The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018593	Listeria monocytogenes SLCC7179, complete genome	2882234	120252	126777	2882234	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003721739.1|120252_120705_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|120710_121046_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003732219.1|121262_121691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014931069.1|121702_122119_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	7.7e-21
WP_012952083.1|122396_122786_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|122798_123311_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|123358_123661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014601581.1|123702_124107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014931070.1|124093_125962_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_003734720.1|125958_126777_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 2
NC_018593	Listeria monocytogenes SLCC7179, complete genome	2882234	1086733	1094155	2882234		Hokovirus(33.33%)	8	NA	NA
WP_003721506.1|1086733_1087117_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003732709.1|1087138_1088122_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	4.1e-12
WP_014931338.1|1088136_1089150_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	7.9e-11
WP_014931339.1|1089358_1090849_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	7.3e-114
WP_014931340.1|1090860_1091685_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.4	4.8e-67
WP_014931341.1|1091697_1092006_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014931342.1|1092065_1092470_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014931343.1|1092598_1094155_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
>prophage 3
NC_018593	Listeria monocytogenes SLCC7179, complete genome	2882234	1232259	1291740	2882234	protease,tRNA	Bacillus_virus(16.67%)	58	NA	NA
WP_003723562.1|1232259_1233399_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014931390.1|1233479_1233875_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1234025_1234241_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014931391.1|1234359_1234893_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1234910_1235576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1235837_1236776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1236890_1238174_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1238358_1239618_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_009924620.1|1239736_1240303_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723888.1|1240337_1240907_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1241008_1241551_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|1241560_1242424_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723891.1|1242420_1243206_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_014931392.1|1243339_1244200_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003732799.1|1244471_1246550_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	3.2e-107
WP_009924616.1|1246612_1247917_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009911635.1|1248199_1249102_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_003724001.1|1249122_1249662_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_012581410.1|1249675_1251085_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	28.8	5.8e-44
WP_003726695.1|1251105_1251885_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_014931393.1|1251987_1252407_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003724130.1|1252429_1252741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009932949.1|1252743_1253616_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003724132.1|1253657_1254254_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003732802.1|1254411_1254819_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_003723731.1|1254999_1256967_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	6.7e-123
WP_010989723.1|1256963_1259423_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	4.7e-102
WP_003723733.1|1259505_1259973_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_014931394.1|1260302_1262072_+	lmo1289 family class 1 internalin	NA	NA	NA	NA	NA
WP_014931395.1|1262404_1264201_+	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_012951576.1|1264234_1266103_-	peptidoglycan O-acetyltransferase OatA	NA	B5WZU0	Pseudomonas_phage	31.9	6.5e-43
WP_003723737.1|1266315_1267014_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	32.4	1.3e-12
WP_003723738.1|1267246_1268923_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_012951578.1|1269048_1269966_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003719566.1|1270088_1270322_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_077906793.1|1270432_1271656_+	GTPase HflX	NA	NA	NA	NA	NA
WP_014931397.1|1271648_1272875_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003719570.1|1273078_1273447_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723435.1|1273517_1274852_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_012951579.1|1274995_1276291_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	61.9	2.8e-146
WP_003723437.1|1276334_1276856_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003723438.1|1276885_1277500_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_003723439.1|1277657_1277987_+	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_003723440.1|1278078_1278306_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003732809.1|1278452_1280447_+	transketolase	NA	NA	NA	NA	NA
WP_003723442.1|1280667_1280907_+	YneF family protein	NA	NA	NA	NA	NA
WP_003723443.1|1280957_1281800_-	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_003723444.1|1281818_1282550_-	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	59.1	1.2e-80
