The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018645	Desulfobacula toluolica Tol2, complete genome	5197905	234811	253850	5197905	transposase,integrase	Staphylococcus_phage(16.67%)	22	234710:234723	253938:253951
234710:234723	attL	AAATTCCTTTTTTT	NA	NA	NA	NA
WP_014955712.1|234811_235147_+|transposase	transposase	transposase	A0A0N9STL0	Staphylococcus_phage	42.9	2.3e-12
WP_085929941.1|235034_235448_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014955714.1|235839_236622_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014955715.1|236838_237117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148278028.1|237629_238310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014955717.1|238433_238802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051012232.1|238938_241923_+	N-6 DNA methylase	NA	A0A2R2ZGH5	Clostridioides_phage	27.1	5.0e-13
WP_014955719.1|241925_242633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014955720.1|242629_243307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014955721.1|243616_243850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041279181.1|243836_244094_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2P1N333	Gordonia_phage	37.6	3.2e-09
WP_014955722.1|244232_244754_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014955723.1|244827_245709_+	DUF89 family protein	NA	NA	NA	NA	NA
WP_041279182.1|245725_245914_+	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_014955724.1|246015_247008_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014955725.1|247170_247836_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_014955726.1|247916_248909_+	carbon-nitrogen hydrolase family protein	NA	M1HRJ8	Acanthocystis_turfacea_Chlorella_virus	28.9	3.0e-15
WP_014955727.1|249441_249876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014955729.1|251318_252293_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8BM23	Lactococcus_phage	25.9	9.6e-06
WP_041279183.1|252283_252865_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	27.1	8.8e-07
WP_014955731.1|252864_253188_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014955732.1|253184_253850_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
253938:253951	attR	AAATTCCTTTTTTT	NA	NA	NA	NA
>prophage 2
NC_018645	Desulfobacula toluolica Tol2, complete genome	5197905	732751	776848	5197905	transposase	Leptospira_phage(57.14%)	43	NA	NA
WP_014956136.1|732751_733240_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014956137.1|733236_733578_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041279224.1|733574_734339_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_014955601.1|734319_734715_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148278039.1|735114_735429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148278040.1|735370_735892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014956141.1|736182_737784_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_014956142.1|738141_738462_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_014956143.1|738458_738806_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	49.1	2.7e-27
WP_014956144.1|738850_740383_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	39.9	8.3e-97
WP_085929944.1|740758_741076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041279228.1|741467_741806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041279229.1|741831_742248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041279230.1|742349_742904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014956146.1|743080_743848_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_148278186.1|743887_744139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014956147.1|744173_745289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014956148.1|745520_746696_+	MORN motif protein	NA	NA	NA	NA	NA
WP_014956149.1|746850_747831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014956152.1|748927_749389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041279231.1|749432_749969_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	53.3	6.1e-47
WP_041279232.1|750184_750478_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_158406055.1|750641_750800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041279789.1|750915_751371_+	dehydratase	NA	NA	NA	NA	NA
WP_014956156.1|751418_751658_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_014956157.1|751672_753391_-	aldehyde ferredoxin oxidoreductase	NA	NA	NA	NA	NA
WP_014956158.1|753422_754106_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_041279233.1|754095_755868_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	2.4e-63
WP_014956160.1|755797_756835_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_014956161.1|756831_757710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014956162.1|757734_758289_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_014956163.1|758542_759583_-	quinohemoprotein amine dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_014956164.1|759599_759923_-	quinohemoprotein amine dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_014956165.1|759981_760809_-	transporter	NA	NA	NA	NA	NA
WP_014956166.1|760858_762316_-	SPASM domain-containing protein	NA	D5GV15	Campylobacter_virus	32.5	2.0e-07
WP_014956167.1|762324_763962_-	quinohemoprotein amine dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_014956168.1|764933_767864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014956144.1|769327_770860_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	39.9	8.3e-97
WP_014956143.1|770904_771252_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	49.1	2.7e-27
WP_014956142.1|771248_771569_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_014956171.1|771775_774901_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_041279235.1|775371_776145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014956173.1|776131_776848_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_018645	Desulfobacula toluolica Tol2, complete genome	5197905	922925	961088	5197905	transposase	Catovirus(25.0%)	41	NA	NA
