The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018877	Bacillus thuringiensis Bt407, complete sequence	5500501	312731	321107	5500501		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|312731_314039_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170549.1|314127_314847_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.8	8.0e-50
WP_000278823.1|314839_315094_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666785.1|315090_315774_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055559.1|315757_317977_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-163
WP_000879026.1|317961_319377_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262441.1|319482_320523_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	2.1e-67
WP_000088590.1|320519_321107_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 2
NC_018877	Bacillus thuringiensis Bt407, complete sequence	5500501	661189	669349	5500501		Bacillus_phage(66.67%)	8	NA	NA
WP_000030268.1|661189_662143_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.9	4.1e-17
WP_003273797.1|662330_662771_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_000822580.1|662936_664328_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.5	3.1e-34
WP_000565468.1|664339_665017_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	1.1e-32
WP_000738870.1|665192_666440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277054.1|666573_667104_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	33.5	2.5e-16
WP_000831286.1|667116_667461_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	78.1	8.5e-42
WP_000487919.1|667897_669349_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	54.4	5.8e-140
>prophage 3
NC_018877	Bacillus thuringiensis Bt407, complete sequence	5500501	691215	721271	5500501	terminase,integrase,capsid	Bacillus_phage(61.54%)	42	690461:690476	714316:714331
690461:690476	attL	TTTGGTAAGAAGAATA	NA	NA	NA	NA
WP_000645827.1|691215_692268_+	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
WP_000948241.1|692386_692731_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_000730997.1|692984_693836_+	phospholipase C	NA	NA	NA	NA	NA
WP_000676798.1|693912_694959_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.3	8.2e-88
WP_000262043.1|694897_695998_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	96.7	1.4e-199
WP_000009558.1|696824_698027_+	hypothetical protein	NA	W8CYT9	Bacillus_phage	43.3	8.0e-87
WP_000511081.1|698369_698714_-	helix-turn-helix transcriptional regulator	NA	W8CZ48	Bacillus_phage	100.0	1.9e-57
WP_000813894.1|698862_699099_+	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	100.0	4.3e-37
WP_000277640.1|699131_699320_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	98.4	9.4e-27
WP_000187072.1|699340_699988_+	sigma-70 family RNA polymerase sigma factor	NA	W8CYN8	Bacillus_phage	86.0	1.9e-98
WP_000167564.1|700265_700559_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	63.0	1.5e-26
WP_000102854.1|700580_700841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001061882.1|700912_701341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000892407.1|701448_701643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001148168.1|701721_702657_+	hypothetical protein	NA	S6C475	Thermus_phage	59.5	5.8e-101
WP_000224586.1|702678_703485_+	recombination protein RecT	NA	S6AVW6	Thermus_phage	66.8	3.1e-95
WP_000040570.1|703656_704460_+	DnaD domain protein	NA	A0A0U4JX08	Bacillus_phage	42.8	2.7e-38
WP_003269479.1|704557_705301_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	49.8	1.5e-59
WP_001045406.1|705324_705834_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000049838.1|705846_706272_+	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	51.9	4.1e-30
WP_000323349.1|706287_706956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762586.1|706945_707668_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_003269482.1|707833_708100_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000973815.1|708083_708818_+	sigma-70 family RNA polymerase sigma factor	NA	C7DTL2	Bacillus_phage	51.2	2.1e-58
WP_000520931.1|709393_709576_+	hypothetical protein	NA	A0A1B1P7L7	Bacillus_phage	58.5	2.9e-09
WP_000164425.1|709610_710408_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	51.7	3.3e-73
WP_001072816.1|711077_711452_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	40.7	6.0e-17
WP_000876114.1|711813_712029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248554.1|712313_712469_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_003269487.1|712554_712737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576172.1|712889_713462_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.1	2.2e-42
WP_000515245.1|713504_714041_+	hypothetical protein	NA	A5GYP7	Lactococcus_phage	56.3	9.5e-40
WP_000338271.1|714054_715470_+|terminase	phage terminase large subunit	terminase	U5PVG8	Bacillus_phage	69.3	7.0e-191
714316:714331	attR	TTTGGTAAGAAGAATA	NA	NA	NA	NA
WP_000222862.1|715466_715697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124815.1|715710_715911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000467413.1|715968_718092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000366284.1|718092_718368_+	DUF2829 domain-containing protein	NA	A0A0A7AQX0	Bacillus_phage	59.0	1.4e-23
WP_003269488.1|718367_718619_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.2	3.3e-19
