The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008956	Herbaspirillum rubrisubalbicans Os34 chromosome, complete genome	6122717	1607593	1615181	6122717	protease	Phage_21(16.67%)	7	NA	NA
WP_017453643.1|1607593_1608850_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	61.1	1.2e-11
WP_006463169.1|1609013_1609220_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	80.3	3.1e-23
WP_013233417.1|1609559_1609874_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	8.4e-12
WP_017453644.1|1609870_1612174_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	3.6e-168
WP_017453645.1|1612324_1613428_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_017453646.1|1613427_1613877_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	62.8	4.7e-48
WP_017453647.1|1613984_1615181_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.8	6.6e-41
>prophage 2
NZ_CP008956	Herbaspirillum rubrisubalbicans Os34 chromosome, complete genome	6122717	1831922	1891882	6122717	tail,terminase,capsid,head,portal,plate,integrase,lysis	Burkholderia_phage(31.25%)	78	1831734:1831756	1894701:1894723
1831734:1831756	attL	TTCGAATCCCCCCCTCTCCGCCA	NA	NA	NA	NA
WP_026052253.1|1831922_1833077_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	57.2	9.9e-119
WP_017454396.1|1833299_1833665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017455142.1|1833737_1835720_-	replication endonuclease	NA	A4JWW0	Burkholderia_virus	43.3	2.1e-108
WP_026052254.1|1835844_1836198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017455143.1|1836286_1836508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006465440.1|1836611_1836857_-	ogr/Delta-like zinc finger family protein	NA	E5E3T8	Burkholderia_phage	49.3	3.5e-13
WP_017454554.1|1836847_1837048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006461600.1|1837040_1837283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017454555.1|1837298_1837499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017454556.1|1837583_1838027_+	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	47.7	1.7e-26
WP_157786960.1|1838227_1838641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017454400.1|1838657_1839314_-	S-layer family protein	NA	NA	NA	NA	NA
WP_017454401.1|1839300_1839636_-	DUF596 domain-containing protein	NA	NA	NA	NA	NA
WP_171426904.1|1842450_1842630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171426976.1|1842844_1843174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171426978.1|1844061_1845024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148290081.1|1846254_1846509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017455150.1|1846717_1847167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148290082.1|1847446_1848007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017452885.1|1848106_1848553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148290083.1|1848630_1849041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017455151.1|1849044_1849425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017455152.1|1849586_1850204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017455154.1|1850773_1851238_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_146744613.1|1851324_1851753_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017455155.1|1851803_1853390_-	recombinase family protein	NA	R9TP69	Rhizobium_phage	34.1	5.5e-51
WP_156481345.1|1853361_1853529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017455156.1|1853515_1853875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008330650.1|1853871_1854018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017455157.1|1854014_1856066_-	replication endonuclease	NA	A4JWW0	Burkholderia_virus	41.4	8.2e-108
WP_017455158.1|1856055_1856409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017455159.1|1856497_1856704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017455160.1|1856783_1857044_-	ogr/Delta-like zinc finger family protein	NA	A4JWR6	Burkholderia_virus	45.7	2.8e-13
WP_017452875.1|1857034_1857232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017452874.1|1857224_1857467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017455161.1|1857781_1858219_+	helix-turn-helix transcriptional regulator	NA	A4PE57	Ralstonia_virus	40.7	9.8e-19
WP_017455162.1|1858343_1859006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017455163.1|1859064_1859985_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_017455164.1|1860155_1861385_-	phage late control protein	NA	K4PAY4	Burkholderia_phage	49.1	2.9e-84
WP_017455165.1|1861381_1862029_-|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	59.8	9.7e-39
WP_017455166.1|1862040_1864665_-|tail	tail protein	tail	A4PE52	Ralstonia_virus	54.8	1.7e-222
WP_017452867.1|1864665_1864779_-|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	67.6	4.2e-06
WP_017455167.1|1864787_1865105_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	52.1	1.3e-17
WP_017455168.1|1865164_1865674_-|tail	phage major tail tube protein	tail	R4JEU1	Burkholderia_phage	56.2	4.5e-47
WP_017455169.1|1865730_1866909_-|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	67.6	2.1e-148
WP_100221488.1|1866933_1867116_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_017455171.1|1867220_1867877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017455172.1|1867882_1868413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017455173.1|1868418_1870149_-|tail	phage tail protein	tail	V5YST5	Pseudomonas_phage	43.5	1.7e-61
WP_017455174.1|1870156_1870765_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	57.9	1.7e-61
WP_017455175.1|1870778_1871702_-|plate	baseplate J/gp47 family protein	plate	A0A1S6KZY6	Salmonella_phage	51.2	3.3e-72
WP_017455176.1|1871698_1872043_-	GPW/gp25 family protein	NA	E5FFH4	Burkholderia_phage	47.9	9.1e-20
WP_017455177.1|1872039_1872684_-|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	40.5	8.8e-32
