The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018693	Bacillus thuringiensis MC28, complete sequence	5414494	1176635	1224796	5414494	portal,protease,terminase,coat,capsid	Clostridium_phage(18.18%)	54	NA	NA
WP_000998630.1|1176635_1176917_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_087991529.1|1176971_1177241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000522672.1|1177256_1178558_+|portal	phage portal protein	portal	A0A060AFC9	Staphylococcus_phage	40.4	9.9e-83
WP_000781512.1|1178535_1180227_+|capsid	phage major capsid protein	capsid	A0A1I9KK60	Lactobacillus_phage	27.3	1.6e-53
WP_001194094.1|1180327_1180957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000443339.1|1181017_1181320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000799107.1|1181549_1181771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000804005.1|1181863_1183369_+	recombinase family protein	NA	I2E8X2	Clostridium_phage	29.2	3.3e-45
WP_000701123.1|1183383_1184670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001026008.1|1184887_1186768_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000648323.1|1186882_1187170_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	57.4	2.6e-12
WP_001089055.1|1187430_1188381_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	58.1	2.0e-96
WP_001259904.1|1188421_1188730_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000877946.1|1188836_1189772_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000162608.1|1190018_1190243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426310.1|1190327_1190675_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_001019817.1|1190869_1191397_+	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_001073069.1|1191579_1192632_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000040622.1|1192840_1194823_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.8	2.1e-23
WP_000539579.1|1195036_1195342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000965088.1|1195596_1195962_+	DUF3979 family protein	NA	NA	NA	NA	NA
WP_000370197.1|1195998_1197039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106367.1|1197280_1197724_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	4.8e-45
WP_000488204.1|1197825_1198281_+	DUF3939 domain-containing protein	NA	NA	NA	NA	NA
WP_000798331.1|1198545_1199490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594074.1|1199535_1200537_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000810136.1|1200641_1200833_-	DUF3896 family protein	NA	NA	NA	NA	NA
WP_001168161.1|1201010_1202474_+	flavin monoamine oxidase family protein	NA	A0A2K9L3H9	Tupanvirus	20.6	4.6e-12
WP_001068752.1|1202558_1203143_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000442814.1|1203166_1204069_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	25.6	1.2e-10
WP_000613433.1|1204234_1205185_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001048672.1|1205321_1205792_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001126163.1|1205929_1206880_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000540935.1|1207144_1207294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001042747.1|1207410_1208070_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000555702.1|1208099_1209137_-	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
WP_000283902.1|1209270_1209723_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	1.6e-27
WP_000388938.1|1209748_1210747_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000824261.1|1210818_1212480_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000911702.1|1212539_1212956_+	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	62.4	4.0e-38
WP_000543131.1|1212969_1213512_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
WP_000859186.1|1213528_1214140_+	phosphoserine phosphatase 1	NA	NA	NA	NA	NA
WP_000817489.1|1214186_1214777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938007.1|1214958_1216035_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_000153581.1|1216139_1216757_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000880689.1|1216861_1217464_+	DedA family protein	NA	NA	NA	NA	NA
WP_015000401.1|1217560_1218940_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000933700.1|1219124_1220066_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_000418718.1|1220264_1221161_+	permease	NA	NA	NA	NA	NA
WP_000488051.1|1221164_1222034_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000141169.1|1222230_1222737_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000505094.1|1222863_1222950_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_043322900.1|1223110_1224295_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_000340530.1|1224325_1224796_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 2
NC_018693	Bacillus thuringiensis MC28, complete sequence	5414494	1447881	1457517	5414494		Bacillus_phage(54.55%)	18	NA	NA
WP_000491233.1|1447881_1448235_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	86.2	2.8e-48
WP_000854270.1|1448452_1448644_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	85.2	7.0e-22
WP_000151195.1|1448685_1448955_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_187292044.1|1448965_1449136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187292043.1|1449138_1449453_+	hypothetical protein	NA	H0USU0	Bacillus_phage	66.7	1.5e-29
WP_000892409.1|1449453_1449675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001148172.1|1449753_1450689_+	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	58.8	2.2e-100
WP_000224753.1|1450704_1451511_+	recombination protein RecT	NA	S6AVW6	Thermus_phage	65.4	3.5e-94
WP_000525984.1|1451682_1452645_+	DnaD domain protein	NA	H0USU2	Bacillus_phage	52.4	2.5e-43
WP_043322942.1|1452775_1453408_+	ATP-binding protein	NA	A0A0S2GLK2	Bacillus_phage	51.4	1.3e-56
WP_000334997.1|1453413_1453602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049820111.1|1453776_1454091_+	hypothetical protein	NA	A0A0A7AQW3	Bacillus_phage	48.5	3.1e-22
WP_000049839.1|1454647_1455064_+	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	51.9	1.4e-30
WP_000120344.1|1455078_1455756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000779203.1|1455774_1456170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001237530.1|1456203_1456398_+	XtrA/YqaO family protein	NA	A0A1L2JY31	Aeribacillus_phage	54.5	7.4e-11
WP_000595938.1|1456397_1457039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072807.1|1457139_1457517_+	hypothetical protein	NA	A0A2H4J748	uncultured_Caudovirales_phage	47.2	1.8e-21