WP_000668389.1|718618_718879_+	DUF2829 domain-containing protein	NA	S5MAK7	Bacillus_phage	70.6	4.3e-30
WP_000791085.1|718878_719133_+	hypothetical protein	NA	A0A1B1P7N4	Bacillus_phage	85.4	1.4e-38
WP_000917220.1|719216_720065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000501401.1|720080_721271_+|capsid	phage major capsid protein	capsid	A0A1B1IV93	uncultured_Mediterranean_phage	28.2	1.0e-33
>prophage 4
NC_018877	Bacillus thuringiensis Bt407, complete sequence	5500501	725678	735936	5500501	bacteriocin	Bacillus_phage(100.0%)	10	NA	NA
WP_001137510.1|725678_729947_+	hypothetical protein	NA	A0A0A0RPU4	Bacillus_phage	36.3	3.2e-138
WP_000392441.1|729998_730229_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	87.8	1.6e-28
WP_003269494.1|730228_730933_+	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	84.0	3.8e-113
WP_000494384.1|731059_731458_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_000264500.1|732255_732480_-	hypothetical protein	NA	A0A1B1P883	Bacillus_phage	74.3	1.3e-27
WP_127057661.1|732803_732935_+	hypothetical protein	NA	W8CYT8	Bacillus_phage	100.0	6.9e-21
WP_000495115.1|732954_733275_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	98.1	2.1e-50
WP_000511372.1|733285_734452_+	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	98.5	1.4e-221
WP_000842170.1|734441_735050_+	hypothetical protein	NA	W8CZ47	Bacillus_phage	98.5	2.4e-111
WP_000730126.1|735054_735936_-	HTH domain-containing protein	NA	I7ILW0	Bacillus_phage	97.3	2.3e-155
>prophage 5
NC_018877	Bacillus thuringiensis Bt407, complete sequence	5500501	1844479	1901904	5500501	integrase,terminase,transposase,portal,holin,tail	Bacillus_phage(68.57%)	72	1840005:1840023	1906791:1906809
1840005:1840023	attL	AAGCAAATGCAAAAAAAGA	NA	NA	NA	NA
WP_000499525.1|1844479_1845676_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_015055111.1|1846117_1847674_+	AAA family ATPase	NA	A7KV18	Bacillus_phage	31.8	2.4e-22
WP_000567354.1|1847687_1847990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000421152.1|1847989_1848223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273133.1|1848236_1848872_+	hypothetical protein	NA	A7KV15	Bacillus_phage	34.8	3.2e-26
WP_000334956.1|1848888_1849254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000546453.1|1849253_1850312_+	exonuclease SbcD	NA	NA	NA	NA	NA
WP_000636793.1|1850308_1850611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000137796.1|1850603_1851155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371314.1|1851164_1851683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003271401.1|1851766_1853344_+	DEAD/DEAH box helicase family protein	NA	A0A1B0Z0P8	Vibrio_phage	24.2	1.7e-15
WP_000523223.1|1853433_1853676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000191310.1|1853675_1854419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001074794.1|1854438_1857525_+	hypothetical protein	NA	A0A1L4BKL0	Thermus_phage	28.6	8.0e-14
WP_000147936.1|1857548_1859975_+	bifunctional 3'-5' exonuclease/DNA polymerase	NA	F8WQ35	Bacillus_phage	23.9	5.1e-32
WP_000532406.1|1859978_1860251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993003.1|1860213_1860471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000509446.1|1860496_1860862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001249533.1|1861004_1861328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001021290.1|1861324_1861864_+	hypothetical protein	NA	A0A288WGA4	Bacillus_phage	34.2	5.8e-21
WP_000521061.1|1861878_1862655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693593.1|1862824_1863196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391475.1|1863243_1863552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422433.1|1863589_1864570_+	site-specific DNA-methyltransferase	NA	A0A2H4JD00	uncultured_Caudovirales_phage	61.2	5.5e-118
WP_000404006.1|1864811_1865309_+	hypothetical protein	NA	A0A288WFR1	Bacillus_phage	67.4	1.7e-27
WP_000053745.1|1866655_1867066_+	hypothetical protein	NA	S5MUC4	Brevibacillus_phage	54.2	2.2e-12
WP_001043868.1|1867062_1867716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805617.1|1867837_1868155_+	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	34.7	1.0e-04
WP_000154978.1|1868171_1869089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000790088.1|1869091_1869238_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_001202995.1|1869363_1869585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000843025.1|1869581_1869863_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	3.0e-13
WP_001294615.1|1869864_1870062_+	hypothetical protein	NA	A0A1L2JY50	Aeribacillus_phage	44.8	9.5e-06
WP_000678673.1|1870058_1870256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000410292.1|1870258_1870783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001106358.1|1870779_1870962_+	hypothetical protein	NA	A0A1B1P7M4	Bacillus_phage	68.0	3.3e-13
WP_000200015.1|1870951_1871278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196741.1|1871538_1871919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873650.1|1872325_1872889_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	51.3	9.0e-41
WP_001086032.1|1873086_1873515_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	51.1	1.2e-32
WP_000323341.1|1873531_1875247_+|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	52.1	8.0e-149
WP_001265883.1|1875263_1876781_+|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	30.5	1.1e-67
