The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018586	Listeria monocytogenes SLCC2540, complete genome	2976958	125108	131635	2976958	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|125108_125561_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|125566_125902_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003724946.1|126118_126547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728213.1|126558_126975_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	3.2e-19
WP_003728212.1|127254_127644_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|127656_128169_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|128216_128519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|128560_128965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728211.1|128951_130820_+	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	4.5e-20
WP_003734720.1|130816_131635_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 2
NC_018586	Listeria monocytogenes SLCC2540, complete genome	2976958	1109386	1116808	2976958		Hokovirus(33.33%)	8	NA	NA
WP_003730941.1|1109386_1109770_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003727002.1|1109791_1110775_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.0e-11
WP_003727001.1|1110789_1111803_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
WP_003721509.1|1112011_1113502_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003727000.1|1113513_1114338_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_003724634.1|1114350_1114659_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_009917597.1|1114718_1115123_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003736259.1|1115251_1116808_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.2	7.8e-18
>prophage 3
NC_018586	Listeria monocytogenes SLCC2540, complete genome	2976958	1205366	1304833	2976958	terminase,holin,integrase,tRNA,protease,tail,capsid,portal	Listeria_phage(81.82%)	114	1231117:1231137	1275127:1275147
WP_003721619.1|1205366_1206419_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.9	1.3e-29
WP_014929510.1|1206418_1208827_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003721621.1|1208987_1209689_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-33
WP_003724750.1|1213209_1213662_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003724751.1|1213677_1216878_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_014929513.1|1216981_1217656_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	3.4e-50
WP_012681263.1|1217693_1218620_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_003740576.1|1218773_1219037_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_003726937.1|1219036_1219579_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003726936.1|1219670_1221383_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.5	1.9e-17
WP_014929514.1|1221405_1223763_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_003723853.1|1223843_1224155_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
WP_003726544.1|1224230_1226042_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003726934.1|1226222_1227437_+	aspartate kinase	NA	NA	NA	NA	NA
WP_012681265.1|1227492_1227987_-	YslB family protein	NA	NA	NA	NA	NA
WP_003723856.1|1228134_1228935_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003726032.1|1228947_1229694_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_003730988.1|1229696_1230308_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_003726034.1|1230344_1230869_+	metallophosphoesterase	NA	NA	NA	NA	NA
1231117:1231137	attL	ATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
WP_014929515.1|1231154_1232309_-|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	98.4	1.1e-215
WP_012951517.1|1232452_1233109_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_014929516.1|1233160_1233613_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	98.0	3.4e-83
WP_014929517.1|1233629_1233953_-	helix-turn-helix transcriptional regulator	NA	A0A059T6G1	Listeria_phage	72.0	7.7e-37
WP_014929518.1|1234757_1235081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009929536.1|1235095_1235299_+	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	100.0	3.1e-28
WP_014929519.1|1235300_1235543_+	hypothetical protein	NA	A8ATD2	Listeria_phage	97.5	2.0e-42
WP_014929520.1|1235545_1235731_+	hypothetical protein	NA	A0A059T7Z3	Listeria_phage	100.0	2.6e-29
