The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007215	Kosakonia sacchari SP1 chromosome, complete genome	4902027	940322	993746	4902027	transposase,tRNA,integrase	uncultured_Mediterranean_phage(16.67%)	48	969192:969251	1001378:1002263
WP_017457715.1|940322_941372_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017457716.1|941352_942114_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.2	1.0e-55
WP_017457717.1|942107_942734_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	2.8e-35
WP_017457718.1|942849_943974_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	1.1e-05
WP_002442472.1|944099_945092_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_017457720.1|945907_948469_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.0e-30
WP_017457721.1|948686_950012_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	24.2	7.9e-11
WP_017457722.1|950258_951122_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017457723.1|951114_951756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017457724.1|953149_953785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017457725.1|953799_955764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170829937.1|955769_957755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017457727.1|957776_959252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017457728.1|960200_960536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017457729.1|960571_960931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017457730.1|960945_961473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025263855.1|961665_962046_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNW5	Morganella_phage	42.3	7.5e-07
WP_051487239.1|962308_962698_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_051487240.1|962818_963280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017457734.1|963282_963735_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_017457735.1|963781_964714_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	30.3	1.7e-12
WP_017457736.1|964754_965282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071957260.1|965557_965764_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_017457737.1|965760_966639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040016504.1|966781_968488_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.0	2.0e-22
WP_000537152.1|968906_969191_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081874659.1|969187_970042_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	6.7e-80
969192:969251	attL	AGTACCGCTTTATCAATGAGCACCGCACTGTATGGGGTGTCATGACGATGTGTCGGGTGT	NA	NA	NA	NA
WP_017460036.1|970055_970565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017460037.1|970583_971036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017460038.1|972086_973559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017460039.1|974168_974843_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_158512902.1|974987_976160_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_017460041.1|976156_976945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017460042.1|977155_977758_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	30.6	1.1e-07
WP_017460043.1|977894_978851_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_025263858.1|978971_979985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025263859.1|979997_981491_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_025263860.1|981506_982778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017460047.1|982872_984309_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_017460048.1|984328_985567_-	MFS transporter	NA	NA	NA	NA	NA
WP_017460049.1|985832_986828_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017460050.1|987277_988165_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017460051.1|988302_989046_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017460052.1|989059_989461_+	VOC family protein	NA	NA	NA	NA	NA
WP_025263861.1|989543_990539_+	saccharopine dehydrogenase NADP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017460054.1|990679_991075_+	VOC family protein	NA	NA	NA	NA	NA
WP_017460055.1|991470_992358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025263862.1|992966_993746_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	1.5e-49
1001378:1002263	attR	ACACCCGACACATCGTCATGACACCCCATACAGTGCGGTGCTCATTGATAAAGCGGTACTTCAGTCGGGCTCCCTTGCAAAGTACCGCGCGGCCTTTTTCAGTATGTCCCGTTCTTCCTCAGTGCGCTTCAGTTGGGCCCTGAGCTTCAGGATCTCGCTTTTCGCTTCCAGTAAATCACGGGCATGCTGCTCGCTGTTATCGGGTTTAATAGCCCGTAACCACTTATAGAGACTGTGTGCTGAAACGCCCAGCCGGTCAGAAACTTCGGCGACGGAATAACCGCGTTCCGTTATCTGACGGACGGCTTCTTCCTTAAATTCAGGTGTAAATCGTGGTGTGCCCATACGCTCCTCCTATGCTCAAACTATAGGGCAGGATCGTCTACCGGGGCGGGGTCAGTCCAACTATAGGGCAGGATCGTCTACCGGGGCGGGGTCAGTCCAACTATAGGGCAGGATCGTCTACCGGGGCGGGGTCAGTCCAAACTGCAGTTTGCGCCATTTCTGGCCGTCAAAAACTGAGGCCAGATAATAACCTGAATAACCGTAATTTGTGTGACGTCCGCGACGATAACTTGCCCCTTGGCGATCGTCATTGCGATAGAGATAAACATCACCAAAAGAAGCGACATAGCGACTGTTCGCAACGCTGCCGGATAGGGTGATGGTATTGATTGTTGATGTAGCCATGCTTCATTCCTCATGCAGTTAGGGTGTGTGCAGAATAGAATTTGCAGGACGGGCTACCCACCCCGGTTCTGAGACCGACAACGAATTAATTTATTTCTATATTAAAATCAATTAATTAGTTGTGCGTATTCTCGACGGAGAGTTTTTATAGAAGAAAATCTGTTTTTGGTCATATCGTATTCTGCTCAGTTCTGCT	NA	NA	NA	NA
>prophage 2