WP_003271428.1|1876839_1877619_+	scaffold protein	NA	Q4ZC70	Staphylococcus_virus	40.0	9.7e-09
WP_001145075.1|1877679_1878804_+	DUF5309 family protein	NA	NA	NA	NA	NA
WP_000027969.1|1878853_1879078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868477.1|1879107_1879449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001285263.1|1879453_1880260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954643.1|1880263_1880638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001222696.1|1880637_1880997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000930921.1|1880999_1881407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000852562.1|1881420_1881927_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_000443956.1|1881950_1882310_+	hypothetical protein	NA	A0A0A7AQ61	Bacillus_phage	82.9	5.4e-39
WP_000762691.1|1882296_1882512_+	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	2.3e-29
WP_000818630.1|1882579_1882957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000931847.1|1883046_1883301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003271441.1|1883337_1887234_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	48.8	4.2e-12
WP_000959919.1|1887248_1888745_+|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	80.4	4.0e-221
WP_001260209.1|1888741_1893721_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	65.6	0.0e+00
WP_000342975.1|1893732_1894113_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	79.2	2.3e-48
WP_000822841.1|1894212_1895172_+|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	95.3	2.1e-175
WP_000373895.1|1895187_1895613_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	95.0	7.0e-70
WP_001216050.1|1895612_1896446_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P783	Bacillus_phage	88.1	1.9e-148
WP_000370580.1|1896500_1896767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230989.1|1897046_1897649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000578036.1|1897748_1897985_-	helix-turn-helix transcriptional regulator	NA	Q2I8D9	Bacillus_phage	57.9	9.0e-19
WP_000854597.1|1898141_1898264_+	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	62.2	4.8e-08
WP_000669093.1|1898905_1899106_-	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	54.5	1.1e-12
WP_001247349.1|1899291_1899558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001267622.1|1899557_1899860_+	hypothetical protein	NA	A0A288WG08	Bacillus_phage	58.2	8.0e-28
WP_000176361.1|1899856_1900039_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	81.7	1.1e-19
WP_000891521.1|1900154_1901339_+	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	62.9	2.1e-140
WP_001025807.1|1901280_1901904_+	hypothetical protein	NA	H0USY2	Bacillus_phage	80.1	2.3e-93
1906791:1906809	attR	AAGCAAATGCAAAAAAAGA	NA	NA	NA	NA
>prophage 6
NC_018877	Bacillus thuringiensis Bt407, complete sequence	5500501	1938783	1948082	5500501		Bacillus_phage(71.43%)	8	NA	NA
WP_000755523.1|1938783_1940076_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.3	5.0e-10
WP_000453879.1|1941180_1942941_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	1.8e-273
WP_015055113.1|1942981_1943659_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.5e-122
WP_001231619.1|1943655_1944729_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.8	8.8e-186
WP_003270270.1|1944753_1945347_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|1945537_1946257_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000014165.1|1946404_1947076_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	92.0	1.8e-64
WP_001258527.1|1947209_1948082_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.4	4.0e-64
>prophage 7
NC_018877	Bacillus thuringiensis Bt407, complete sequence	5500501	2368858	2375939	5500501		Bacillus_phage(50.0%)	9	NA	NA
WP_015055127.1|2368858_2369188_+	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	45.7	2.6e-16
WP_003269337.1|2369247_2369493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015466.1|2369901_2370399_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	34.0	6.2e-09
WP_000461733.1|2371104_2371344_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	92.4	1.0e-30
WP_000753400.1|2371340_2372390_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	91.0	2.4e-188
WP_000384715.1|2372448_2372790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000249917.1|2372815_2374306_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	46.7	5.0e-22
WP_001281134.1|2374533_2374770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598277.1|2375156_2375939_-	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	31.6	2.2e-21
>prophage 8
NC_018877	Bacillus thuringiensis Bt407, complete sequence	5500501	2582925	2649913	5500501	protease,integrase,terminase,transposase,portal,bacteriocin,tail,tRNA,capsid	Bacillus_phage(62.86%)	75	2583333:2583349	2648578:2648594
WP_000558614.1|2582925_2584479_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
2583333:2583349	attL	TGAAAATATTTTAGAGG	NA	NA	NA	NA
WP_001128402.1|2584538_2584967_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_000285662.1|2585117_2586032_+	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_000238996.1|2586158_2586866_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015055137.1|2586862_2587846_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000376270.1|2588164_2588791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014482037.1|2589500_2591129_+	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	33.3	3.5e-53