WP_014956305.1|922925_923264_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_014956306.1|923350_923575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041279248.1|923626_923875_+|transposase	transposase	transposase	A0A1I9KF42	Aeromonas_phage	60.0	1.9e-06
WP_173391113.1|923900_924263_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_041279250.1|924237_924477_-	type II toxin-antitoxin system PrlF family antitoxin	NA	NA	NA	NA	NA
WP_014956308.1|924869_925133_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_014956309.1|925129_925381_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014956310.1|925508_925718_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_041279251.1|926142_926415_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014956311.1|926430_926793_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014956312.1|926799_927135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014956313.1|927127_927442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014956314.1|927518_928541_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	S5VY82	Leptospira_phage	35.1	1.5e-30
WP_014956317.1|930424_930964_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_014956318.1|930953_931883_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_014956319.1|932255_932972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148278194.1|933189_933873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014956321.1|934086_934782_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_014956322.1|934778_935141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014956324.1|935773_936814_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_014956325.1|937037_938948_-	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	31.4	3.5e-28
WP_014956327.1|939648_940296_-	sugar transferase	NA	NA	NA	NA	NA
WP_014956328.1|940322_941534_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_148278048.1|941559_942288_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_158406058.1|942313_942487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014956330.1|942533_943592_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_148278195.1|943669_944782_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	50.5	3.1e-101
WP_014956332.1|944811_945951_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_014956333.1|945990_947040_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	31.8	1.3e-35
WP_041279253.1|947167_948505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014956335.1|948615_949869_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_014956336.1|949865_951134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014956337.1|951130_952279_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_014956338.1|952315_953491_-	Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain	NA	NA	NA	NA	NA
WP_051012259.1|953487_955041_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_014956340.1|955048_956146_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_014956341.1|956256_957252_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	31.4	5.7e-38
WP_014956342.1|957245_958433_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_014956343.1|958469_959549_-	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	28.9	6.6e-32
WP_041279254.1|959556_960057_-	DUF1353 domain-containing protein	NA	A0A218MKF9	uncultured_virus	37.7	2.6e-23
WP_014956345.1|960122_961088_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_018645	Desulfobacula toluolica Tol2, complete genome	5197905	2347841	2437272	5197905	tRNA,transposase,integrase	Brevibacillus_phage(28.57%)	95	2389097:2389156	2437273:2437405
WP_014957499.1|2347841_2349323_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.8	7.1e-93
WP_014957500.1|2349423_2350725_-	GHKL domain-containing protein	NA	B5LWN0	Feldmannia_species_virus	29.2	1.7e-13
WP_014957501.1|2350729_2351941_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_014957502.1|2352093_2354775_+	CBS domain-containing protein	NA	A0A291LDS1	Aeromonas_phage	30.2	3.7e-15
WP_014957503.1|2354829_2355840_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014957504.1|2355828_2356521_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_014957505.1|2356523_2357693_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_041279944.1|2358228_2359224_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	37.5	1.3e-50
WP_041279425.1|2359452_2359641_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PJD4	Moraxella_phage	55.2	1.5e-13
WP_014957507.1|2359643_2360045_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0U4ISP5	Pseudomonas_phage	43.7	8.1e-28
WP_083863568.1|2360195_2360756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957509.1|2360847_2362188_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_014957532.1|2362590_2362782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957509.1|2362778_2364119_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_158406100.1|2364521_2364686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957511.1|2364761_2365469_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_041279427.1|2365678_2365939_+	toxin HicA	NA	A0A2P1A0R7	Gordonia_phage	67.5	4.3e-06
WP_014957513.1|2365922_2366252_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_014957514.1|2366606_2367692_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014957515.1|2367688_2368564_-|integrase	site-specific integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.4	7.3e-13
WP_041279429.1|2368834_2369284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148278098.1|2369560_2370481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957517.1|2370483_2371176_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014957518.1|2371195_2371873_+	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_014957509.1|2372095_2373436_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_173391124.1|2373838_2373979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041279948.1|2374085_2374277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957520.1|2374266_2375322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957509.1|2375415_2376756_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_014957514.1|2377569_2378655_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014957515.1|2378651_2379527_-|integrase	site-specific integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.4	7.3e-13
