The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018139	Legionella pneumophila subsp. pneumophila, complete genome	3467254	941044	947883	3467254		Acinetobacter_phage(42.86%)	9	NA	NA
WP_011945950.1|941044_941821_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	1.9e-57
WP_014841226.1|941813_942848_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.3	2.7e-75
WP_014841227.1|942825_943404_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	52.6	1.0e-55
WP_010946572.1|943437_944163_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_041174037.1|944159_944669_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|944649_945219_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|945215_945743_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|945756_946719_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|947085_947883_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NC_018139	Legionella pneumophila subsp. pneumophila, complete genome	3467254	1236517	1242455	3467254		Staphylococcus_phage(50.0%)	6	NA	NA
WP_014841413.1|1236517_1237591_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	28.6	2.1e-30
WP_041174046.1|1237575_1238190_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	1.0e-21
WP_014841415.1|1238186_1239395_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.2	4.5e-98
WP_014841416.1|1239402_1239870_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	50.0	4.1e-23
WP_010946915.1|1239996_1241634_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1241630_1242455_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NC_018139	Legionella pneumophila subsp. pneumophila, complete genome	3467254	2192045	2202167	3467254		Bacillus_phage(16.67%)	7	NA	NA
WP_014842062.1|2192045_2193734_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_014842063.1|2193865_2194873_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014842064.1|2194995_2196321_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_014842065.1|2196339_2197488_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	9.9e-127
WP_014842066.1|2197696_2198809_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	8.6e-51
WP_010947740.1|2198904_2200044_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_011946925.1|2200232_2202167_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NC_018139	Legionella pneumophila subsp. pneumophila, complete genome	3467254	2612311	2646231	3467254	transposase,integrase	Acinetobacter_phage(25.0%)	34	2633253:2633299	2643999:2644045
WP_014842361.1|2612311_2615356_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_154080659.1|2615711_2615873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014842362.1|2616026_2617175_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_014842363.1|2617204_2618323_+	DUF3494 domain-containing protein	NA	NA	NA	NA	NA
WP_154080660.1|2618626_2618785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027265134.1|2618832_2619174_+	helix-turn-helix domain-containing protein	NA	A0A218MNC9	uncultured_virus	39.0	4.5e-11
WP_027265133.1|2619190_2619682_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	25.8	1.3e-11
WP_014842364.1|2619930_2620182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014842365.1|2620262_2620457_-	CsbD family protein	NA	NA	NA	NA	NA
WP_014842366.1|2620589_2620943_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_014842368.1|2621799_2622303_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014842369.1|2622305_2623487_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_065211439.1|2623791_2623959_+	DUF3309 domain-containing protein	NA	NA	NA	NA	NA
WP_014842370.1|2624083_2625289_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_014842371.1|2625495_2627271_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_080031823.1|2627610_2628045_+	TIGR00341 family protein	NA	NA	NA	NA	NA
WP_014842373.1|2628080_2628407_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_110540214.1|2628465_2628906_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_014842375.1|2628921_2629248_+	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_014842376.1|2629515_2630526_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_014842377.1|2630820_2631156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014842378.1|2631325_2632657_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	35.6	3.0e-58
2633253:2633299	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_014842379.1|2633412_2634288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014842380.1|2634419_2635925_-	cytidine deaminase	NA	V9LZ62	Vibrio_phage	36.4	9.9e-10
WP_014842381.1|2636322_2636586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014842382.1|2636587_2636854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014842383.1|2637070_2637436_-	TraK family protein	NA	NA	NA	NA	NA
WP_014842384.1|2637874_2639641_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	29.7	2.6e-54
WP_014842385.1|2639720_2639975_-	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	40.6	5.5e-06
WP_014842386.1|2640437_2641244_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_027220510.1|2641255_2641927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014842389.1|2642609_2643839_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	32.8	1.8e-49
WP_014842390.1|2644149_2644848_+	hypothetical protein	NA	NA	NA	NA	NA
2643999:2644045	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_013101389.1|2645019_2646231_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	36.7	1.1e-72