WP_000503549.1|2591149_2591737_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003270612.1|2592291_2592786_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000404443.1|2593101_2593872_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	1.6e-32
WP_000144179.1|2593846_2595778_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000831683.1|2595845_2596514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165517.1|2596590_2596932_-	DUF3914 domain-containing protein	NA	NA	NA	NA	NA
WP_000517061.1|2597211_2598453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000701755.1|2598540_2599566_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000471611.1|2599655_2601104_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003270605.1|2601108_2602023_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_000144507.1|2602329_2603019_+	thiaminase II	NA	NA	NA	NA	NA
WP_002082716.1|2603469_2603733_+	DUF3937 domain-containing protein	NA	NA	NA	NA	NA
WP_001071355.1|2604281_2604611_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003270601.1|2605094_2605580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000736205.1|2605891_2606593_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_000675858.1|2606631_2607741_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.4	1.1e-146
WP_000732892.1|2607972_2608446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734558.1|2608679_2609141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001197708.1|2609802_2611011_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	45.2	2.3e-81
WP_071740166.1|2611007_2611193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425257.1|2611453_2611804_-	helix-turn-helix transcriptional regulator	NA	A0A288WFW4	Bacillus_phage	39.7	9.6e-17
WP_001180927.1|2611987_2612284_+	helix-turn-helix transcriptional regulator	NA	A0A288WG89	Bacillus_phage	46.5	8.2e-09
WP_000522023.1|2612499_2612766_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	90.6	2.0e-35
WP_000190250.1|2613140_2613875_+	DnaD domain protein	NA	A0A1B1P7T6	Bacillus_phage	83.9	1.1e-89
WP_014482038.1|2613843_2614647_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	98.5	7.3e-145
WP_000332458.1|2614661_2614856_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	87.5	2.2e-26
WP_000792379.1|2614872_2615283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312979.1|2615315_2615570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014482039.1|2615657_2615801_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	68.3	9.6e-08
WP_001053955.1|2615912_2617349_-|transposase	IS4-like element IS231A family transposase	transposase	NA	NA	NA	NA
WP_001125966.1|2617595_2617955_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	52.5	1.6e-30
WP_000717823.1|2617972_2618140_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.1e-13
WP_000109538.1|2618165_2618417_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	36.1	6.5e-07
WP_140340092.1|2618529_2619318_-	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	32.1	9.4e-20
WP_000185202.1|2619533_2620322_-	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	72.3	3.0e-106
WP_000527470.1|2621230_2621590_-	cell division protein DivIVC	NA	NA	NA	NA	NA
WP_000506751.1|2621737_2621941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183173.1|2622301_2622424_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_001013579.1|2622444_2622633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001041413.1|2622922_2623393_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	91.0	7.2e-76
WP_001028517.1|2623389_2623932_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	97.2	1.0e-94
WP_000351128.1|2624056_2624713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000538961.1|2624696_2625857_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	34.5	1.1e-56
WP_000440224.1|2626289_2627219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453364.1|2627599_2627821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000615852.1|2627817_2628147_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	50.0	6.1e-21
WP_000377853.1|2628149_2628458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015467.1|2628765_2629263_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	34.0	6.2e-09
WP_000988815.1|2629237_2630914_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	57.8	7.8e-181
WP_000512879.1|2630930_2632175_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	37.5	6.8e-73
WP_003272656.1|2632191_2632824_+|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	45.5	1.9e-34
WP_000588590.1|2632837_2633962_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.0	7.2e-98
WP_001282872.1|2633975_2634299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963758.1|2634288_2634645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174092.1|2634631_2635012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001111193.1|2635001_2635412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145608.1|2635413_2635983_+	hypothetical protein	NA	Q858W9	Listeria_phage	45.4	3.5e-40
WP_000159510.1|2636044_2636395_+	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	36.5	1.5e-09
WP_000235149.1|2636577_2640408_+|tail	phage tail tape measure protein	tail	A0A1S5SFC1	Streptococcus_phage	30.2	5.8e-46
WP_000227695.1|2640400_2641087_+	hypothetical protein	NA	A0A2H4J851	uncultured_Caudovirales_phage	63.7	2.4e-80