>prophage 3
NC_018693	Bacillus thuringiensis MC28, complete sequence	5414494	2892911	3006390	5414494	tRNA,portal,protease,terminase,head,coat,tail,integrase,capsid	Bacillus_phage(44.23%)	110	2947413:2947428	3011608:3011623
WP_001288802.1|2892911_2893454_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_000870465.1|2893580_2894012_-	RicAFT regulatory complex protein RicA family protein	NA	NA	NA	NA	NA
WP_001005380.1|2894015_2895545_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000190161.1|2895976_2896843_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_000625414.1|2896829_2898587_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_000688028.1|2898814_2899738_-	dipeptidase	NA	NA	NA	NA	NA
WP_000404341.1|2899796_2900057_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_001221099.1|2900206_2901001_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_000204714.1|2901148_2902714_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_001115378.1|2903197_2903623_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.9	6.0e-45
WP_000301533.1|2903888_2904512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990728.1|2905362_2906601_-	competence/damage-inducible protein CinA	NA	NA	NA	NA	NA
WP_001052980.1|2906621_2907200_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000137457.1|2907263_2908178_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000574107.1|2908199_2908985_-	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_000114447.1|2909123_2909372_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_000759614.1|2909447_2910161_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000411963.1|2910261_2911548_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	29.4	3.4e-11
WP_000772425.1|2911548_2912823_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.0	1.0e-55
WP_000008852.1|2913032_2913992_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001085263.1|2913992_2915051_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000456933.1|2915043_2916576_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	2.8e-12
WP_000725766.1|2916694_2917780_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	32.8	5.8e-44
WP_000114182.1|2917872_2918598_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001118764.1|2919137_2921522_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_000605019.1|2921740_2921944_-	YlzJ-like family protein	NA	NA	NA	NA	NA
WP_000139820.1|2921940_2922690_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_000823093.1|2922793_2924464_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000564770.1|2925067_2925946_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000692465.1|2925957_2927190_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000414844.1|2927213_2928260_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_087991510.1|2928410_2928626_-	dipicolinate synthase	NA	NA	NA	NA	NA
WP_000459795.1|2928702_2930043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000713578.1|2930627_2931125_+	hypothetical protein	NA	A0A1B2APY6	Phage_Wrath	75.8	1.4e-64
WP_000856248.1|2931653_2932301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272604.1|2932423_2933689_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	48.3	2.5e-107
WP_001057809.1|2933685_2934027_+	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	33.3	1.1e-06
WP_000913819.1|2934235_2934733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939539.1|2934996_2935500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939538.1|2935992_2936484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000751890.1|2936535_2937600_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	90.1	4.5e-190
WP_000461731.1|2937596_2937836_-	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	93.7	8.5e-33
WP_000398742.1|2937835_2938072_-	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	84.6	6.7e-14
WP_001067565.1|2938193_2938592_-	hypothetical protein	NA	A0A2H4JGF7	uncultured_Caudovirales_phage	93.2	5.7e-66
WP_000030428.1|2938606_2943136_-|tail	phage tail protein	tail	A0A2H4JF18	uncultured_Caudovirales_phage	78.5	0.0e+00
WP_000094108.1|2943132_2944590_-|tail	phage tail family protein	tail	A0A2H4JH21	uncultured_Caudovirales_phage	90.3	1.2e-265
WP_000918793.1|2944630_2948251_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	88.3	8.1e-191
2947413:2947428	attL	ACAGCTTCTTCTACTG	NA	NA	NA	NA
WP_000415910.1|2948482_2948845_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	92.5	1.1e-55
WP_001004909.1|2948849_2949437_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	83.1	7.1e-89
WP_000172100.1|2949437_2949767_-	hypothetical protein	NA	D2XR22	Bacillus_phage	96.3	7.6e-56
WP_015000873.1|2950109_2950460_-|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	84.6	3.0e-50
WP_000381899.1|2950461_2950755_-	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	90.7	3.5e-44
WP_000234881.1|2950760_2951912_-|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	95.8	1.9e-207
WP_000216408.1|2951915_2952698_-|protease	Clp protease ClpP	protease	R9TLM7	Paenibacillus_phage	58.6	5.6e-57
WP_000628341.1|2952681_2953845_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	81.5	3.7e-182
WP_000621029.1|2953854_2955522_-|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	93.5	5.2e-310
WP_000301149.1|2955518_2955830_-|terminase	P27 family phage terminase small subunit	terminase	D2XR14	Bacillus_phage	97.1	3.6e-47
WP_001008150.1|2955956_2956292_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.9	2.1e-53
WP_000333208.1|2956284_2956458_-	hypothetical protein	NA	A0A1B1P8J7	Bacillus_phage	84.2	1.6e-20
WP_001072609.1|2956463_2956691_-	hypothetical protein	NA	D2XR60	Bacillus_phage	80.6	8.1e-25
WP_001294974.1|2957605_2958301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743936.1|2959078_2960065_+	hypothetical protein	NA	A0A143FNS3	Bacillus_phage	67.0	4.3e-30
WP_000743935.1|2960245_2961295_-	C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	50.4	1.8e-21
WP_001012141.1|2961467_2962010_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	89.4	4.0e-86
WP_000166149.1|2961984_2962491_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	84.8	1.2e-71
WP_000862383.1|2962518_2962689_-	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	80.4	2.2e-11
WP_000960588.1|2962805_2963003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113468.1|2963219_2963384_+	hypothetical protein	NA	A0A288WGN0	Bacillus_phage	98.1	5.7e-20
WP_000512851.1|2964577_2964769_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	63.5	1.9e-14
