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	60.8	5.0e-211
WP_003566388.1|1098504_1101450_+|tail	phage tail protein	tail	Q3L0S2	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	65.8	0.0e+00
WP_003566386.1|1101451_1101742_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	57.3	1.4e-24
WP_003566384.1|1101734_1101866_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	95.3	3.2e-18
WP_003566381.1|1101896_1102283_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	98.4	4.3e-66
WP_025598269.1|1102263_1102470_+	hypothetical protein	NA	A0A1B0YE97	Lactobacillus_phage	97.4	3.2e-12
WP_003566379.1|1102466_1102913_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	95.9	8.4e-66
WP_003566377.1|1102925_1103132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038410483.1|1103149_1104295_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	51.1	3.3e-82
>prophage 4
NZ_CP006690	Lactobacillus casei 12A chromosome, complete genome	2907892	1500683	1605698	2907892	integrase,head,tRNA,holin,transposase,protease,capsid,tail,portal,terminase	Lactobacillus_phage(70.37%)	117	1554981:1555000	1596733:1596752
WP_003565699.1|1500683_1501130_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003565701.1|1501250_1503479_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	34.3	1.5e-06
WP_003565703.1|1503715_1504039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003565705.1|1504065_1504806_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_003565707.1|1504938_1505886_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_003565709.1|1506002_1506497_-	DUF3013 family protein	NA	NA	NA	NA	NA
WP_003565711.1|1506493_1507099_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003565713.1|1507204_1507453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003565715.1|1507522_1507909_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003565717.1|1508371_1508554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003565719.1|1508553_1508940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658131.1|1510050_1510236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003565721.1|1510900_1511491_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003565723.1|1511483_1512050_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003565725.1|1512157_1512961_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_003565728.1|1513394_1513709_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_003565730.1|1513727_1514231_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003565731.1|1514554_1515082_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.4	6.5e-25
WP_003565734.1|1515078_1517373_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.6	5.1e-74
WP_003565736.1|1517647_1518019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003565737.1|1518342_1518819_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003565739.1|1518824_1519058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003565741.1|1519149_1520988_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	2.0e-20
WP_003565743.1|1521144_1522053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003565745.1|1524156_1525320_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.2	1.4e-24
WP_003565747.1|1525432_1527307_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.0	2.6e-140
WP_003565749.1|1527336_1527927_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003565751.1|1528103_1529150_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003565753.1|1529312_1530458_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_003565755.1|1530459_1531407_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_003565758.1|1531413_1532319_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003565760.1|1532330_1533122_-	DUF475 domain-containing protein	NA	S5MAL1	Bacillus_phage	44.7	1.8e-34
WP_013245374.1|1533520_1534765_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	2.0e-11
WP_003565780.1|1534897_1535251_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003565782.1|1535311_1538143_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	40.0	5.8e-19
WP_003565784.1|1538163_1538463_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_003565786.1|1538465_1538759_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003565788.1|1538770_1540024_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003565790.1|1540040_1540520_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003570427.1|1540774_1545109_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	36.0	1.5e-18
WP_003565796.1|1545175_1546903_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.9	1.8e-07
WP_003565798.1|1546927_1548169_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003565800.1|1548185_1548974_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003570430.1|1549009_1549762_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.2	2.1e-21
WP_003565804.1|1550291_1550849_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003565806.1|1550848_1551568_-	UMP kinase	NA	NA	NA	NA	NA
WP_003565808.1|1551803_1552685_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_003565810.1|1552769_1553558_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003565812.1|1553953_1554223_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_032777268.1|1554212_1554947_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
1554981:1555000	attL	CAATGGTATAATTTACCACA	NA	NA	NA	NA
WP_080661708.1|1555682_1555898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003563301.1|1556115_1556589_-	SocA family protein	NA	Q9AZG0	Lactococcus_phage	41.7	2.4e-26
WP_038410525.1|1556838_1557984_-	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	53.8	1.9e-90
WP_003564881.1|1557994_1558441_-|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	93.2	3.2e-65
WP_025598812.1|1558433_1558751_-	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	55.6	3.7e-15
WP_003564877.1|1558870_1558996_-	XkdX family protein	NA	A8YQK3	Lactobacillus_phage	90.2	1.0e-13
WP_003564875.1|1558992_1559322_-	hypothetical protein	NA	A8YQK2	Lactobacillus_phage	61.5	2.2e-31
WP_003564873.1|1559323_1561759_-|tail	phage tail protein	tail	Q6J1X1	Lactobacillus_phage	73.3	0.0e+00
WP_025598811.1|1561759_1563754_-|tail	phage tail family protein	tail	B4XYQ4	Lactobacillus_phage	45.6	7.4e-146