WP_000631955.1|2641083_2643813_+	peptidase S74	NA	A0A1B1P770	Bacillus_phage	50.2	3.6e-236
WP_000387824.1|2643851_2644085_+	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	95.9	2.7e-15
WP_000499523.1|2644179_2645373_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000461714.1|2645670_2645910_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	93.7	1.5e-32
WP_000753418.1|2645906_2646971_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	94.1	4.2e-196
WP_000459799.1|2647012_2647921_+	collagen-like protein	NA	NA	NA	NA	NA
WP_000998176.1|2648185_2648485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000249915.1|2648503_2649913_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	45.8	6.2e-22
2648578:2648594	attR	CCTCTAAAATATTTTCA	NA	NA	NA	NA
>prophage 9
NC_018877	Bacillus thuringiensis Bt407, complete sequence	5500501	3729538	3850279	5500501	coat,protease,integrase,head,terminase,transposase,portal,holin,bacteriocin,tail,tRNA,capsid	Bacillus_phage(51.92%)	111	3805653:3805670	3822000:3822017
WP_000878380.1|3729538_3729895_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_000454956.1|3729928_3731362_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000006458.1|3731548_3731740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274919.1|3731960_3732668_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000671631.1|3732698_3734108_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.0	7.8e-57
WP_000066296.1|3734299_3735289_-	phosphatidylinositol diacylglycerol-lyase	NA	NA	NA	NA	NA
WP_000689202.1|3735468_3737310_-	peptidase	NA	NA	NA	NA	NA
WP_000771003.1|3737602_3738400_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	38.6	2.8e-35
WP_000272398.1|3738665_3740003_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_000791042.1|3740504_3742424_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	37.3	2.7e-97
WP_001235332.1|3742473_3745257_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000461138.1|3745761_3745947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000516464.1|3746225_3748169_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	4.5e-63
WP_000195993.1|3748177_3750850_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	24.2	2.3e-33
WP_001288799.1|3751030_3751573_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_000870460.1|3751700_3752132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005391.1|3752135_3753665_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000190159.1|3754093_3754960_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_000625417.1|3754946_3756704_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_000688049.1|3756931_3757855_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_000404341.1|3757914_3758175_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_001221095.1|3758324_3759119_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_000099769.1|3759281_3760847_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_001283854.1|3761329_3762361_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	71.8	1.9e-137
WP_000990687.1|3762505_3763744_-	competence/damage-inducible protein CinA	NA	NA	NA	NA	NA
WP_001052967.1|3763764_3764343_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000137473.1|3764407_3765319_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000574107.1|3765340_3766126_-	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_000114444.1|3766264_3766513_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_000759628.1|3766588_3767302_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000411974.1|3767402_3768689_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.9	1.0e-10
WP_000772415.1|3768689_3769964_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.0	3.5e-56
WP_000008857.1|3770172_3771132_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001085254.1|3771132_3772191_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000456926.1|3772183_3773716_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.3	6.3e-12
WP_000725769.1|3773834_3774920_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000114182.1|3775012_3775738_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001118792.1|3776276_3778658_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_000605020.1|3778870_3779074_-	ribonuclease	NA	NA	NA	NA	NA
WP_000139807.1|3779070_3779820_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_000823071.1|3779923_3781594_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000564763.1|3782519_3783398_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000692450.1|3783409_3784642_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000414846.1|3784665_3785712_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001238645.1|3785862_3786039_-	dipicolinate synthase	NA	NA	NA	NA	NA
WP_142389137.1|3786153_3787080_-	bclA protein	NA	NA	NA	NA	NA
WP_000249941.1|3787583_3788501_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	36.2	7.1e-19
WP_000069067.1|3788523_3789024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001022083.1|3789289_3789679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000540624.1|3789806_3790616_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	82.9	9.1e-135
WP_001261076.1|3790615_3790852_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A2H4JGN9	uncultured_Caudovirales_phage	100.0	1.7e-25
WP_000499523.1|3791139_3792333_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000342979.1|3792465_3792834_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	61.5	1.7e-32