WP_051012347.1|2381119_2381593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957521.1|2381881_2383222_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_158406100.1|2383624_2383789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957522.1|2383781_2384735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957523.1|2384984_2386325_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_014957524.1|2387138_2388224_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014957525.1|2388220_2389096_-|integrase	site-specific integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.0	1.2e-12
2389097:2389156	attL	GGTATCTTCCTTTTTTCTTTAACCTTGTCGGGTGAAGATACCGACCTGCAAGCCGGTAAC	NA	NA	NA	NA
WP_041279433.1|2389382_2389682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957526.1|2390031_2391117_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014957527.1|2391113_2391989_-|integrase	site-specific integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.4	9.5e-13
WP_014957528.1|2392323_2392578_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_014957529.1|2392574_2392910_+	type II toxin-antitoxin system HicB family antitoxin	NA	R4JJS9	Burkholderia_phage	54.5	4.1e-25
WP_014957509.1|2393151_2394492_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_014957530.1|2394894_2395260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957509.1|2395598_2396939_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_014957532.1|2397341_2397533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957531.1|2397529_2398870_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_014957532.1|2399272_2399464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957533.1|2399460_2400801_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_158406100.1|2401203_2401368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957534.1|2401539_2401791_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_041279436.1|2401780_2402065_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	53.8	1.7e-19
WP_014957526.1|2402813_2403899_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014957527.1|2403895_2404771_-|integrase	site-specific integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.4	9.5e-13
WP_014957536.1|2405003_2405198_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_014957537.1|2405194_2405530_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_014957509.1|2405636_2406977_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_158406100.1|2407379_2407544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041279438.1|2407659_2408004_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014957538.1|2408006_2408282_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162138510.1|2408463_2408643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957539.1|2408586_2408850_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2P1N333	Gordonia_phage	33.7	9.5e-09
WP_014957540.1|2408853_2409105_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014957541.1|2409285_2410626_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_014957532.1|2411028_2411220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957509.1|2411216_2412557_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_173391125.1|2412959_2413100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957542.1|2413341_2413596_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014957543.1|2413592_2414012_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_014957546.1|2415790_2417398_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_014957547.1|2417473_2417806_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_083863578.1|2417802_2418159_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	46.2	1.3e-24
WP_014957549.1|2418204_2419788_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	42.0	2.4e-107
WP_014957550.1|2419931_2420135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957551.1|2420257_2421256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957552.1|2421431_2421698_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_041279440.1|2421710_2421968_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_014957509.1|2422096_2423437_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_014957553.1|2423839_2424100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957554.1|2424208_2424607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957555.1|2424603_2424876_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_014957556.1|2425117_2426740_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_014957557.1|2427013_2427367_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	46.2	1.7e-05
WP_014957558.1|2427359_2427638_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_014956142.1|2429040_2429361_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_014956143.1|2429357_2429705_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	49.1	2.7e-27
WP_014956144.1|2429749_2431282_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	39.9	8.3e-97
WP_158406101.1|2431842_2432007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148278099.1|2432085_2432475_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_014957561.1|2432401_2432674_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014957509.1|2432901_2434242_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_014957562.1|2434644_2434899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957514.1|2435314_2436400_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014957515.1|2436396_2437272_-|integrase	site-specific integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.4	7.3e-13
2437273:2437405	attR	GGTATCTTCCTTTTTTCTTTAACCTTGTCGGGTGAAGATACCGACCTGCAAGCCGGTAACAAGATACCATGAGCAATGGAATTGAACAATGATGATACGGCTTAATCTGCCGCGTAGCGGCTTACTTGAACAA	NA	NA	NA	NA
>prophage 5
NC_018645	Desulfobacula toluolica Tol2, complete genome	5197905	3000400	3109745	5197905	transposase,protease,integrase	Bacillus_phage(18.75%)	97	3068911:3068965	3083039:3083093