WP_003723445.1|1282571_1283078_-	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	4.0e-56
WP_014931398.1|1283087_1284392_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	9.5e-134
WP_077906794.1|1284381_1285587_-	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	47.1	4.9e-92
WP_003723448.1|1285564_1285939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723449.1|1286231_1286960_+	UMP kinase	NA	NA	NA	NA	NA
WP_003723450.1|1286959_1287517_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_039385819.1|1287746_1288505_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.4	7.4e-22
WP_003727496.1|1288518_1289307_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_014931401.1|1289321_1290464_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003723454.1|1290477_1291740_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 4
NC_018593	Listeria monocytogenes SLCC7179, complete genome	2882234	1781318	1789604	2882234		Prochlorococcus_phage(33.33%)	8	NA	NA
WP_014931513.1|1781318_1781885_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.1	7.5e-27
WP_014931514.1|1781881_1782931_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.1	3.2e-63
WP_003722245.1|1782949_1784377_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_014931515.1|1784361_1786581_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	1.9e-158
WP_003733240.1|1786573_1787257_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1787260_1787506_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_014931516.1|1787517_1788231_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	37.8	8.8e-41
WP_003729814.1|1788311_1789604_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 5
NC_018593	Listeria monocytogenes SLCC7179, complete genome	2882234	2447179	2455023	2882234		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2447179_2448151_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_014931662.1|2448158_2449127_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	42.9	8.8e-68
WP_010990001.1|2449128_2450004_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	3.2e-08
WP_014601136.1|2450111_2451842_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.3	4.3e-174
WP_026750232.1|2451883_2452945_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_014931663.1|2452961_2453945_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	36.9	1.7e-50
WP_003722610.1|2454063_2455023_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 6
NC_018593	Listeria monocytogenes SLCC7179, complete genome	2882234	2541483	2625901	2882234	integrase,portal,plate,terminase,protease,tail,holin,tRNA,capsid	Listeria_phage(75.93%)	96	2573315:2573364	2612518:2612567
WP_003723609.1|2541483_2543154_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003723610.1|2543150_2543600_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003723611.1|2543677_2544331_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003723612.1|2544405_2544591_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_009924630.1|2544625_2545948_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.2	2.6e-30
WP_009924631.1|2545962_2546799_-	lipoyl-[GcvH]:protein N-lipoyltransferase	NA	NA	NA	NA	NA
WP_003729274.1|2547116_2547317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723616.1|2547338_2547662_-	YxeA family protein	NA	NA	NA	NA	NA
WP_014931674.1|2547816_2549478_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003726112.1|2549613_2550228_-	SdpI family protein	NA	NA	NA	NA	NA
WP_014931675.1|2550251_2550884_-	nicotinamidase	NA	NA	NA	NA	NA
WP_003723621.1|2550884_2551409_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_012952036.1|2551411_2552410_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014931676.1|2552506_2552779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723624.1|2552827_2553739_-	cation transporter	NA	NA	NA	NA	NA
WP_014931677.1|2553864_2558457_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003733264.1|2558677_2559505_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_014931678.1|2559619_2560495_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003723278.1|2560505_2560799_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012952039.1|2560831_2560993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723280.1|2561061_2561730_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.0	5.0e-38
WP_010990019.1|2561729_2562818_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014931679.1|2562896_2564276_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	43.7	1.4e-55
WP_003723283.1|2564272_2564950_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	48.4	2.6e-58
WP_014931680.1|2564996_2565782_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_003723285.1|2565843_2566320_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_014931681.1|2566319_2569307_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_009931305.1|2569805_2570648_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_003733258.1|2570695_2572177_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003723289.1|2572277_2573165_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
2573315:2573364	attL	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
WP_014931683.1|2573734_2573968_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	94.8	5.2e-35
WP_014931684.1|2574405_2574591_+	hypothetical protein	NA	R4IBK5	Listeria_phage	86.7	9.2e-19
WP_014931685.1|2574660_2575398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003734112.1|2575513_2576359_-	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	89.4	2.0e-137
WP_003722522.1|2576358_2576640_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003722523.1|2576652_2577018_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003734113.1|2577046_2577205_-	hypothetical protein	NA	Q9T1A1	Listeria_phage	98.1	3.0e-18