WP_001125995.1|2964840_2965203_-	hypothetical protein	NA	D2XR47	Bacillus_phage	91.7	2.2e-56
WP_000926802.1|2965177_2965366_-	hypothetical protein	NA	D2XR45	Bacillus_phage	83.6	6.3e-15
WP_000063896.1|2965368_2966691_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	93.6	6.9e-233
WP_000312132.1|2966687_2967635_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	62.1	4.8e-87
WP_000215314.1|2968385_2968607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537276.1|2968620_2969208_-	hypothetical protein	NA	D2XR41	Bacillus_phage	68.7	1.4e-73
WP_043322254.1|2969298_2969547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000405170.1|2969601_2969793_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000172330.1|2969963_2970374_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	52.4	1.6e-31
WP_043323121.1|2970386_2970830_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	76.1	2.9e-58
WP_000411164.1|2970850_2971669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844783.1|2971763_2973311_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	53.4	3.9e-142
WP_000954741.1|2973765_2974668_-	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_001239739.1|2974835_2975087_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000592990.1|2975216_2976458_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.2	7.5e-56
WP_000868234.1|2976544_2977444_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000076756.1|2977595_2979734_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001229392.1|2979894_2980164_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_000766713.1|2980264_2981236_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	33.6	4.3e-06
WP_000399360.1|2981279_2982203_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000776439.1|2982288_2982645_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000036352.1|2982938_2984999_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	1.4e-19
WP_001286525.1|2985003_2985315_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000071127.1|2985315_2985588_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000102596.1|2985599_2986706_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000359095.1|2986723_2987194_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000060013.1|2987527_2991829_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	39.6	5.3e-24
WP_000814296.1|2991953_2993654_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001090232.1|2993763_2995020_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_000790354.1|2995037_2996180_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000813595.1|2996203_2996995_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000971308.1|2997012_2997789_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	3.4e-22
WP_000531505.1|2997874_2998432_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000042662.1|2998434_2999157_-	UMP kinase	NA	NA	NA	NA	NA
WP_001018579.1|2999223_3000111_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_000111485.1|3000214_3000916_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000421291.1|3001264_3002044_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_000550076.1|3002121_3003513_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.7	7.2e-47
WP_000526274.1|3003535_3004078_-|protease	ATP-dependent protease proteolytic subunit HslV	protease	NA	NA	NA	NA
WP_001101234.1|3004120_3005020_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	3.1e-35
WP_000212000.1|3005085_3006390_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
3011608:3011623	attR	ACAGCTTCTTCTACTG	NA	NA	NA	NA
>prophage 4
NC_018693	Bacillus thuringiensis MC28, complete sequence	5414494	3071449	3146059	5414494	tRNA,portal,holin,protease,terminase,head,tail,integrase,capsid	Bacillus_phage(80.0%)	95	3103556:3103570	3146099:3146113
WP_000455944.1|3071449_3074215_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	28.0	1.1e-86
WP_001131611.1|3074562_3075069_-	septum site-determining protein DivIVA	NA	NA	NA	NA	NA
WP_000029703.1|3075158_3075926_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_000214326.1|3075941_3076205_-	YggT family protein	NA	NA	NA	NA	NA
WP_000119137.1|3076211_3076682_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_000218001.1|3076701_3077376_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001209013.1|3077372_3078191_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_043322276.1|3078309_3078594_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000197755.1|3078762_3079542_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.9	3.4e-46
WP_000976947.1|3079699_3080419_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	2.5e-19
WP_000261989.1|3080438_3081356_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_000888977.1|3081741_3082896_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_001087556.1|3082935_3084243_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_000798216.1|3084644_3085415_-	cell division protein DivIB	NA	NA	NA	NA	NA
WP_000437053.1|3085513_3086419_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_001265419.1|3086481_3087576_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_000753526.1|3087677_3088769_-	stage V sporulation protein E	NA	NA	NA	NA	NA
WP_000860135.1|3088859_3090212_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_000893064.1|3090212_3091187_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_000766293.1|3091209_3092685_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_001266241.1|3092893_3094810_-	stage V sporulation protein D	NA	NA	NA	NA	NA
WP_002093365.1|3094891_3096991_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_000182809.1|3097063_3097426_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_000472506.1|3097441_3098374_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_000405027.1|3098743_3100360_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
WP_033661358.1|3100439_3101324_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_000506686.1|3101618_3102092_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000246459.1|3102125_3102632_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	34.7	3.9e-11
WP_001984764.1|3102761_3102935_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_000872142.1|3102996_3103497_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
3103556:3103570	attL	GTTTTTTCTTTACAC	NA	NA	NA	NA
WP_001025812.1|3103779_3104400_-	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	80.1	1.6e-94