WP_001260192.1|3792845_3797231_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	53.6	0.0e+00
WP_000094125.1|3797227_3798685_-|tail	phage tail protein	tail	A0A0A7AQV1	Bacillus_phage	59.9	2.3e-173
WP_000897025.1|3798726_3802353_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	86.5	1.9e-184
WP_000415912.1|3802585_3802948_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	2.4e-42
WP_001004907.1|3802952_3803540_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	82.1	5.1e-87
WP_000176452.1|3803540_3803876_-	hypothetical protein	NA	D2XR22	Bacillus_phage	89.9	7.5e-51
WP_001279008.1|3803872_3804217_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	78.8	7.0e-44
WP_001247272.1|3804218_3804569_-|head	phage head closure protein	head	D2XR20	Bacillus_phage	87.9	1.3e-53
WP_001243203.1|3804570_3804867_-	hypothetical protein	NA	D2XR19	Bacillus_phage	87.5	9.5e-42
WP_000234856.1|3804879_3806043_-|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	95.9	5.5e-210
3805653:3805670	attL	AAATAAACTTCGTAACTG	NA	NA	NA	NA
WP_000216400.1|3806062_3806839_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	1.5e-57
WP_015406504.1|3806822_3807929_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	90.1	9.0e-186
WP_000615661.1|3807994_3809653_-|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.0	1.1e-256
WP_000124844.1|3809649_3809985_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	1.7e-07
WP_001258474.1|3810137_3810479_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	93.6	1.1e-54
WP_000049336.1|3810459_3810873_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	52.5	1.1e-30
WP_000196709.1|3810886_3811108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000930972.1|3812370_3812589_-	hypothetical protein	NA	H0USV5	Bacillus_phage	66.2	5.2e-21
WP_001170299.1|3813011_3813962_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_001012136.1|3814175_3814718_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	90.6	2.1e-87
WP_000166167.1|3814717_3815200_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	80.6	2.1e-70
WP_001061238.1|3815502_3815634_-	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	83.7	4.5e-12
WP_001141572.1|3815870_3816086_+	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	80.3	7.7e-25
WP_000032817.1|3816347_3817439_+	hypothetical protein	NA	A0A285PWR0	Cedratvirus	62.6	3.7e-38
WP_001151791.1|3818195_3818417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000512858.1|3818452_3818644_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	65.1	8.3e-15
WP_001126000.1|3818717_3819080_-	hypothetical protein	NA	D2XR47	Bacillus_phage	90.0	2.4e-55
WP_000926801.1|3819054_3819243_-	hypothetical protein	NA	D2XR45	Bacillus_phage	80.0	5.3e-14
WP_000063842.1|3819245_3820568_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	94.8	1.9e-235
WP_000312138.1|3820564_3821512_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	59.9	1.2e-74
WP_000998232.1|3821791_3822076_-	hypothetical protein	NA	D2XR42	Bacillus_phage	54.3	2.5e-23
3822000:3822017	attR	CAGTTACGAAGTTTATTT	NA	NA	NA	NA
WP_000215311.1|3822256_3822478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537278.1|3822491_3823079_-	hypothetical protein	NA	D2XR41	Bacillus_phage	69.2	8.4e-74
WP_001141264.1|3823169_3823418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001036233.1|3823450_3823642_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000900759.1|3823814_3824252_+	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	59.9	7.0e-33
WP_000403118.1|3824264_3824693_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	80.3	7.1e-62
WP_000202384.1|3824776_3825589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000661246.1|3825646_3826642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844785.1|3826963_3828511_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	53.4	1.0e-142
WP_000954735.1|3828965_3829868_-	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_001239759.1|3830037_3830289_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000593001.1|3830424_3831666_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.5	4.4e-56
WP_000868222.1|3831753_3832653_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000076745.1|3832805_3834944_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001229392.1|3835104_3835374_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_000766703.1|3835474_3836446_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	31.8	2.1e-05
WP_000399362.1|3836489_3837413_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000776437.1|3837499_3837856_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000634350.1|3837871_3838153_-	DUF503 family protein	NA	NA	NA	NA	NA
WP_000036347.1|3838149_3840216_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.9	1.9e-19
WP_001286522.1|3840220_3840532_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000071125.1|3840532_3840805_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000102598.1|3840816_3841923_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000359095.1|3841940_3842411_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000060002.1|3842744_3847046_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	39.6	4.1e-24
WP_000814316.1|3847212_3848913_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001090233.1|3849022_3850279_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 10