WP_003727798.1|2577209_2577527_-	hypothetical protein	NA	Q9T1A2	Listeria_phage	92.4	1.3e-49
WP_014931686.1|2577538_2578612_-|plate	phage baseplate upper protein	plate	Q9T1A3	Listeria_phage	96.9	7.4e-193
WP_014931687.1|2578611_2579640_-	hypothetical protein	NA	Q9T1A4	Listeria_phage	98.8	2.1e-189
WP_014931688.1|2579640_2580666_-|tail	phage tail protein	tail	Q9T1A5	Listeria_phage	94.7	1.6e-192
WP_014931689.1|2580674_2581493_-|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	93.4	7.2e-148
WP_014931690.1|2581494_2586858_-	tape measure protein	NA	Q9T1A7	Listeria_phage	82.4	0.0e+00
WP_003731740.1|2586868_2587471_-	hypothetical protein	NA	A8ASK5	Listeria_phage	98.0	2.0e-107
WP_003731739.1|2587476_2587899_-|tail	phage tail assembly chaperone	tail	Q9T1A9	Listeria_phage	98.6	3.4e-69
WP_003731738.1|2587950_2588283_-	Ig domain-containing protein	NA	Q9T1B0	Listeria_phage	84.5	1.3e-39
WP_014931692.1|2588212_2588650_-	hypothetical protein	NA	A8ASK2	Listeria_phage	98.6	2.1e-77
WP_014931693.1|2588652_2589060_-	hypothetical protein	NA	A8ASK1	Listeria_phage	97.8	6.5e-65
WP_014931694.1|2589059_2589398_-	hypothetical protein	NA	A0A059T7W4	Listeria_phage	96.4	1.6e-56
WP_014931695.1|2589397_2589760_-	hypothetical protein	NA	A8ASJ9	Listeria_phage	95.0	1.0e-61
WP_003731735.1|2589759_2590155_-	hypothetical protein	NA	A8ASJ8	Listeria_phage	99.2	3.3e-66
WP_003731734.1|2590156_2590315_-	hypothetical protein	NA	Q9T1B6	Listeria_phage	94.2	6.7e-18
WP_014931696.1|2590314_2591214_-|capsid	phage major capsid protein	capsid	A0A0B5CU19	Listeria_phage	98.7	3.8e-166
WP_003759694.1|2591237_2591807_-	phage scaffolding protein	NA	Q9T1B8	Listeria_phage	96.8	1.1e-89
WP_014931697.1|2591885_2593025_-|capsid	phage minor capsid protein	capsid	Q9T1B9	Listeria_phage	97.1	4.4e-204
WP_003731730.1|2593025_2594795_-|portal	phage portal protein	portal	A8ASJ3	Listeria_phage	91.6	2.0e-264
WP_014931698.1|2594807_2596118_-|terminase	PBSX family phage terminase large subunit	terminase	A0A286QNX6	Streptococcus_phage	65.3	1.5e-166
WP_014931699.1|2596110_2596866_-|terminase	terminase small subunit	terminase	V5URT8	Oenococcus_phage	45.6	9.0e-44
WP_041176806.1|2596911_2597451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003734123.1|2597710_2598145_-	hypothetical protein	NA	A8AU03	Listeria_phage	95.1	9.0e-73
WP_003734124.1|2598163_2598328_-	hypothetical protein	NA	A8ASQ0	Listeria_phage	96.3	6.7e-21
WP_014931701.1|2598457_2598862_-	endodeoxyribonuclease	NA	A8AU00	Listeria_phage	99.3	2.1e-71
WP_014601286.1|2598827_2598968_-	BH0509 family protein	NA	A8ATZ9	Listeria_phage	100.0	2.6e-18
WP_014601287.1|2598964_2599270_-	hypothetical protein	NA	A8ATZ8	Listeria_phage	98.0	1.5e-45
WP_014931702.1|2599297_2599675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014601288.1|2599696_2600179_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	93.1	2.7e-78
WP_014931703.1|2600175_2600376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014931704.1|2600668_2601229_-	pentapeptide repeat-containing protein	NA	A0A060AFJ6	Listeria_phage	69.4	2.1e-29
WP_014931705.1|2601246_2601786_-	DUF1642 domain-containing protein	NA	A0A0B5D0I5	Listeria_phage	92.2	3.6e-95
WP_041176811.1|2602606_2603137_-	hypothetical protein	NA	A0A059T5F9	Listeria_phage	94.9	1.6e-95
WP_014931708.1|2603184_2604111_-	hypothetical protein	NA	I1W658	Staphylococcus_phage	39.3	6.7e-17
WP_014931709.1|2604130_2604940_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A290GJV0	Caldibacillus_phage	54.3	2.7e-78
WP_003753535.1|2604893_2605775_-	hypothetical protein	NA	A0A2P1JTZ5	Anoxybacillus_phage	58.6	3.4e-87
WP_003727754.1|2605771_2605975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014931710.1|2606192_2606381_-	hypothetical protein	NA	A0A0B5CU43	Listeria_phage	93.5	4.2e-27
WP_014931711.1|2606483_2606690_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014931712.1|2606679_2607210_-	hypothetical protein	NA	A8ATY1	Listeria_phage	87.3	1.9e-77
WP_014931713.1|2607330_2608119_-	phage antirepressor Ant	NA	Q9T178	Listeria_phage	93.1	1.4e-135
WP_014931714.1|2608131_2608407_-	hypothetical protein	NA	A8ASM5	Listeria_phage	85.1	4.9e-40
WP_014931715.1|2608432_2608717_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	87.2	7.0e-42
WP_014931716.1|2608781_2609141_+	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	26.3	2.1e-06
WP_003733687.1|2609099_2609294_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_003731437.1|2609326_2609530_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014931717.1|2609698_2610175_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	62.7	5.8e-41
WP_014601103.1|2610332_2610500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731435.1|2610554_2611205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014931718.1|2611266_2612430_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	31.2	1.2e-50
WP_003733022.1|2618159_2619188_-	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
2612518:2612567	attR	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
WP_003733023.1|2619456_2620983_+	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0K2CP65	Brevibacillus_phage	48.7	9.1e-27
WP_014931719.1|2621024_2621876_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.0	1.0e-48
WP_014931720.1|2621897_2622320_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014602248.1|2622441_2622801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014931721.1|2623044_2623914_+	DUF4969 domain-containing protein	NA	NA	NA	NA	NA
WP_003723652.1|2624108_2624501_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003727703.1|2624522_2624960_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003733032.1|2625154_2625901_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