NZ_CP007215	Kosakonia sacchari SP1 chromosome, complete genome	4902027	1172244	1247994	4902027	transposase,plate,integrase,holin,tRNA,tail	Erwinia_phage(24.39%)	77	1179606:1179622	1194489:1194505
WP_081874659.1|1172244_1173099_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	6.7e-80
WP_000537152.1|1173095_1173380_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017459902.1|1174651_1176985_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_017459903.1|1176994_1177315_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_017459904.1|1177311_1177539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071957261.1|1177535_1178084_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_017459906.1|1178080_1178347_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	72.7	2.3e-31
WP_017459907.1|1178907_1179705_+	hypothetical protein	NA	NA	NA	NA	NA
1179606:1179622	attL	GCCGCTGACCGGCGTGG	NA	NA	NA	NA
WP_017459908.1|1179708_1179912_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	65.4	3.7e-13
WP_017459909.1|1180283_1181231_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_017459910.1|1181249_1183907_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017459911.1|1183903_1185112_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.5	1.6e-106
WP_017459912.1|1186067_1186550_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.4e-29
WP_017459913.1|1186669_1187146_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_017459914.1|1187135_1187429_+	RnfH family protein	NA	NA	NA	NA	NA
WP_017459915.1|1187565_1187907_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_017459916.1|1188054_1189716_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_017459917.1|1189803_1190682_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_139164788.1|1190805_1191402_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_025263874.1|1191510_1192797_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017459920.1|1192814_1193603_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_017459922.1|1193769_1195131_+	signal recognition particle protein	NA	NA	NA	NA	NA
1194489:1194505	attR	GCCGCTGACCGGCGTGG	NA	NA	NA	NA
WP_017459923.1|1195383_1195632_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017459924.1|1195650_1196199_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_017459925.1|1196229_1196997_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004104634.1|1197041_1197389_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017459926.1|1197818_1198013_-	ogr/Delta-like zinc finger family protein	NA	Q37973	Salmonella_virus	68.9	3.9e-20
WP_017459927.1|1198091_1199228_-	late control protein D	NA	S4TRX8	Salmonella_phage	46.7	8.3e-94
WP_017459928.1|1199227_1199686_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	65.5	5.1e-50
WP_017459929.1|1199700_1201581_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	46.6	2.0e-39
WP_017459930.1|1201573_1201693_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	87.2	1.3e-13
WP_017459931.1|1201725_1202007_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	78.4	1.0e-29
WP_017459932.1|1202067_1202586_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	89.0	5.0e-86
WP_017459933.1|1202598_1203780_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	88.0	2.1e-201
WP_017459934.1|1203917_1204355_-|tail	tail assembly chaperone	tail	A0A1B0VCD0	Salmonella_phage	41.7	1.0e-15
WP_017459935.1|1204357_1206100_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	62.8	7.8e-91
WP_017459936.1|1206230_1206794_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	61.4	3.9e-60
WP_025263875.1|1206793_1207804_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	66.1	1.6e-120
WP_017459937.1|1207959_1208568_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	77.5	3.7e-88
WP_017459938.1|1208560_1209469_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	77.5	4.1e-128
WP_017459939.1|1209473_1209821_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	71.3	3.6e-40
WP_017459940.1|1209817_1210453_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	82.0	2.5e-95
WP_139164789.1|1210530_1211007_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	62.1	1.7e-48
WP_074460813.1|1210960_1211206_-|holin	holin	holin	S4TNY4	Salmonella_phage	71.6	2.3e-25
WP_017459943.1|1211105_1211519_-	hypothetical protein	NA	O80310	Escherichia_phage	38.0	1.5e-16
WP_017459944.1|1211515_1212025_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	73.8	1.5e-66
WP_017459945.1|1211999_1212230_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	44.6	4.0e-11
WP_017459946.1|1212220_1212424_-|tail	tail protein X	tail	Q858W3	Yersinia_virus	75.0	2.7e-19
WP_017459947.1|1212634_1212820_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	77.0	7.8e-18
WP_017459948.1|1212894_1214949_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	64.7	9.3e-253
WP_017459949.1|1214949_1215171_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	74.6	3.3e-23
WP_017459950.1|1215170_1215398_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_017459951.1|1215465_1215804_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	65.8	9.9e-35
WP_025263876.1|1216335_1217187_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	59.1	1.0e-88