WP_003564869.1|1563754_1568596_-|tail	phage tail tape measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	81.9	0.0e+00
WP_025598810.1|1568718_1569132_-	hypothetical protein	NA	A0A2D1GPL7	Lactobacillus_phage	79.6	3.0e-49
WP_080661678.1|1569202_1569418_-	Ig-like domain-containing protein	NA	A0A2D1GPF6	Lactobacillus_phage	91.5	3.7e-19
WP_003564863.1|1569444_1570053_-|tail	phage major tail protein	tail	A0A2D1GPC8	Lactobacillus_phage	97.0	2.4e-108
WP_025598808.1|1570086_1570473_-	hypothetical protein	NA	U5U3W4	Lactobacillus_phage	96.1	3.1e-69
WP_003564860.1|1570472_1570859_-	HK97 gp10 family phage protein	NA	U5U769	Lactobacillus_phage	97.7	2.5e-66
WP_003564859.1|1570858_1571188_-|head,tail	head-tail adaptor protein	head,tail	B4XYP8	Lactobacillus_phage	97.2	2.0e-56
WP_003564855.1|1571177_1571537_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	97.5	1.6e-59
WP_003564853.1|1571547_1571787_-	Ig-like domain-containing protein	NA	A0A2D1GPN4	Lactobacillus_phage	93.7	1.2e-29
WP_003564851.1|1571804_1573007_-|capsid	phage major capsid protein	capsid	U5U3Z5	Lactobacillus_phage	97.2	1.7e-214
WP_003564849.1|1573049_1573679_-|head,protease	HK97 family phage prohead protease	head,protease	U5U3W0	Lactobacillus_phage	98.1	9.6e-116
WP_003564847.1|1573632_1574886_-|portal	phage portal protein	portal	U5U764	Lactobacillus_phage	97.6	5.5e-232
WP_025598804.1|1574891_1575086_-	hypothetical protein	NA	U5U6Z9	Lactobacillus_phage	81.2	1.4e-22
WP_003564845.1|1575097_1576810_-|terminase	terminase large subunit	terminase	Q8LTC3	Lactobacillus_phage	99.3	0.0e+00
WP_003564843.1|1576831_1577287_-|terminase	P27 family phage terminase small subunit	terminase	U5U3Z1	Lactobacillus_phage	98.0	5.2e-79
WP_003564841.1|1577487_1578282_-	HNH endonuclease	NA	U5U440	Lactobacillus_phage	96.6	1.9e-145
WP_003564836.1|1578895_1579231_-	hypothetical protein	NA	U5U7A9	Lactobacillus_phage	82.9	5.2e-28
WP_025598801.1|1579233_1579563_-	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	89.6	8.1e-50
WP_003564832.1|1579549_1580767_-	phage protein	NA	A8YQN3	Lactobacillus_phage	96.5	8.9e-235
WP_003564830.1|1581186_1581396_+	CsbD family protein	NA	NA	NA	NA	NA
WP_025598624.1|1581619_1581805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025598626.1|1581960_1582491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032776774.1|1583293_1583752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025598628.1|1584161_1584380_-	helix-turn-helix transcriptional regulator	NA	U5U738	Lactobacillus_phage	80.6	6.4e-27
WP_025598630.1|1584450_1584738_-	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	96.8	2.2e-51
WP_003564824.1|1584749_1585487_-	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	43.4	2.0e-48
WP_003564822.1|1585488_1585911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003564819.1|1585957_1586476_-	exonuclease	NA	NA	NA	NA	NA
WP_003564818.1|1586475_1587300_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	74.7	1.9e-116
WP_003564817.1|1587314_1588064_-	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	56.1	5.8e-35
WP_025598639.1|1588056_1588371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003564814.1|1588453_1588651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003564812.1|1588732_1589092_-	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	5.3e-63
WP_003564811.1|1589158_1589410_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_003564809.1|1589402_1589582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025598642.1|1589582_1590323_-	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	54.6	4.7e-45
WP_003564805.1|1590397_1590598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003564801.1|1590594_1590744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003564799.1|1590740_1590989_-	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	98.7	1.6e-37
WP_003564797.1|1591244_1591589_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	41.1	1.5e-17
WP_025598647.1|1591581_1592004_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0Y2S4	Lactobacillus_phage	39.6	4.9e-23
WP_003564795.1|1592069_1592867_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_003564793.1|1592963_1593152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025598650.1|1593315_1593597_+	hypothetical protein	NA	A0A0P0HRW5	Lactobacillus_phage	53.8	3.6e-22
WP_003564789.1|1593619_1593955_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_003564787.1|1594101_1594989_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_025598653.1|1595065_1595329_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.2	4.2e-09
WP_003564785.1|1595433_1596609_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	49.0	4.6e-103
WP_003564783.1|1596780_1597431_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
1596733:1596752	attR	CAATGGTATAATTTACCACA	NA	NA	NA	NA
WP_003570435.1|1597487_1598882_+	amino acid permease	NA	NA	NA	NA	NA
WP_003564777.1|1598912_1599704_+	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_003564775.1|1599801_1601595_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	6.4e-40
WP_003564773.1|1601584_1603342_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.5	1.8e-50
WP_003564771.1|1603483_1603705_-	YneF family protein	NA	NA	NA	NA	NA
WP_003658561.1|1603765_1604011_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003564766.1|1604043_1604220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003564764.1|1604446_1604794_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003564762.1|1604930_1605698_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP006690	Lactobacillus casei 12A chromosome, complete genome	2907892	2294129	2355754	2907892	protease,bacteriocin	Bacillus_phage(20.0%)	58	NA	NA
WP_003567237.1|2294129_2294969_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003567240.1|2294981_2295998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567242.1|2296004_2296379_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567244.1|2296542_2297814_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003567246.1|2298130_2298907_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003567248.1|2298924_2299812_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	8.9e-35