WP_009931096.1|1235965_1236118_+	hypothetical protein	NA	A0A059T7S2	Listeria_phage	98.0	3.4e-19
WP_014929521.1|1236254_1236506_+	hypothetical protein	NA	Q8W5X5	Listeria_phage	91.6	4.7e-34
WP_014929522.1|1236502_1237033_+	hypothetical protein	NA	A0A059T5F9	Listeria_phage	94.9	1.2e-95
WP_157865517.1|1237023_1237422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014929524.1|1237418_1237979_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	43.7	3.2e-30
WP_014929525.1|1237981_1238425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014929526.1|1238421_1238568_+	hypothetical protein	NA	A8ATZ0	Listeria_phage	100.0	1.7e-20
WP_041176858.1|1238585_1238771_+	hypothetical protein	NA	Q8W5X1	Listeria_phage	91.1	1.1e-24
WP_014929527.1|1238767_1239211_+	pentapeptide repeat-containing protein	NA	A0A060AFJ6	Listeria_phage	90.4	3.4e-43
WP_014929528.1|1239314_1239524_+	hypothetical protein	NA	A8ATE0	Listeria_phage	94.2	4.5e-30
WP_014929529.1|1239520_1239811_+	hypothetical protein	NA	A0A059T5D9	Listeria_phage	99.0	3.0e-48
WP_014929530.1|1239810_1240023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041176859.1|1240015_1240210_+	hypothetical protein	NA	A0A059T7V7	Listeria_phage	87.5	1.2e-24
WP_014929531.1|1240225_1240441_+	hypothetical protein	NA	A0A059T7T1	Listeria_phage	93.7	4.8e-27
WP_014929532.1|1240437_1240938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014929533.1|1240969_1241230_+	hypothetical protein	NA	Q8W5W6	Listeria_phage	49.4	7.9e-16
WP_009933642.1|1241233_1241407_+	hypothetical protein	NA	A0A059T5G3	Listeria_phage	100.0	5.2e-24
WP_014929534.1|1241403_1241787_+	hypothetical protein	NA	A0A059T6A2	Listeria_phage	99.2	5.5e-66
WP_014929535.1|1241788_1242268_+	siphovirus Gp157 family protein	NA	A0A059T803	Listeria_phage	100.0	5.4e-79
WP_014929536.1|1242280_1242970_+	AAA family ATPase	NA	A0A059T7T3	Listeria_phage	99.6	7.5e-130
WP_014929537.1|1243033_1244290_+	DEAD/DEAH box helicase	NA	Q8W5V9	Listeria_phage	95.7	1.7e-233
WP_009928019.1|1244314_1244800_+	DUF669 domain-containing protein	NA	A0A059T5G4	Listeria_phage	100.0	2.9e-88
WP_014929538.1|1244822_1247096_+	primase	NA	A0A059T6A4	Listeria_phage	100.0	0.0e+00
WP_014929539.1|1247382_1247703_+	VRR-NUC domain-containing protein	NA	Q8W5V6	Listeria_phage	98.1	1.2e-53
WP_014929540.1|1247886_1248417_+	DUF3310 domain-containing protein	NA	A0A059T7T5	Listeria_phage	78.4	2.1e-76
WP_009928014.1|1248608_1249034_+	DUF722 domain-containing protein	NA	Q8W5V4	Listeria_phage	93.6	2.7e-69
WP_014929541.1|1249562_1249889_+	hypothetical protein	NA	A0A059T5G5	Listeria_phage	95.4	3.9e-52
WP_041176860.1|1249888_1250203_+	HNH endonuclease	NA	A0A059T6A6	Listeria_phage	99.0	1.7e-57
WP_014929542.1|1250251_1250608_+|terminase	P27 family phage terminase small subunit	terminase	A0A059T7Y1	Listeria_phage	97.0	4.5e-46
WP_014929543.1|1250604_1252248_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	99.8	0.0e+00
WP_014929544.1|1252259_1253390_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	100.0	1.9e-215
WP_014929545.1|1253386_1254184_+|protease	Clp protease ClpP	protease	A0A059T5F2	Listeria_phage	98.9	6.8e-143
WP_014929546.1|1254210_1255362_+|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	99.5	2.4e-213
WP_014929547.1|1255368_1255530_+	hypothetical protein	NA	A0A059T7Y2	Listeria_phage	98.1	1.2e-19
WP_014929548.1|1255548_1255848_+	hypothetical protein	NA	A8ATA0	Listeria_phage	98.0	3.4e-47
WP_014929549.1|1255831_1256197_+	hypothetical protein	NA	A0A059T6F2	Listeria_phage	100.0	2.9e-64
WP_014929550.1|1256193_1256595_+	hypothetical protein	NA	A0A059T5F3	Listeria_phage	97.7	1.8e-67
WP_014929551.1|1256591_1256975_+	hypothetical protein	NA	A0A059T681	Listeria_phage	95.3	2.3e-64
WP_014929552.1|1256995_1257583_+|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	98.5	2.9e-106
WP_014929553.1|1257653_1257986_+	hypothetical protein	NA	A0A059T7R2	Listeria_phage	96.4	2.5e-51
WP_009931626.1|1258036_1258198_+	hypothetical protein	NA	A0A059T6F4	Listeria_phage	98.0	4.3e-20
WP_014929554.1|1258201_1263127_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	96.8	0.0e+00
WP_014929555.1|1263119_1264769_+|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	99.6	0.0e+00
WP_014929556.1|1264781_1267076_+|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	98.6	0.0e+00