WP_000891541.1|3104341_3105523_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	82.4	1.0e-187
WP_000170781.1|3105638_3105821_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	93.3	2.7e-23
WP_001267644.1|3105823_3106126_-	hypothetical protein	NA	Q2I8E3	Bacillus_phage	91.0	8.5e-46
WP_000340447.1|3106285_3106480_+	helix-turn-helix domain-containing protein	NA	A0A1B1P7S8	Bacillus_phage	93.8	4.1e-25
WP_000728659.1|3106573_3107191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000509865.1|3107254_3108049_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	68.3	9.6e-105
WP_000002925.1|3108116_3108611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000375618.1|3108610_3109036_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	96.5	1.6e-69
WP_000390483.1|3109109_3109334_-	XpaF1 protein	NA	A0A1B1P780	Bacillus_phage	90.3	8.5e-27
WP_000403082.1|3109485_3109854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001123596.1|3109859_3111596_-	hypothetical protein	NA	A0A1D6X866	Bacillus_phage	26.3	3.3e-09
WP_000301779.1|3111604_3112693_-	hypothetical protein	NA	U5J9M9	Bacillus_phage	51.5	5.0e-88
WP_043322286.1|3112711_3114718_-|tail	phage tail protein	tail	A0A0U4JID8	Exiguobacterium_phage	35.5	7.6e-82
WP_000184668.1|3114730_3115516_-|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	53.2	5.6e-73
WP_000896618.1|3115512_3120543_-|tail	phage tail tape measure protein	tail	A0A1B1P7S6	Bacillus_phage	85.0	0.0e+00
WP_043323124.1|3120558_3120699_-	hypothetical protein	NA	A0A1B1P7R9	Bacillus_phage	89.1	1.6e-15
WP_142333337.1|3120716_3121148_-	hypothetical protein	NA	A0A1B1P7S9	Bacillus_phage	81.1	2.1e-53
WP_000997085.1|3121183_3121756_-|tail	tail protein	tail	A0A1B1P7S4	Bacillus_phage	78.4	7.2e-86
WP_001211419.1|3121767_3122127_-	hypothetical protein	NA	A0A1B1P7S7	Bacillus_phage	87.4	4.8e-56
WP_000852718.1|3122123_3122561_-	HK97 gp10 family phage protein	NA	A0A1B1P7R6	Bacillus_phage	93.1	2.2e-71
WP_001069941.1|3122548_3122896_-|head	phage head closure protein	head	A0A1B1P7T4	Bacillus_phage	92.2	9.4e-57
WP_000891457.1|3122882_3123158_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B1P7Q8	Bacillus_phage	91.2	5.9e-38
WP_000272023.1|3123166_3123367_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_000790812.1|3123443_3124625_-|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	91.6	6.9e-200
WP_001107321.1|3124624_3125377_-|protease	Clp protease ClpP	protease	A0A0U3U021	Bacillus_phage	95.6	7.9e-133
WP_000697138.1|3125354_3126569_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	89.9	2.4e-216
WP_000626165.1|3126584_3128357_-|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	96.6	0.0e+00
WP_000357496.1|3128337_3128718_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B1P7R2	Bacillus_phage	94.4	1.3e-62
WP_001209623.1|3128879_3129242_-	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	82.5	9.5e-52
WP_000964489.1|3129244_3129472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148283617.1|3129964_3130216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043323127.1|3130278_3130545_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	82.4	1.5e-30
WP_001028525.1|3131558_3132101_-|integrase	site-specific integrase	integrase	A0A1B1P746	Bacillus_phage	88.9	2.5e-88
WP_001041479.1|3132097_3132568_-	hypothetical protein	NA	A0A1B1P744	Bacillus_phage	63.2	2.0e-49
WP_000866137.1|3132588_3132759_-	hypothetical protein	NA	A0A1B1P735	Bacillus_phage	80.4	5.1e-08
WP_001031142.1|3132872_3133163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538740.1|3133187_3133457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000662513.1|3133486_3133846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015000902.1|3133936_3134083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000453752.1|3134133_3134367_-	hypothetical protein	NA	Q5YA92	Bacillus_phage	42.6	4.9e-09
WP_000873540.1|3134399_3134852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000438094.1|3134890_3135313_-	hypothetical protein	NA	A0A2H4J3B9	uncultured_Caudovirales_phage	75.0	1.5e-08
WP_000533093.1|3135476_3135932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000288162.1|3136118_3136547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121197.1|3136531_3136735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000077268.1|3136769_3137237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000675888.1|3137270_3137747_-	hypothetical protein	NA	A0A288WFT9	Bacillus_phage	68.2	6.4e-64
WP_015000905.1|3137750_3138266_-	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	43.9	1.0e-27
WP_001272170.1|3138286_3138760_-	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	42.5	2.2e-08
WP_000711468.1|3138785_3138950_-	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	63.5	1.3e-11
WP_001125958.1|3138968_3139328_-	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	54.2	2.9e-32
WP_000799037.1|3139320_3139599_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	64.4	5.1e-13
WP_001060923.1|3139602_3140628_-	DnaD domain protein	NA	W8CYG5	Bacillus_phage	42.3	9.0e-55
WP_015000907.1|3140685_3140850_-	hypothetical protein	NA	A0A1B0T6C1	Bacillus_phage	70.4	8.7e-13
WP_000284335.1|3140906_3141107_-	helix-turn-helix domain-containing protein	NA	A0A0U4IIS1	Bacillus_phage	50.0	1.4e-07
WP_000935434.1|3141217_3141412_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	45.2	1.4e-06
WP_001021262.1|3141580_3141937_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	44.6	5.4e-15
WP_000908626.1|3141933_3142116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720667.1|3142258_3142393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001165427.1|3142394_3143540_-	hypothetical protein	NA	H0UST6	Bacillus_phage	33.0	5.3e-56
WP_001091276.1|3143977_3144322_+	helix-turn-helix transcriptional regulator	NA	I3VYY8	Thermoanaerobacterium_phage	32.9	2.2e-05
WP_000833168.1|3144409_3144598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000503721.1|3144616_3144766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000323189.1|3144928_3146059_+|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	37.7	1.2e-63
3146099:3146113	attR	GTTTTTTCTTTACAC	NA	NA	NA	NA
>prophage 5
NC_018693	Bacillus thuringiensis MC28, complete sequence	5414494	3701133	3708806	5414494		Staphylococcus_phage(16.67%)	10	NA	NA
WP_000221075.1|3701133_3702057_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.1	5.3e-46
WP_000183219.1|3702183_3703119_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	6.3e-23
WP_000018038.1|3703120_3703813_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.4e-06