WP_014958018.1|3000400_3000913_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_014958019.1|3001058_3001259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148278227.1|3001538_3003398_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014958021.1|3003400_3003913_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_148278116.1|3003905_3005939_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_014958023.1|3006141_3006771_+	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_014958024.1|3006781_3007780_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_148278117.1|3008011_3008824_-	ATP-dependent peptidase	NA	NA	NA	NA	NA
WP_051012387.1|3008771_3009353_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014958027.1|3009321_3011331_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014958028.1|3011495_3012068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014958029.1|3012401_3013772_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_014958030.1|3013819_3016378_-	amino acid permease	NA	NA	NA	NA	NA
WP_014958031.1|3016530_3018033_-	hybrid sensor histidine kinase/response regulator	NA	W8CYF6	Bacillus_phage	29.4	3.5e-23
WP_139168998.1|3018072_3019581_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_014958033.1|3019693_3020656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014958034.1|3020857_3021247_-	response regulator	NA	W8CYM9	Bacillus_phage	38.1	2.1e-12
WP_014958035.1|3021287_3022211_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_014958036.1|3022207_3022876_-	methylenetetrahydrofolate reductase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014958037.1|3022901_3023345_-	hydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_041279521.1|3023344_3026383_-	CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein	NA	NA	NA	NA	NA
WP_014958039.1|3026460_3027333_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_014958040.1|3027825_3028872_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014958041.1|3028878_3029151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041280023.1|3029802_3031605_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014958044.1|3031735_3032821_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_148278228.1|3032859_3033876_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014958046.1|3033879_3035475_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	2.4e-22
WP_014958047.1|3035675_3037004_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.3	3.7e-61
WP_014958048.1|3037310_3037574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014958050.1|3038100_3040242_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014958051.1|3040254_3041982_+	ATP-dependent helicase	NA	S5M596	Bacillus_phage	22.1	5.5e-12
WP_014958052.1|3042258_3043233_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H4TJ57	Erysipelothrix_phage	26.6	3.3e-06
WP_014958053.1|3043223_3044132_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	25.0	4.4e-05
WP_014958054.1|3044128_3045016_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014958055.1|3045539_3047312_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014957509.1|3047407_3048748_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_173391127.1|3049150_3049294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014958057.1|3049485_3050946_+	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_014958058.1|3050942_3051782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014958059.1|3051825_3052428_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_014958052.1|3052687_3053662_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0H4TJ57	Erysipelothrix_phage	26.6	3.3e-06
WP_014958053.1|3053652_3054561_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	25.0	4.4e-05
WP_014958054.1|3054557_3055445_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_041280025.1|3055583_3056300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014958061.1|3056386_3057259_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_014956965.1|3057311_3058718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014958062.1|3059138_3060104_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_014958063.1|3060394_3061012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014958064.1|3061004_3061883_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_014958065.1|3062116_3063019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014958066.1|3063149_3063842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041279531.1|3064446_3064914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014958067.1|3064903_3066088_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_014958068.1|3066062_3066740_-	multiubiquitin domain-containing protein	NA	NA	NA	NA	NA
WP_014958069.1|3066892_3067480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014958070.1|3067472_3067880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014958071.1|3067879_3068698_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
3068911:3068965	attL	CCCCCTGTGTCAGGATAGATGTCGCCTCAATTAAAAATTAAATTTGGGGCATTGA	NA	NA	NA	NA
WP_014956136.1|3068975_3069464_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014958072.1|3069460_3070516_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014958073.1|3070732_3071794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014958074.1|3071798_3072386_+	NADAR family protein	NA	A0A2K9L130	Tupanvirus	33.9	1.9e-09
WP_014957509.1|3072996_3074337_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_158406100.1|3074739_3074904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014957534.1|3075075_3075327_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014958075.1|3075316_3075601_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	53.8	6.4e-19
WP_014958076.1|3076349_3077435_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014957515.1|3077431_3078307_-|integrase	site-specific integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.4	7.3e-13
WP_051012398.1|3078395_3079196_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	29.1	9.6e-12
WP_041279533.1|3079524_3080697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014958079.1|3080822_3081755_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	35.3	1.9e-35