NC_018877	Bacillus thuringiensis Bt407, complete sequence	5500501	4535791	4543474	5500501		Staphylococcus_phage(16.67%)	9	NA	NA
WP_000221100.1|4535791_4536715_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	6.9e-46
WP_000247669.1|4536841_4537777_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.9e-23
WP_000018060.1|4537778_4538471_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.0e-06
WP_001014310.1|4538813_4539008_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255968.1|4539048_4540248_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	5.6e-72
WP_000587824.1|4540542_4540866_+	heme oxygenase	NA	NA	NA	NA	NA
WP_000095598.1|4540934_4541699_-	class B sortase	NA	NA	NA	NA	NA
WP_000403738.1|4541730_4542501_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.6	1.3e-13
WP_001036824.1|4542490_4543474_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.9	7.1e-17
>prophage 11
NC_018877	Bacillus thuringiensis Bt407, complete sequence	5500501	4737287	4744331	5500501	transposase	Staphylococcus_phage(50.0%)	9	NA	NA
WP_000165837.1|4737287_4738049_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	1.0e-34
WP_000527699.1|4738314_4739337_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_000817275.1|4739493_4740651_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q331V1	Clostridium_botulinum_C_phage	59.0	9.6e-122
WP_004412121.1|4740647_4740998_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	66.7	9.2e-44
WP_001129340.1|4741212_4741362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000840869.1|4741377_4741641_-	YtzC family protein	NA	NA	NA	NA	NA
WP_000868033.1|4741752_4742712_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	72.0	1.7e-55
WP_000764492.1|4742708_4743281_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	53.4	4.1e-49
WP_000959717.1|4743497_4744331_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	1.8e-16
>prophage 12
NC_018877	Bacillus thuringiensis Bt407, complete sequence	5500501	4891799	4980343	5500501	coat,protease,integrase,head,tRNA,terminase,plate,transposase,portal,holin,tail,capsid	Bacillus_phage(67.86%)	95	4886359:4886382	4982357:4982380
4886359:4886382	attL	TTTTGTCGGTAAGTCGATATATTT	NA	NA	NA	NA
WP_000287154.1|4891799_4893176_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.1	3.4e-49
WP_001140612.1|4893215_4893599_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810334.1|4893694_4894438_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001253379.1|4894488_4895082_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_000757822.1|4895127_4896015_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	1.2e-79
WP_001104228.1|4896122_4897847_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	3.5e-176
WP_000545250.1|4897990_4898596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028674.1|4899009_4900263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537660.1|4900278_4900701_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_001183889.1|4900712_4901057_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001206693.1|4901159_4902047_-	decaprenyl-phosphate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000487953.1|4902221_4903706_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.6	1.9e-58
WP_002094181.1|4903851_4904478_-	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	43.0	2.1e-14
WP_000027016.1|4904563_4904881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517993.1|4904877_4905384_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000856603.1|4905701_4906910_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829791.1|4907372_4908362_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.9e-31
WP_000606660.1|4919125_4919605_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391931.1|4919823_4921071_+	MFS transporter	NA	NA	NA	NA	NA
WP_000535246.1|4921088_4921970_-	decarboxylase	NA	NA	NA	NA	NA
WP_000635489.1|4922050_4922512_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_000710531.1|4922834_4923662_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_000551103.1|4923671_4924292_-	hypothetical protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_000891536.1|4924233_4925415_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.7	6.9e-216
WP_000170777.1|4925530_4925713_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_001257569.1|4925709_4926027_-	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	6.4e-52
WP_000649833.1|4926209_4926407_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_001137905.1|4926415_4926595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000043397.1|4926600_4927179_+	type IV secretory system conjugative DNA transfer family protein	NA	H0USX9	Bacillus_phage	88.0	5.0e-95
WP_000119483.1|4927232_4927571_+	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	94.6	2.1e-48
WP_000405778.1|4928116_4928818_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	90.3	1.7e-121
WP_000373913.1|4928817_4929243_-|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	96.5	1.2e-69
WP_000390482.1|4929318_4929543_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	97.3	8.3e-30
WP_001243323.1|4929693_4930869_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	80.4	4.6e-172
WP_000631942.1|4930883_4933226_-	endopeptidase	NA	A0A1C8E983	Bacillus_phage	95.3	0.0e+00
WP_000884123.1|4933222_4933906_-	hypothetical protein	NA	A0A1B0T6A0	Bacillus_phage	96.0	2.1e-124