WP_001293580.1|3703981_3704155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014310.1|3704155_3704350_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255937.1|3704389_3705589_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.3	1.9e-72
WP_000587821.1|3705875_3706199_+	heme oxygenase	NA	NA	NA	NA	NA
WP_015001005.1|3706265_3707030_-	class B sortase	NA	NA	NA	NA	NA
WP_000403759.1|3707062_3707833_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	1.7e-13
WP_001036848.1|3707822_3708806_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	1.1e-17
>prophage 6
NC_018693	Bacillus thuringiensis MC28, complete sequence	5414494	4932251	4940626	5414494		Synechococcus_phage(50.0%)	8	NA	NA
WP_000610752.1|4932251_4933559_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.5	4.9e-21
WP_001170546.1|4933647_4934367_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	3.0e-49
WP_000278820.1|4934359_4934614_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666770.1|4934610_4935294_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055551.1|4935277_4937497_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	3.7e-162
WP_000879031.1|4937481_4938897_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_001262428.1|4939001_4940042_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.6	1.2e-67
WP_000088571.1|4940038_4940626_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.8	2.3e-26
>prophage 7
NC_018693	Bacillus thuringiensis MC28, complete sequence	5414494	5098838	5143196	5414494	portal,protease,terminase,head,tail,integrase,capsid	Bacillus_phage(58.33%)	61	5115106:5115121	5129142:5129157
WP_000615219.1|5098838_5100218_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	38.3	2.3e-85
WP_000679469.1|5100278_5101403_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	86.1	5.2e-189
WP_000970854.1|5101578_5101737_+	hypothetical protein	NA	A0A1B0T6B0	Bacillus_phage	92.3	1.1e-15
WP_000742855.1|5102415_5103012_-	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	70.4	2.7e-43
WP_001215551.1|5103420_5103765_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	63.1	1.5e-33
WP_001174513.1|5104260_5105424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000722888.1|5105430_5105586_+	hypothetical protein	NA	A0A1B1P8B4	Bacillus_phage	66.7	6.5e-10
WP_001213812.1|5105886_5106237_-	helix-turn-helix transcriptional regulator	NA	A0A142LP08	Marinitoga_camini_virus	43.9	1.7e-05
WP_000575563.1|5106503_5106707_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001072754.1|5106788_5107583_+	phage antirepressor KilAC domain-containing protein	NA	R4IFK0	Staphylococcus_phage	55.5	2.5e-76
WP_000798610.1|5107649_5108000_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	90.5	6.8e-55
WP_000969631.1|5107996_5108164_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	72.2	5.6e-15
WP_000364138.1|5108193_5108370_+	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	87.9	4.5e-23
WP_000005657.1|5108375_5109263_+	phage replisome organizer N-terminal domain-containing protein	NA	V9QKF6	Oenococcus_phage	45.1	7.8e-55
WP_001148325.1|5109198_5110068_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	71.9	5.8e-103
WP_000332468.1|5110070_5110265_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	84.4	1.3e-23
WP_000805169.1|5110290_5110464_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	89.5	1.3e-22
WP_000811697.1|5110478_5110733_+	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	84.5	6.7e-36
WP_015001249.1|5110740_5111205_+	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	35.4	7.5e-17
WP_000665840.1|5111231_5111444_+	hypothetical protein	NA	A0A1B0T6B5	Bacillus_phage	95.2	1.5e-25
WP_000360135.1|5111481_5111736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025407.1|5111772_5111997_+	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	67.6	1.3e-22
WP_000784377.1|5111993_5112293_-	hypothetical protein	NA	W8CYG6	Bacillus_phage	62.6	2.8e-25
WP_000668246.1|5112442_5112583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124017.1|5112620_5112989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000339165.1|5113008_5113251_+	hypothetical protein	NA	A0A1B1P7A3	Bacillus_phage	70.5	8.4e-28
WP_000021719.1|5113284_5113590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424484.1|5114541_5114706_+	hypothetical protein	NA	A0A0A7AQ96	Bacillus_phage	75.5	3.8e-16
5115106:5115121	attL	CTAAAATCACCTGAAT	NA	NA	NA	NA
WP_001245639.1|5115128_5115950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000666332.1|5117043_5117790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000497527.1|5117812_5118994_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	29.0	4.4e-37
WP_000166146.1|5119285_5119774_+	ArpU family transcriptional regulator	NA	A0A1B0T6C9	Bacillus_phage	95.7	8.3e-83
WP_001012127.1|5119770_5120313_+|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	97.8	1.4e-94
WP_000930964.1|5120528_5120753_+	hypothetical protein	NA	H0USV5	Bacillus_phage	91.9	1.3e-30
WP_001033082.1|5121201_5121390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347594.1|5121456_5122332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000452083.1|5122384_5122627_+	hypothetical protein	NA	A0A288WG15	Bacillus_phage	66.2	4.3e-24
WP_000378695.1|5122642_5122906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241249.1|5122925_5123297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000666405.1|5123262_5123598_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	93.7	3.8e-55
WP_000301148.1|5123721_5124033_+|terminase	P27 family phage terminase small subunit	terminase	D2XR14	Bacillus_phage	89.2	3.8e-41
WP_000595322.1|5124029_5125697_+|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	86.8	7.8e-290
WP_049820091.1|5125762_5126872_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	88.9	3.1e-186
WP_000812150.1|5126852_5127620_+|protease	Clp protease ClpP	protease	A0A2H4JC91	uncultured_Caudovirales_phage	94.9	4.2e-105
WP_000152781.1|5127639_5128803_+|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	86.3	4.6e-188
WP_000361978.1|5128815_5129109_+	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	80.4	9.8e-39
WP_043322706.1|5129110_5129464_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	94.9	2.3e-58
5129142:5129157	attR	ATTCAGGTGATTTTAG	NA	NA	NA	NA
WP_000997552.1|5129465_5129810_+	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	93.8	3.3e-54
WP_000176455.1|5129806_5130145_+	hypothetical protein	NA	D2XR22	Bacillus_phage	85.5	4.3e-46