WP_014958080.1|3081871_3082456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083863663.1|3083144_3084461_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
3083039:3083093	attR	CCCCCTGTGTCAGGATAGATGTCGCCTCAATTAAAAATTAAATTTGGGGCATTGA	NA	NA	NA	NA
WP_041279534.1|3084737_3085121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158406120.1|3086367_3086652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041279535.1|3086762_3086996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148278206.1|3086995_3087742_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_083863884.1|3087741_3089181_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_041279536.1|3090347_3090566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014958085.1|3090572_3090854_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014958086.1|3091299_3092088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014958087.1|3092265_3092469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014958088.1|3092505_3094065_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_158406121.1|3094199_3094373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083863666.1|3094624_3094945_+	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_085929950.1|3094934_3095111_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041279539.1|3095113_3095581_+	HipA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014958091.1|3095499_3097290_-	anion permease	NA	NA	NA	NA	NA
WP_014958092.1|3097481_3099029_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014958093.1|3099601_3100978_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	4.7e-59
WP_148278229.1|3100997_3101915_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_014958095.1|3102474_3103203_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014958096.1|3103199_3104360_+	response regulator	NA	Q9EYF3	Enterobacteria_phage	32.4	2.0e-18
WP_014958097.1|3104621_3105200_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_014955645.1|3107263_3107569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014958100.1|3108204_3109260_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014956136.1|3109256_3109745_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NC_018645	Desulfobacula toluolica Tol2, complete genome	5197905	3129968	3192036	5197905	tRNA,transposase	Catovirus(33.33%)	48	NA	NA
WP_083863679.1|3129968_3130691_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014958112.1|3130734_3131919_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_014958113.1|3132117_3133401_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_014958114.1|3133657_3136219_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_014958115.1|3136218_3136881_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	3.2e-29
WP_148278231.1|3136928_3137525_-	arylesterase	NA	NA	NA	NA	NA
WP_014958117.1|3137757_3138618_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014958118.1|3138673_3139447_+	DUF2914 domain-containing protein	NA	NA	NA	NA	NA
WP_014958119.1|3139548_3140046_+	GatB/YqeY domain-containing protein	NA	NA	NA	NA	NA
WP_014958120.1|3140156_3141272_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014958121.1|3141434_3142313_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014958122.1|3142314_3143499_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014958123.1|3143502_3144162_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051012409.1|3144356_3145814_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_051012411.1|3145877_3146456_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014958125.1|3147180_3148314_+	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_014958126.1|3148320_3149079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014955937.1|3149670_3150840_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_014958128.1|3150855_3151875_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_014958129.1|3151896_3154302_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_014958130.1|3154331_3155954_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_014958131.1|3155957_3156839_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_014958132.1|3156902_3157259_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_041279544.1|3157255_3157687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014958133.1|3157725_3158166_-	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_014958134.1|3158781_3159402_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_014958135.1|3159561_3160077_-	universal stress protein	NA	NA	NA	NA	NA
WP_014958136.1|3160130_3160646_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_014958137.1|3160664_3162539_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_041279545.1|3163874_3165419_-	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.3	3.0e-22
WP_014958140.1|3165518_3167075_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_014958143.1|3169170_3169452_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014958144.1|3169525_3169936_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.3	1.1e-06
WP_083863918.1|3169822_3170446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158406123.1|3170572_3170713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014958146.1|3171228_3172176_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	21.9	1.2e-08
WP_041279548.1|3172656_3174207_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_158406124.1|3174359_3175046_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_014958149.1|3176893_3177508_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_014958150.1|3177590_3180266_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_014958134.1|3180881_3181502_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_014958135.1|3181661_3182177_-	universal stress protein	NA	NA	NA	NA	NA
WP_014958136.1|3182230_3182746_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_014958137.1|3182764_3184639_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_041279545.1|3185974_3187519_-	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.3	3.0e-22