WP_071957262.1|1217253_1217808_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_017459955.1|1217871_1219233_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_017459956.1|1219415_1220486_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.7	6.2e-91
WP_017459957.1|1220495_1221617_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_017459958.1|1221685_1222558_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_017459959.1|1222554_1223715_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_189660115.1|1223819_1223870_-	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_017459960.1|1223972_1224311_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017459961.1|1224577_1225315_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017459962.1|1225446_1226427_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_017459963.1|1226423_1227155_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_017459964.1|1227284_1229858_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.6	1.2e-124
WP_017459055.1|1235812_1237111_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.3	3.1e-44
WP_017459054.1|1237114_1237435_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_025263877.1|1237480_1238836_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_017459052.1|1238955_1241610_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_017459051.1|1241642_1242341_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_017459050.1|1242410_1242830_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	6.3e-15
WP_017459049.1|1243034_1244153_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_017459048.1|1244360_1245050_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.9	1.8e-54
WP_017459047.1|1245365_1245749_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	1.4e-32
WP_017459046.1|1245792_1247127_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.4	6.7e-42
WP_017459045.1|1247256_1247994_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP007215	Kosakonia sacchari SP1 chromosome, complete genome	4902027	1646964	1700125	4902027	transposase,coat,integrase,lysis,tRNA	Enterobacteria_phage(45.45%)	47	1696911:1696970	1703289:1703367
WP_017459794.1|1646964_1647660_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_017459795.1|1647656_1648055_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_017459796.1|1648275_1649226_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_017459797.1|1649659_1650574_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017459798.1|1650647_1651604_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000698460.1|1651643_1651727_-	protein YohP	NA	NA	NA	NA	NA
WP_017459800.1|1651836_1652610_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017459801.1|1652606_1653191_-	DedA family protein	NA	NA	NA	NA	NA
WP_017459802.1|1653361_1653949_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_017459803.1|1654119_1655064_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_017459804.1|1655064_1655619_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	33.8	7.6e-16
WP_017459805.1|1655720_1657457_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_017459806.1|1657765_1660063_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_017459807.1|1660112_1660643_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_017459808.1|1660669_1661386_-	molecular chaperone	NA	NA	NA	NA	NA
WP_046199726.1|1661410_1661944_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_017459810.1|1661956_1662994_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_017459811.1|1662984_1665300_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_017459812.1|1665702_1665945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017459813.1|1665955_1666873_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017459814.1|1666881_1668036_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017459815.1|1668028_1668976_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	4.5e-08
WP_017459816.1|1668959_1669697_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017459817.1|1669671_1669785_-	protein YohO	NA	NA	NA	NA	NA
WP_017459818.1|1669845_1670577_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	76.4	9.2e-86
WP_017459819.1|1670796_1672485_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.5	7.2e-259
WP_017459820.1|1672478_1673198_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_017459821.1|1673251_1673737_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	78.1	3.2e-63
WP_017459822.1|1673810_1674266_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	43.0	9.2e-28
WP_025263906.1|1674352_1676386_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.0	3.0e-54
WP_017459824.1|1676669_1677779_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_017459825.1|1677812_1678238_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017459826.1|1678250_1678586_-	RcnB family protein	NA	NA	NA	NA	NA
WP_017459827.1|1678783_1679797_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_017459828.1|1679905_1681036_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.9	3.1e-24
WP_017459829.1|1681388_1682624_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_017459830.1|1682680_1683988_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_017459831.1|1683998_1684850_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_017459832.1|1684854_1686054_+	glycosyl hydrolase 53 family protein	NA	NA	NA	NA	NA