WP_000829684.1|5130145_5130718_+|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	57.4	5.5e-54
WP_000751343.1|5130722_5131085_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	55.0	5.4e-31
WP_000918776.1|5131326_5135283_+	hypothetical protein	NA	D2XR25	Bacillus_phage	71.1	2.8e-144
WP_000059749.1|5135279_5136089_+|tail	phage tail family protein	tail	A0A2H4J982	uncultured_Caudovirales_phage	40.4	9.9e-57
WP_000752639.1|5136102_5138034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001176103.1|5138077_5140021_+|tail	phage tail protein	tail	A0A2H4JG80	uncultured_Caudovirales_phage	59.7	1.4e-160
WP_001193275.1|5140058_5140505_+	hypothetical protein	NA	A0A2H4J980	uncultured_Caudovirales_phage	76.5	1.1e-52
WP_000482991.1|5140541_5141252_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	45.0	1.4e-35
WP_000390472.1|5141361_5141586_+	XpaF1 protein	NA	A0A1B1P780	Bacillus_phage	87.5	9.5e-26
WP_000398746.1|5141659_5141896_+	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	88.5	1.2e-15
WP_000461735.1|5141895_5142135_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	91.1	1.6e-31
WP_000751921.1|5142131_5143196_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	91.5	5.3e-191
>prophage 1
NC_018687	Bacillus thuringiensis MC28 plasmid pMC189, complete sequence	189702	78224	163995	189702	integrase,tRNA,transposase	Streptococcus_phage(25.0%)	55	73657:73676	120779:120798
73657:73676	attL	TTGAAAATATGAAATGTCTT	NA	NA	NA	NA
WP_080595736.1|78224_78554_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	33.3	3.2e-06
WP_000667332.1|78994_80155_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000360259.1|80510_81494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148283635.1|82899_84312_+	phosphatidylinositol-specific phospholipase C domain-containing protein	NA	NA	NA	NA	NA
WP_014990534.1|86091_87615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000730235.1|91273_92200_-	ETX/MTX2 family pore-forming toxin	NA	NA	NA	NA	NA
WP_001055929.1|92634_94068_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001243455.1|95832_96876_-	Fic family protein	NA	NA	NA	NA	NA
WP_000058822.1|97358_98846_+	spore germination protein	NA	NA	NA	NA	NA
WP_000527478.1|98861_99962_+	endospore germination permease	NA	NA	NA	NA	NA
WP_000288490.1|101535_103188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014990538.1|103252_105262_-	pesticidal crystal protein	NA	NA	NA	NA	NA
WP_000371897.1|107788_108409_-	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_000124664.1|109047_109422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018641.1|109423_110245_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	44.6	3.3e-52
WP_000473546.1|111903_112173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080595738.1|112277_112379_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000475291.1|112656_113082_+	DUF4879 domain-containing protein	NA	NA	NA	NA	NA
WP_000406883.1|113186_113573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001190697.1|113632_115429_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.6	9.0e-34
WP_087991598.1|117247_117394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000410927.1|118084_119434_+	YncE family protein	NA	NA	NA	NA	NA
WP_000410923.1|119622_120699_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_000448254.1|123135_123357_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
120779:120798	attR	TTGAAAATATGAAATGTCTT	NA	NA	NA	NA
WP_001202887.1|123378_123660_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	55.7	9.1e-10
WP_000620809.1|123859_124759_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000762456.1|125174_126359_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_000943139.1|126391_127429_-	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	35.4	4.1e-39
WP_000251826.1|127736_128444_-|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_000637312.1|128491_129391_-	kinase	NA	NA	NA	NA	NA
WP_000454883.1|129516_130959_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_181004266.1|132145_132466_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_001201432.1|132909_133323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000494383.1|134314_134500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014990559.1|136875_138543_+	collagen-like protein	NA	NA	NA	NA	NA
WP_000104995.1|138924_139803_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_000836979.1|142375_144502_-	phosphatidylinositol-specific phospholipase C domain-containing protein	NA	NA	NA	NA	NA
WP_000804096.1|144936_145164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001055905.1|145987_147421_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001196891.1|148236_149103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001064653.1|149178_150228_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_103592562.1|151103_151571_+	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_001123487.1|151604_151898_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000899478.1|152014_152587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133497.1|153117_153657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000974221.1|153753_154116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043324653.1|154633_154933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000533915.1|154963_155362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043324655.1|155606_155858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199494.1|156173_156815_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	36.5	1.8e-21
WP_000837527.1|157372_158374_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	57.9	6.0e-88
WP_000823322.1|158626_159607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000377015.1|160501_161902_-	phosphatidylinositol-specific phospholipase C	NA	NA	NA	NA	NA
WP_000730172.1|162299_162872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014990573.1|163311_163995_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	58.3	4.0e-67
>prophage 1
NC_018688	Bacillus thuringiensis MC28 plasmid pMC319, complete sequence	319710	269814	276349	319710		Bacillus_phage(83.33%)	7	NA	NA
WP_000987741.1|269814_270426_-	replication-relaxation family protein	NA	W8CZ47	Bacillus_phage	75.1	1.2e-86
WP_000522930.1|270415_271582_-	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	80.2	7.6e-183
WP_000958236.1|271592_271787_-	hypothetical protein	NA	A0A1B1P7T1	Bacillus_phage	56.2	4.2e-14
WP_000467346.1|272004_272229_+	helix-turn-helix domain-containing protein	NA	A0A0A7AR43	Bacillus_phage	54.4	3.6e-17