WP_017455178.1|1872791_1874501_-	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_017455179.1|1874636_1875113_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	51.7	4.1e-34
WP_017452853.1|1875109_1875595_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	55.3	3.0e-32
WP_017455180.1|1875548_1876118_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_017455181.1|1876114_1876645_-	glycoside hydrolase family 104 protein	NA	Q9MC90	Pseudomonas_phage	62.3	1.0e-41
WP_017452850.1|1876641_1877016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017452849.1|1877056_1877266_-|tail	tail protein X	tail	E5FFI3	Burkholderia_phage	47.8	7.8e-06
WP_017455182.1|1877265_1877757_-|head	head completion/stabilization protein	head	A4JWU5	Burkholderia_virus	54.2	1.1e-31
WP_017455183.1|1877845_1878565_-|integrase	integrase	integrase	A0A2H4J948	uncultured_Caudovirales_phage	45.5	5.0e-44
WP_017452846.1|1878564_1879608_-|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	63.4	2.5e-113
WP_017455184.1|1879658_1880501_-|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	48.9	1.8e-56
WP_017455185.1|1880644_1882426_+|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	65.5	1.8e-228
WP_017451518.1|1882425_1883478_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	62.2	2.7e-123
WP_017451519.1|1883480_1883699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017451520.1|1884014_1884278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017451521.1|1884456_1884627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017451522.1|1884629_1884938_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_157786962.1|1886590_1886773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157786963.1|1886908_1888267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017455187.1|1888723_1889425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034358506.1|1889477_1890158_-	S-adenosylmethionine-binding protein	NA	A0A076YNT4	Mesorhizobium_phage	69.1	3.5e-87
WP_006464206.1|1890168_1890477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017455189.1|1890582_1890852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017454409.1|1890854_1891220_+	pyocin R, lytic enzyme	NA	A0A2H4JDB4	uncultured_Caudovirales_phage	41.4	8.5e-16
WP_017454410.1|1891369_1891882_+|lysis	lysis protein	lysis	NA	NA	NA	NA
1894701:1894723	attR	TTCGAATCCCCCCCTCTCCGCCA	NA	NA	NA	NA
>prophage 3
NZ_CP008956	Herbaspirillum rubrisubalbicans Os34 chromosome, complete genome	6122717	3737691	3747840	6122717		Bacillus_phage(25.0%)	9	NA	NA
WP_017451804.1|3737691_3738117_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.1	2.1e-21
WP_017451803.1|3738384_3739074_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	36.8	1.1e-27
WP_017451802.1|3739160_3740522_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.5	8.9e-26
WP_017451801.1|3740663_3741677_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.9	4.6e-35
WP_017451800.1|3741680_3742646_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1P8CWQ1	Bacillus_phage	42.4	4.1e-09
WP_017451799.1|3742887_3743853_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	48.4	3.7e-34
WP_026052018.1|3743849_3744587_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	55.8	9.0e-73
WP_017451797.1|3744659_3745607_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_017451796.1|3745608_3747840_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.8	6.2e-85
>prophage 4
NZ_CP008956	Herbaspirillum rubrisubalbicans Os34 chromosome, complete genome	6122717	4075939	4119604	6122717	tail,terminase,capsid,transposase,head,protease,portal,plate,tRNA,lysis	Pseudomonas_phage(30.43%)	54	NA	NA
WP_017454726.1|4075939_4077367_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_157786916.1|4077670_4078534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157786917.1|4078961_4080140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157786918.1|4080344_4080740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157786919.1|4080787_4081618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017454730.1|4081711_4082248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017454731.1|4082423_4083218_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	71.5	2.5e-113
WP_017454732.1|4083350_4083866_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_017454733.1|4083862_4084438_-	pyocin R, lytic enzyme	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	40.6	2.0e-27
WP_017454734.1|4084434_4084734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017454735.1|4084730_4085168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017454736.1|4085213_4085600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017454737.1|4085664_4086465_-	hypothetical protein	NA	A0A0A8J8U5	Ralstonia_phage	39.9	2.2e-32
WP_017454738.1|4086475_4087072_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_017454739.1|4087062_4088109_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	45.0	6.1e-75
WP_017454740.1|4088098_4088506_-	phage GP46 family protein	NA	B5TK74	Pseudomonas_phage	41.9	1.2e-23
WP_017454741.1|4088502_4089051_-|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	32.1	1.1e-19
WP_017454742.1|4089047_4090139_-|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	49.0	1.4e-85
WP_017454743.1|4090163_4091399_-	DNA circularization N-terminal domain-containing protein	NA	B5TK71	Pseudomonas_phage	34.6	1.0e-57
WP_017454744.1|4091398_4093270_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	51.2	3.4e-116
WP_017454745.1|4093396_4093918_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_017452162.1|4093917_4094265_-|tail	phage tail tube protein	tail	B5TK68	Pseudomonas_phage	60.0	1.0e-34
WP_017454746.1|4094324_4095815_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	57.6	7.7e-156
WP_017454747.1|4095811_4096030_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_017454748.1|4096040_4096637_-	hypothetical protein	NA	Q8W624	Enterobacteria_phage	35.0	3.4e-22