WP_017459833.1|1686084_1688142_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_017459834.1|1688208_1688526_+	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_017459835.1|1688749_1690015_-	maltoporin	NA	NA	NA	NA	NA
WP_017459836.1|1690283_1691357_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.0	4.1e-74
WP_040016612.1|1692121_1696783_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	40.5	1.6e-26
1696911:1696970	attL	TTTTAAATGACTCGGGGTGCCCTTCTTTGTGAAGGCTGAGAAATACCCGTACCACCTGAT	NA	NA	NA	NA
WP_017459838.1|1697075_1698431_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017459839.1|1698522_1699251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081874659.1|1699270_1700125_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	6.7e-80
1703289:1703367	attR	TTTTAAATGACTCGGGGTGCCCTTCTTTGTGAAGGCTGAGAAATACCCGTACCACCTGATCTGGATAATGCCAGCGTAG	NA	NA	NA	NA
>prophage 4
NZ_CP007215	Kosakonia sacchari SP1 chromosome, complete genome	4902027	1762788	1770251	4902027		Enterobacteria_phage(42.86%)	7	NA	NA
WP_017458476.1|1762788_1764204_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	4.9e-19
WP_017458475.1|1764381_1765275_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	1.8e-43
WP_017458474.1|1765682_1766771_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	3.0e-101
WP_017458473.1|1766767_1767667_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	33.3	4.1e-27
WP_017458472.1|1767688_1768567_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	5.6e-106
WP_017458471.1|1768571_1769114_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.3	1.9e-51
WP_017458470.1|1769123_1770251_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A2K9L0G1	Tupanvirus	29.9	3.1e-24
>prophage 5
NZ_CP007215	Kosakonia sacchari SP1 chromosome, complete genome	4902027	3155365	3242733	4902027	terminase,plate,head,capsid,integrase,lysis,portal,protease,tRNA,tail	Salmonella_phage(61.11%)	94	3210367:3210385	3244097:3244115
WP_017456177.1|3155365_3156658_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	3.1e-92
WP_017456176.1|3156749_3158093_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	39.1	2.0e-78
WP_017456175.1|3158102_3158714_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_017456174.1|3159041_3159719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025263671.1|3159788_3163868_-	DNA translocase FtsK 4TM domain-containing protein	NA	S5VNE3	Mycobacterium_phage	49.6	3.8e-88
WP_000228469.1|3163988_3164483_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_017456171.1|3165036_3166002_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	2.3e-60
WP_017456170.1|3166117_3167884_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.6	4.6e-22
WP_017456169.1|3167884_3169606_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	2.5e-17
WP_017456168.1|3169712_3170414_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3170702_3170921_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017456167.1|3171077_3171521_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_017456166.1|3171517_3171982_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_017456165.1|3172612_3174904_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.4e-164
WP_017456164.1|3174934_3175255_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.0	7.7e-13
WP_017456163.1|3175583_3175805_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.0e-16
WP_017456162.1|3175869_3177816_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.9	5.9e-39
WP_017456161.1|3177812_3178925_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_017456160.1|3179085_3180042_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_017456159.1|3180038_3181697_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_017456158.1|3182070_3182766_+	aquaporin Z	NA	NA	NA	NA	NA
WP_017456157.1|3182892_3183792_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_017456156.1|3183939_3185592_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_017456155.1|3185602_3186571_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_017456154.1|3186622_3187051_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017456153.1|3187204_3188923_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	8.9e-31
WP_017456152.1|3188961_3189960_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_017456151.1|3189970_3191407_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017456150.1|3191501_3192515_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017456149.1|3192520_3193093_-	WG repeat-containing protein	NA	NA	NA	NA	NA
WP_017456148.1|3193121_3193952_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	1.9e-07
WP_017456146.1|3194373_3194889_+	lipoprotein	NA	NA	NA	NA	NA
WP_017456145.1|3195098_3195827_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	2.1e-29
WP_017456144.1|3195846_3196578_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017456143.1|3196584_3197301_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_017456142.1|3197300_3197969_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_017456141.1|3198139_3198871_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_017456140.1|3198913_3200041_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.7	1.6e-28