WP_014929557.1|1267065_1268157_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	96.2	1.3e-197
WP_003733957.1|1268208_1268514_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	100.0	1.8e-43
WP_014929558.1|1268513_1268795_+|holin	phage holin	holin	A8ATW3	Listeria_phage	98.9	6.7e-45
WP_014929559.1|1268794_1269475_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	93.6	3.3e-122
WP_149808156.1|1269830_1270718_+	Abi family protein	NA	NA	NA	NA	NA
WP_014929561.1|1270797_1271295_-	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	89.7	4.2e-82
WP_012951927.1|1271306_1271735_-	transcriptional regulator	NA	A8ATJ2	Listeria_phage	87.3	3.9e-28
WP_014929562.1|1271736_1272141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014929563.1|1272242_1272452_-	hypothetical protein	NA	R4IBK5	Listeria_phage	92.8	6.7e-26
WP_014929565.1|1272888_1273122_+	hypothetical protein	NA	A0A059T6E1	Listeria_phage	93.5	6.8e-35
WP_003726037.1|1274002_1274476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726932.1|1274581_1274944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014929567.1|1275612_1278861_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
1275127:1275147	attR	ATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
WP_003727539.1|1278983_1280342_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_003726043.1|1280384_1280978_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_003726044.1|1281114_1281522_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_014929568.1|1281686_1282286_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.5	5.8e-30
WP_003726046.1|1282317_1282578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726047.1|1282701_1284114_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	4.9e-51
WP_003726048.1|1284138_1284402_+	DUF3116 family protein	NA	NA	NA	NA	NA
WP_014929569.1|1284569_1285046_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003726050.1|1285083_1285329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014929570.1|1285325_1286531_-	MFS transporter	NA	NA	NA	NA	NA
WP_003726052.1|1286735_1287395_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003726053.1|1287434_1287629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726054.1|1287695_1288544_-	YitT family protein	NA	NA	NA	NA	NA
WP_003723553.1|1288873_1289011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726055.1|1289161_1289875_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_014929571.1|1289905_1291552_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003727531.1|1291570_1293055_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_014929572.1|1293172_1293634_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003726717.1|1293672_1294137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009918133.1|1294325_1295240_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014929573.1|1295264_1296512_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	1.4e-105
WP_014929574.1|1296495_1297326_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	3.6e-46
WP_003734523.1|1297472_1298612_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1298691_1299087_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1299237_1299453_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727523.1|1299576_1300110_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003731300.1|1300125_1300791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727521.1|1301052_1301991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1302105_1303389_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1303573_1304833_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
>prophage 4
NC_018586	Listeria monocytogenes SLCC2540, complete genome	2976958	2564795	2572637	2976958		Streptococcus_phage(50.0%)	7	NA	NA
WP_003725407.1|2564795_2565767_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003731212.1|2565774_2566743_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003722606.1|2566744_2567620_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_014929802.1|2567727_2569458_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	1.2e-173
WP_009918600.1|2569499_2570561_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_014929803.1|2570577_2571561_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	4.0e-52
WP_003722610.1|2571677_2572637_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