WP_017454749.1|4096646_4097117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017454750.1|4097118_4097448_-|head,tail	head-tail adaptor protein	head,tail	Q8HAC9	Salmonella_phage	45.2	2.4e-17
WP_017454751.1|4097447_4097792_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q3HQT2	Burkholderia_phage	45.6	1.4e-15
WP_017454752.1|4097795_4098227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017454753.1|4098291_4099590_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	48.6	1.7e-87
WP_017454754.1|4099600_4100266_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	50.0	3.7e-49
WP_017454755.1|4100262_4101567_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	46.9	1.7e-106
WP_100221474.1|4101563_4103300_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	41.8	2.6e-118
WP_017454757.1|4103259_4103775_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_157786920.1|4103773_4103941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034358001.1|4104036_4104345_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	59.3	3.8e-25
WP_148290192.1|4104467_4104821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017454759.1|4105136_4105343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017454760.1|4105609_4106179_-	hypothetical protein	NA	Q3HR05	Burkholderia_phage	37.6	2.6e-19
WP_034357962.1|4106175_4106469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017454762.1|4106717_4109414_-	hypothetical protein	NA	B7SYD0	Stenotrophomonas_phage	35.5	3.3e-80
WP_100221475.1|4109410_4109890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157786921.1|4110041_4110275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171426909.1|4110493_4110862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081584556.1|4110749_4111082_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017452890.1|4111189_4111873_+	LexA family transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	36.2	1.3e-22
WP_017454766.1|4112489_4112807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017454768.1|4112940_4113195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017454770.1|4113492_4115607_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017454771.1|4115618_4116056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157786922.1|4116184_4116487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940472.1|4116458_4118045_+	recombinase family protein	NA	A0A139ZPH5	Marinitoga_camini_virus	27.8	2.8e-23
WP_017452893.1|4118277_4118844_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_017452894.1|4118860_4119604_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP008956	Herbaspirillum rubrisubalbicans Os34 chromosome, complete genome	6122717	4348332	4374664	6122717	transposase,integrase	Moraxella_phage(33.33%)	28	4341621:4341635	4378827:4378841
4341621:4341635	attL	CAGCGCCAGTTCGGT	NA	NA	NA	NA
WP_017455502.1|4348332_4349364_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_100221503.1|4350052_4350778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157786983.1|4350805_4351099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100221504.1|4351243_4352287_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	31.0	2.2e-16
WP_017455505.1|4352289_4353042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017455506.1|4353364_4354399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017455507.1|4354527_4355004_-	3'-5' exoribonuclease	NA	NA	NA	NA	NA
WP_017455508.1|4355225_4355501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017455509.1|4355925_4357056_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_034358754.1|4357052_4358744_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017455512.1|4358740_4359574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112077066.1|4359626_4360853_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	1.4e-49
WP_017455430.1|4360938_4361151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157786971.1|4361250_4362561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157786970.1|4362587_4363229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157786969.1|4363486_4363753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940484.1|4363760_4364896_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017455426.1|4365293_4366643_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_017455425.1|4366748_4367369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081584704.1|4367597_4368536_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017455423.1|4368773_4369112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157786968.1|4369193_4370057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017455421.1|4370492_4371164_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017455420.1|4371236_4371683_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_100221496.1|4371737_4372265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017455418.1|4372642_4373227_+	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_017455417.1|4373237_4373729_+	3'-5' exoribonuclease	NA	NA	NA	NA	NA
WP_081584703.1|4373812_4374664_-|integrase	site-specific integrase	integrase	A0A0A1I5U0	Burkholderia_phage	39.1	4.3e-42
4378827:4378841	attR	ACCGAACTGGCGCTG	NA	NA	NA	NA
>prophage 6
NZ_CP008956	Herbaspirillum rubrisubalbicans Os34 chromosome, complete genome	6122717	4523386	4580475	6122717	transposase,tail	Ralstonia_virus(27.27%)	57	NA	NA
WP_148290318.1|4523386_4524205_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017455550.1|4524204_4524519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017455548.1|4526372_4526888_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_017455547.1|4527049_4527922_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034315264.1|4528620_4529565_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017455544.1|4529635_4530508_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017455543.1|4530659_4531565_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017455542.1|4531556_4532027_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_017455541.1|4532019_4532484_-	RidA family protein	NA	NA	NA	NA	NA