WP_014958140.1|3187618_3189175_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_014958143.1|3191270_3191552_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014958144.1|3191625_3192036_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.3	1.1e-06
>prophage 7
NC_018645	Desulfobacula toluolica Tol2, complete genome	5197905	3210584	3287415	5197905	transposase	Bacillus_phage(30.0%)	56	NA	NA
WP_014958143.1|3210584_3210866_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014958144.1|3210939_3211350_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.3	1.1e-06
WP_083863690.1|3211236_3211812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158406123.1|3211987_3212128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014958146.1|3212643_3213591_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	21.9	1.2e-08
WP_041279548.1|3215498_3217049_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_158406124.1|3217201_3217888_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_014958149.1|3219735_3220350_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_014958150.1|3220432_3223108_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_014958134.1|3223723_3224344_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_014958135.1|3224503_3225019_-	universal stress protein	NA	NA	NA	NA	NA
WP_014958136.1|3225072_3225588_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_014958137.1|3225606_3227481_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_041279545.1|3228816_3230361_-	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.3	3.0e-22
WP_014958140.1|3230460_3232017_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_014958143.1|3234112_3234394_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014958144.1|3234467_3234878_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.3	1.1e-06
WP_083863918.1|3234764_3235388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158406123.1|3235514_3235655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014958146.1|3236170_3237118_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	21.9	1.2e-08
WP_041279548.1|3237598_3239149_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_158406124.1|3239301_3239988_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_014958149.1|3241835_3242450_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_014958150.1|3242532_3245208_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_014958134.1|3245823_3246444_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_014958135.1|3246603_3247119_-	universal stress protein	NA	NA	NA	NA	NA
WP_014958136.1|3247172_3247688_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_014958137.1|3247706_3249581_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_041279545.1|3250916_3252461_-	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.3	3.0e-22
WP_014958140.1|3252560_3254117_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_014958143.1|3256212_3256494_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_014958144.1|3256567_3256978_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.3	1.1e-06
WP_083863918.1|3256864_3257488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158406123.1|3257614_3257755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014958146.1|3258270_3259218_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	21.9	1.2e-08
WP_041279548.1|3261125_3262676_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_158406124.1|3262828_3263515_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_014958149.1|3265362_3265977_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_173391128.1|3266059_3268396_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_014958153.1|3268586_3270200_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_014958154.1|3270203_3271085_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_014958132.1|3271148_3271505_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_041279549.1|3271501_3271933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014958156.1|3272157_3272973_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014958157.1|3272988_3274572_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	41.8	1.2e-106
WP_083863693.1|3274617_3274974_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.5	1.3e-24
WP_014958159.1|3274970_3275303_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_014958160.1|3275359_3277504_+	S-layer family protein	NA	NA	NA	NA	NA
WP_014958161.1|3277519_3279247_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_014958162.1|3279300_3280239_-	carbamate kinase	NA	NA	NA	NA	NA
WP_014958163.1|3280248_3281568_-	GTPase	NA	NA	NA	NA	NA
WP_014958164.1|3282197_3283412_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_148278124.1|3284461_3284740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014958167.1|3284699_3286010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083863694.1|3286473_3286860_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014958168.1|3286863_3287415_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_018645	Desulfobacula toluolica Tol2, complete genome	5197905	3946100	3956250	5197905	tRNA	Staphylococcus_phage(57.14%)	12	NA	NA
WP_014958713.1|3946100_3946577_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.3	5.1e-37
WP_014958714.1|3946657_3947860_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.3	3.2e-96
WP_014958715.1|3947968_3948634_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	33.6	4.1e-32
WP_014958716.1|3948709_3949807_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.9	9.7e-47
WP_014958717.1|3949796_3950300_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_041279609.1|3950318_3950780_-	cytidine deaminase	NA	S5YN57	Mycobacterium_phage	38.8	1.4e-23
WP_014958719.1|3950772_3952017_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.9	2.2e-100
WP_041279610.1|3952040_3952481_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_014958721.1|3952496_3952730_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_014958722.1|3952768_3952957_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_014958723.1|3953461_3954712_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_014958724.1|3954846_3956250_+|tRNA	glutamate--tRNA ligase	tRNA	A0A1V0SFT2	Hokovirus	33.3	3.1e-13