WP_148283640.1|272321_272834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000424045.1|273375_273615_-	hypothetical protein	NA	A0A1B1P8F3	Bacillus_phage	38.6	1.0e-06
WP_000483141.1|274369_276349_-	DUF3472 domain-containing protein	NA	G1FGA4	Mycobacterium_phage	40.2	7.2e-08
>prophage 1
NC_018689	Bacillus thuringiensis MC28 plasmid pMC429, complete sequence	429674	250250	258760	429674		Bacillus_phage(88.89%)	15	NA	NA
WP_001043915.1|250250_250460_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	59.4	7.7e-14
WP_000376551.1|251063_251201_+	DUF3956 domain-containing protein	NA	NA	NA	NA	NA
WP_000513195.1|251331_251616_-	hypothetical protein	NA	A0A1B1P857	Bacillus_phage	76.7	2.1e-30
WP_000462901.1|251960_252152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000441076.1|252386_252548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001000165.1|253378_253543_+	hypothetical protein	NA	A0A288WGN0	Bacillus_phage	55.6	2.6e-09
WP_001008433.1|254692_254941_+	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	79.3	3.5e-29
WP_000776806.1|255323_255770_-	dUTP diphosphatase	NA	A0A0U3SLD3	Bacillus_phage	79.1	1.4e-60
WP_000712300.1|255810_255951_-	hypothetical protein	NA	A0A0U3SD36	Bacillus_phage	87.0	1.7e-12
WP_080451858.1|256018_256150_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_043324812.1|256246_256510_-	hypothetical protein	NA	W8CYZ5	Bacillus_phage	56.8	1.4e-20
WP_181004292.1|256479_256551_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000516004.1|256759_257278_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	74.6	3.5e-47
WP_000540766.1|257571_258132_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000476456.1|258331_258760_+	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	43.3	8.4e-23
>prophage 2
NC_018689	Bacillus thuringiensis MC28 plasmid pMC429, complete sequence	429674	318773	326951	429674		Bacillus_phage(85.71%)	9	NA	NA
WP_001214906.1|318773_319094_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	68.0	1.3e-31
WP_000767011.1|319104_320271_+	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	78.6	6.2e-177
WP_014990779.1|320311_320869_+	replication-relaxation family protein	NA	W8CZ47	Bacillus_phage	75.1	9.8e-80
WP_000760455.1|320958_321294_+	YxeA family protein	NA	NA	NA	NA	NA
WP_000799428.1|321714_322362_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	33.2	5.2e-16
WP_043324884.1|322661_324125_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.7	9.0e-24
WP_000800731.1|324138_324804_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	2.7e-36
WP_000050963.1|324967_325144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000494789.1|325742_326951_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.9	1.5e-24
>prophage 3
NC_018689	Bacillus thuringiensis MC28 plasmid pMC429, complete sequence	429674	358204	374836	429674	terminase,capsid,portal	Bacillus_phage(42.86%)	24	NA	NA
WP_000477260.1|358204_359026_+	hypothetical protein	NA	F2NZ47	Diadromus_pulchellus_ascovirus	29.8	1.5e-23
WP_001046354.1|359030_359423_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000764188.1|359576_360101_+	ester cyclase	NA	NA	NA	NA	NA
WP_000834515.1|360639_361284_-	helix-turn-helix domain-containing protein	NA	A0A2H4J245	uncultured_Caudovirales_phage	34.3	3.1e-29
WP_000549411.1|361421_361622_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	51.7	1.7e-10
WP_000231465.1|362152_362437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000096620.1|362517_363282_+	conserved phage C-terminal domain-containing protein	NA	A0A1W6JNI1	Staphylococcus_phage	49.2	7.9e-56
WP_176548852.1|363265_364048_+	ATP-binding protein	NA	U5PWH5	Bacillus_phage	35.6	3.3e-33
WP_001261480.1|364283_364922_+	hypothetical protein	NA	X2JKZ4	Bacillus_phage	28.6	7.9e-09
WP_000765289.1|364902_365079_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_000931949.1|365142_365523_+	hypothetical protein	NA	A0A0M4R397	Bacillus_phage	42.7	1.4e-16
WP_001205172.1|365793_366294_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0A7AQW8	Bacillus_phage	60.4	2.2e-46
WP_000892958.1|366527_366713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113634.1|366730_367222_+	hypothetical protein	NA	A0A1B0XTP0	Freshwater_phage	22.8	1.8e-05
WP_043324840.1|367402_368659_+|terminase	phage terminase large subunit	terminase	A0A2H4J7G6	uncultured_Caudovirales_phage	51.1	2.2e-111
WP_000229506.1|368752_370093_+|portal	phage portal protein	portal	A0A222YY66	Streptomyces_phage	29.3	4.5e-46
WP_001132396.1|370121_371312_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	31.1	3.2e-35
WP_001060156.1|371332_372313_+|capsid	phage major capsid protein	capsid	H7BVA6	unidentified_phage	41.4	3.6e-69
WP_080595761.1|372329_372494_+	YqbF domain-containing protein	NA	NA	NA	NA	NA
WP_000406976.1|372507_373041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000392019.1|373069_373396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033663286.1|373397_373814_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_000208341.1|373810_374227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000118566.1|374239_374836_+	hypothetical protein	NA	A0A1S5S9Y8	Streptococcus_phage	31.3	5.3e-15
>prophage 1
NC_018694	Bacillus thuringiensis MC28 plasmid pMC54, complete sequence	54484	34879	54484	54484	terminase,integrase,portal	Bacillus_phage(71.43%)	32	38118:38131	52567:52580
WP_001092095.1|34879_35224_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAY7	uncultured_Caudovirales_phage	35.9	2.8e-08
WP_001161769.1|35819_37007_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	48.7	1.7e-89
WP_000837442.1|37026_37167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001099889.1|37331_37511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001213815.1|37531_37870_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000667090.1|38074_38293_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
38118:38131	attL	AAAAGATTAAACAA	NA	NA	NA	NA
WP_000088808.1|38368_39043_+	Rha family transcriptional regulator	NA	A0A0U4IS08	Exiguobacterium_phage	41.0	3.0e-35
WP_001121079.1|39066_39429_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	67.8	7.6e-41
WP_000521761.1|39451_39799_+	hypothetical protein	NA	A0A0S2MVM3	Bacillus_phage	56.5	4.7e-24
WP_000348869.1|39987_40488_+	hypothetical protein	NA	A0A0A7AQW2	Bacillus_phage	72.4	4.1e-61
WP_000139416.1|40456_40873_+	hypothetical protein	NA	A0A0S2MVI0	Bacillus_phage	63.5	1.7e-44
WP_000706095.1|40875_41343_+	hypothetical protein	NA	A0A0A7AR00	Bacillus_phage	45.8	3.4e-33