WP_003567250.1|2299995_2300892_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567252.1|2300994_2302110_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003567254.1|2302131_2303496_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003567256.1|2303512_2304055_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003567258.1|2304275_2304566_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567260.1|2304682_2305060_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003567262.1|2305304_2306624_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.2	5.4e-60
WP_003567264.1|2306946_2308293_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	5.3e-47
WP_003567265.1|2308520_2309621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567267.1|2309617_2310814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567269.1|2310876_2311755_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003567271.1|2311916_2313971_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.5e-64
WP_032774271.1|2314127_2316758_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.2	1.4e-88
WP_003567275.1|2316919_2317543_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003567277.1|2318043_2318715_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003567279.1|2319224_2320346_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003567280.1|2320359_2320644_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_003567282.1|2320834_2321950_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567284.1|2322137_2322344_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003567286.1|2322476_2322734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2322826_2323033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567290.1|2323257_2323509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567292.1|2323836_2325069_+	MFS transporter	NA	NA	NA	NA	NA
WP_003567294.1|2325147_2326404_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	1.6e-98
WP_003567296.1|2326492_2327326_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	2.1e-46
WP_003567298.1|2327642_2327837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567300.1|2328090_2328627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567302.1|2328815_2330039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567303.1|2330628_2331456_-	class C sortase	NA	NA	NA	NA	NA
WP_003567305.1|2331462_2333022_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_003567307.1|2333018_2334341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567309.1|2334342_2337348_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003567312.1|2337625_2338183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567314.1|2338277_2339474_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003567316.1|2339682_2340738_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003567322.1|2341753_2342083_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003567324.1|2342079_2342868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567326.1|2342920_2343709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567328.1|2343753_2344032_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567331.1|2344055_2344340_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567333.1|2344532_2344829_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567335.1|2344930_2346286_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580849.1|2346591_2346903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567340.1|2346975_2347326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567343.1|2347499_2348879_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_003567347.1|2348889_2351082_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.7	8.1e-37
WP_003567348.1|2351551_2351677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567349.1|2351866_2353165_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003567351.1|2353169_2353976_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003659579.1|2354337_2354535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567354.1|2355081_2355321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032675994.1|2355580_2355754_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 6
NZ_CP006690	Lactobacillus casei 12A chromosome, complete genome	2907892	2858859	2871801	2907892	integrase,head,capsid,tail,portal,terminase	Lactobacillus_phage(37.5%)	19	2858743:2858762	2873721:2873740
2858743:2858762	attL	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
WP_003568329.1|2858859_2860017_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	32.7	5.6e-45
WP_003568331.1|2860116_2860713_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_123796598.1|2860872_2861151_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025600015.1|2861216_2861627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568337.1|2861619_2861757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568341.1|2861975_2862251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568343.1|2862247_2862436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025600009.1|2862419_2863247_+	bifunctional DNA primase/polymerase	NA	Q854C1	Mycobacterium_phage	34.9	1.5e-12
WP_003568347.1|2863239_2864664_+	helicase	NA	A0A1W6JQD6	Staphylococcus_phage	38.1	1.0e-64
WP_003568348.1|2864933_2865356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568350.1|2865370_2865688_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_003568352.1|2865699_2865873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025599464.1|2865866_2866259_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	46.0	7.7e-23
WP_003568354.1|2866413_2866884_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_003568355.1|2866880_2868584_+|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	40.2	1.2e-120
WP_003568357.1|2868549_2868729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003568359.1|2868733_2869915_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.0	4.1e-59
WP_003568361.1|2869901_2871446_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.2	2.1e-39
WP_003568363.1|2871507_2871801_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I7QHJ6	Enterococcus_phage	32.6	8.3e-06
2873721:2873740	attR	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