WP_001119327.1|4933906_4937299_-|tail	phage tail tape measure protein	tail	A0A1B0T698	Bacillus_phage	92.1	0.0e+00
WP_000113340.1|4937542_4937929_-	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	99.2	3.6e-65
WP_000151366.1|4937940_4938576_-	hypothetical protein	NA	A0A1C8E980	Bacillus_phage	99.1	1.6e-115
WP_000157921.1|4938587_4938965_-	hypothetical protein	NA	A0A1C8E995	Bacillus_phage	87.2	2.5e-55
WP_001166633.1|4938964_4939294_-	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	96.3	2.2e-55
WP_001126092.1|4939283_4939616_-	hypothetical protein	NA	A0A1B2APX8	Phage_Wrath	96.4	1.6e-53
WP_000342229.1|4939593_4939854_-	hypothetical protein	NA	A0A1B2APX3	Phage_Wrath	96.5	1.4e-41
WP_001049344.1|4939855_4941160_-|capsid	phage major capsid protein	capsid	A0A2H4JFZ3	uncultured_Caudovirales_phage	91.1	5.5e-198
WP_000687903.1|4941161_4941743_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	96.4	1.4e-97
WP_000603760.1|4941813_4942071_+	hypothetical protein	NA	A0A1C8E966	Bacillus_phage	70.6	2.2e-26
WP_000524246.1|4942239_4943412_-|portal	phage portal protein	portal	A0A1C8E972	Bacillus_phage	99.2	2.7e-220
WP_000587611.1|4943427_4945152_-|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	94.3	0.0e+00
WP_000113444.1|4945148_4945574_-|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	94.3	5.3e-70
WP_000872554.1|4945656_4946049_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	96.2	6.9e-72
WP_000627440.1|4946045_4946360_-	hypothetical protein	NA	A0A1B0T6C6	Bacillus_phage	89.4	1.4e-46
WP_000074276.1|4946356_4946575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052395.1|4946621_4946819_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	83.1	2.3e-23
WP_000930965.1|4946876_4947101_-	hypothetical protein	NA	H0USV5	Bacillus_phage	91.9	2.3e-32
WP_000895343.1|4947385_4947775_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	61.2	9.9e-39
WP_102981940.1|4947792_4947891_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_000847100.1|4948058_4948244_-	hypothetical protein	NA	Q3HKX5	Bacillus_phage	50.0	5.1e-09
WP_001092478.1|4948291_4948579_-	hypothetical protein	NA	A0A0S2MVI8	Bacillus_phage	92.6	8.9e-45
WP_000726820.1|4948804_4949203_-	hypothetical protein	NA	A0A1B0T6B6	Bacillus_phage	97.0	1.0e-67
WP_000159772.1|4949287_4950034_-	sigma-70 family RNA polymerase sigma factor	NA	Q2I8C6	Bacillus_phage	74.2	8.2e-98
WP_000002743.1|4950030_4950255_-	hypothetical protein	NA	C7DTL1	Bacillus_phage	72.6	4.0e-24
WP_000532218.1|4950254_4951136_-	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	32.6	5.2e-27
WP_000040038.1|4951147_4951921_-	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	47.4	4.9e-53
WP_000525424.1|4952053_4952935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372558.1|4952958_4953633_-	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	66.5	4.6e-84
WP_000277642.1|4953846_4954035_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	3.4e-21
WP_000368215.1|4954179_4954425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001236353.1|4954806_4956036_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_000004989.1|4956405_4956735_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	96.3	9.6e-51
WP_000466634.1|4957155_4958409_-	hypothetical protein	NA	H0UST6	Bacillus_phage	98.1	1.7e-212
WP_000237488.1|4959750_4960812_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.6	4.6e-171
WP_000833148.1|4960901_4961255_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	40.2	1.3e-13
WP_003272374.1|4961361_4961547_-	methyltransferase	NA	NA	NA	NA	NA
WP_000834607.1|4961950_4962721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068189.1|4963633_4964197_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000573830.1|4964302_4964656_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	42.3	8.2e-16
WP_000077392.1|4964697_4965564_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|4965810_4966050_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682065.1|4966402_4967473_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001054089.1|4967706_4967880_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000470296.1|4967935_4969375_+	iron export ABC transporter permease subunit FetB	NA	G3M9Y6	Bacillus_virus	34.4	6.8e-16
WP_000212735.1|4969616_4969958_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
WP_024927875.1|4970117_4970399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003272364.1|4970468_4971266_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_001019404.1|4971592_4972270_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003272363.1|4972368_4973163_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000248588.1|4973215_4973524_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|4973719_4973956_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125507.1|4974275_4974491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614216.1|4974552_4975554_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665103.1|4975674_4976166_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_000351152.1|4976189_4976669_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001106075.1|4976830_4977934_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000856291.1|4977878_4979225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000241506.1|4979230_4980343_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
4982357:4982380	attR	AAATATATCGACTTACCGACAAAA	NA	NA	NA	NA