WP_000667212.1|41549_41831_+	hypothetical protein	NA	A0A0S2MVD9	Bacillus_phage	56.2	8.2e-19
WP_000843532.1|41827_42277_+	hypothetical protein	NA	A0A0S2MVJ1	Bacillus_phage	79.3	5.8e-67
WP_001216591.1|42273_42855_+	dUTP diphosphatase	NA	A0A0S2MVD0	Bacillus_phage	82.4	2.6e-91
WP_000841932.1|42876_43425_+	hypothetical protein	NA	A0A0S2MVC3	Bacillus_phage	96.2	4.4e-101
WP_000417534.1|43483_43675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784798.1|43707_43920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139625.1|43907_44165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362235.1|44589_44793_+	hypothetical protein	NA	A0A1B1P8C8	Bacillus_phage	95.5	9.8e-30
WP_000074682.1|44980_45172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000540404.1|45429_45960_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	81.2	5.1e-78
WP_000414269.1|45959_46304_+	zinc-finger domain-containing protein	NA	A0A0A7AR67	Bacillus_phage	47.2	4.0e-23
WP_000654043.1|46448_46949_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2MVE1	Bacillus_phage	80.6	3.3e-71
WP_000849232.1|47224_47773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001263205.1|48589_48814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000451524.1|49301_49721_+	helix-turn-helix domain-containing protein	NA	A0A142F1N8	Bacillus_phage	55.6	1.7e-07
WP_000673899.1|49878_50421_+|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	49.2	3.2e-43
WP_000390791.1|50635_50815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113809.1|50836_51664_+|terminase	terminase	terminase	A0A1L2JY44	Aeribacillus_phage	38.1	1.1e-34
WP_000038941.1|51656_52934_+|terminase	PBSX family phage terminase large subunit	terminase	S5MC58	Brevibacillus_phage	64.2	3.6e-154
52567:52580	attR	AAAAGATTAAACAA	NA	NA	NA	NA
WP_001280902.1|53002_54484_+|portal	phage portal protein	portal	O80200	Methanobacterium_phage	29.5	1.2e-31
>prophage 1
NC_018685	Bacillus thuringiensis MC28 plasmid pMC95, complete sequence	95433	15185	78176	95433	integrase,transposase	Bacillus_phage(30.77%)	53	8505:8520	77293:77308
8505:8520	attL	TTGATCCGAATGTAAA	NA	NA	NA	NA
WP_000219643.1|15185_16112_-|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	45.2	1.4e-70
WP_000926057.1|17489_18500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110318.1|18954_20124_+	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	23.8	2.0e-21
WP_000443950.1|20385_20526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369750.1|20581_20974_-	helix-turn-helix domain-containing protein	NA	A0A139ZPK3	Marinitoga_camini_virus	34.4	4.3e-05
WP_000881124.1|21081_21315_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000243352.1|21496_24037_+	Cys-Gln thioester bond-forming surface protein	NA	NA	NA	NA	NA
WP_000334855.1|24071_24257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333864.1|24289_24826_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000802607.1|24886_25069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000517905.1|25128_25368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951341.1|25400_28205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000526863.1|28210_29053_+	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_000488222.1|29057_29273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001146809.1|29276_29498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000494039.1|29530_29812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000487024.1|30015_30993_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_000281809.1|31002_31254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659764.1|31281_31833_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_000920941.1|31792_34363_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	28.5	3.8e-86
WP_000736224.1|34421_34931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000732811.1|34927_37684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000683506.1|37741_38140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247221.1|38167_39295_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2D0ZM66	Rhodococcus_phage	40.6	2.2e-17
WP_000808984.1|39319_39904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000610003.1|39921_40242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000636254.1|40266_40563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000575853.1|40690_41011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581807.1|41043_41256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000070888.1|41872_42763_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_000658054.1|43180_43354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014990401.1|43645_44938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120840.1|45977_47516_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L3H9	Tupanvirus	24.6	4.7e-15
WP_000843031.1|48898_49180_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	65.6	5.2e-13
WP_000448511.1|49200_49434_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001043043.1|49486_49765_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	62.2	6.7e-21
WP_000786134.1|49915_50206_+	helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	36.2	7.0e-05
WP_000016447.1|50275_50584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075554.1|50946_51876_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_000576875.1|51960_52296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001032323.1|52391_52601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000273149.1|52799_53504_-	hypothetical protein	NA	A0A0A7RTR8	Clostridium_phage	37.4	2.1e-39
WP_001199493.1|54052_54694_+	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	33.2	2.8e-14
WP_014990407.1|56025_57414_-	phosphatidylinositol-specific phospholipase C domain-containing protein	NA	NA	NA	NA	NA
WP_148283627.1|59139_62628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377014.1|63341_64742_-	phosphatidylinositol-specific phospholipase C	NA	NA	NA	NA	NA
WP_000730143.1|65139_65712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148283626.1|66710_66851_+	amino acid adenylation	NA	NA	NA	NA	NA
WP_001053994.1|69384_70818_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000711950.1|71692_72400_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	44.4	1.4e-38
WP_000162158.1|72516_74943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001056253.1|76304_76832_+	DUF642 domain-containing protein	NA	NA	NA	NA	NA
WP_087951311.1|77013_78176_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.7	4.6e-39
77293:77308	attR	TTGATCCGAATGTAAA	NA	NA	NA	NA