WP_017456139.1|3200082_3200553_-	YbjO family protein	NA	NA	NA	NA	NA
WP_017456138.1|3200626_3201472_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_017456137.1|3201468_3202422_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_017456136.1|3202431_3203565_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	1.6e-28
WP_017456135.1|3203706_3204819_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_017456134.1|3205168_3205648_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_017456133.1|3205733_3206636_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.2	2.6e-34
WP_017456132.1|3206708_3207431_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_017456131.1|3207605_3207869_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	73.1	2.0e-27
WP_017456130.1|3207899_3208265_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_017456129.1|3208546_3210232_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3210367:3210385	attL	ATGGGTTTTTTGTTGCCTT	NA	NA	NA	NA
WP_017456128.1|3210462_3210687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017456127.1|3210873_3211092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139164738.1|3211063_3211699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017456125.1|3211878_3212094_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.8	2.5e-23
WP_025263674.1|3212161_3213256_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.9	5.3e-170
WP_017456123.1|3213243_3213729_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	83.1	1.2e-68
WP_017456122.1|3213725_3216527_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	59.1	7.2e-248
WP_017456121.1|3216519_3216639_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	6.3e-13
WP_017456120.1|3216653_3216956_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.9	1.0e-38
WP_017456119.1|3217010_3217526_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	86.5	6.9e-80
WP_017456118.1|3217535_3218708_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.1	5.6e-210
WP_017456117.1|3218841_3219027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017456116.1|3219013_3220177_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	83.9	3.2e-125
WP_017456115.1|3220173_3220779_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	90.5	7.8e-107
WP_017456114.1|3220771_3221680_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.4	1.1e-141
WP_017456113.1|3221666_3222026_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	89.7	4.2e-52
WP_017456112.1|3222022_3222601_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	91.7	8.0e-101
WP_017456111.1|3222700_3223396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017456110.1|3223397_3223847_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	81.4	1.9e-57
WP_025263675.1|3223839_3224271_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	88.8	1.3e-68
WP_025263676.1|3224366_3224792_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	89.3	3.3e-59
WP_017456107.1|3224788_3225304_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	5.8e-87
WP_025263677.1|3225284_3225500_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	83.1	1.1e-26
WP_017456105.1|3225503_3225707_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	95.5	1.6e-32
WP_017456104.1|3225706_3226171_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	92.9	5.3e-79
WP_017456103.1|3226264_3226912_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	93.0	6.4e-107
WP_017456102.1|3226915_3227995_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	95.1	6.3e-184
WP_017456101.1|3228011_3228842_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	87.7	4.6e-118
WP_017456100.1|3228981_3230748_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	95.2	0.0e+00
WP_017456099.1|3230747_3231782_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	92.1	2.3e-183
WP_017456098.1|3231853_3232810_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	63.9	1.0e-116
WP_017456097.1|3232860_3233724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017456095.1|3234133_3234322_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	84.7	9.1e-22
WP_017456094.1|3234483_3236853_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	84.9	0.0e+00
WP_017456093.1|3236899_3237127_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	81.3	9.9e-31
WP_017456092.1|3237126_3237363_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	59.5	6.7e-14
WP_017456091.1|3237429_3237771_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	80.5	3.9e-47
WP_017456090.1|3237978_3238437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017456089.1|3238433_3238619_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	80.6	7.1e-11
WP_017456088.1|3238626_3239136_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	84.6	1.0e-75
WP_004223867.1|3239168_3239390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017456087.1|3239515_3240085_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	46.7	1.4e-41
WP_083200633.1|3240102_3240288_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	55.6	1.0e-09
WP_017456086.1|3240299_3241631_+	NTPase	NA	R9TRQ8	Vibrio_phage	22.1	1.0e-13
WP_017456085.1|3241713_3242733_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.4	1.8e-103
3244097:3244115	attR	ATGGGTTTTTTGTTGCCTT	NA	NA	NA	NA