WP_017455540.1|4532602_4533526_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_017455539.1|4533544_4534168_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017455538.1|4534237_4536910_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017455537.1|4537092_4537542_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157786984.1|4537562_4538339_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_017455535.1|4538770_4539385_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017455534.1|4539418_4539733_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017455533.1|4539760_4540519_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017455532.1|4540616_4541261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034358775.1|4543179_4544406_-	MFS transporter	NA	NA	NA	NA	NA
WP_017455530.1|4544597_4545533_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017455529.1|4545522_4546143_-	2-hydroxychromene-2-carboxylate isomerase	NA	NA	NA	NA	NA
WP_017455528.1|4546139_4547015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026052389.1|4547302_4547749_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017455526.1|4547818_4548637_+	class D beta-lactamase	NA	NA	NA	NA	NA
WP_017455525.1|4548788_4550084_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017455524.1|4550187_4551597_+	CoA transferase	NA	NA	NA	NA	NA
WP_017455523.1|4551612_4552383_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_081584746.1|4553028_4553811_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_146744641.1|4555395_4556115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017454521.1|4556116_4556599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017455520.1|4556871_4557348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017454523.1|4557450_4557783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148290092.1|4558142_4558961_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017454809.1|4558960_4559275_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_148290161.1|4559449_4559797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017455518.1|4559805_4560060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017455517.1|4560199_4561564_+	EndoU domain-containing protein	NA	NA	NA	NA	NA
WP_017455516.1|4561573_4561828_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_026052387.1|4562085_4562529_-	transcriptional regulator	NA	A4JWN8	Burkholderia_virus	43.8	1.6e-21
WP_026052386.1|4562611_4562812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006461600.1|4562827_4563070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017455513.1|4563062_4563263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006465440.1|4563253_4563499_+	ogr/Delta-like zinc finger family protein	NA	E5E3T8	Burkholderia_phage	49.3	3.5e-13
WP_026052407.1|4566905_4568132_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	2.3e-49
WP_026052404.1|4568314_4569037_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	37.0	1.1e-33
WP_017455618.1|4569041_4569629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034304709.1|4569631_4569991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017455391.1|4569974_4570481_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	46.1	2.5e-34
WP_017455390.1|4570480_4570888_-	PAAR domain-containing protein	NA	A4PE23	Ralstonia_virus	36.9	5.4e-11
WP_017455388.1|4571523_4571724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026052376.1|4571845_4573591_+	CHASE3 domain-containing protein	NA	NA	NA	NA	NA
WP_017455386.1|4574482_4576054_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	56.5	2.4e-38
WP_017452249.1|4576350_4577073_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.7	3.2e-91
WP_017452248.1|4577053_4577482_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.9	1.7e-47
WP_017455385.1|4577509_4578790_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.2	6.4e-167
WP_026052064.1|4578801_4579137_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081584696.1|4579785_4580475_-|tail	phage tail protein	tail	A9YX14	Burkholderia_phage	54.5	2.1e-55
>prophage 7
NZ_CP008956	Herbaspirillum rubrisubalbicans Os34 chromosome, complete genome	6122717	5205133	5255348	6122717	transposase,plate,protease	uncultured_Mediterranean_phage(28.57%)	52	NA	NA
WP_017452621.1|5205133_5206222_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_017452622.1|5206185_5208030_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_017452623.1|5208030_5208519_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_017452624.1|5208681_5209173_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_017452625.1|5209207_5210701_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_017452626.1|5210713_5211214_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_017452627.1|5211303_5211927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017452629.1|5212297_5212927_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_017452630.1|5212990_5214337_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_017452631.1|5214333_5215113_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_017454455.1|5218171_5219713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017454454.1|5219709_5220798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017454453.1|5220974_5221910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017454451.1|5222153_5222984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017454450.1|5223135_5223966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017454449.1|5223971_5226182_-	OsmC domain/YcaO domain-containing protein	NA	NA	NA	NA	NA
WP_017453791.1|5226569_5227058_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	47.5	5.8e-20
WP_017453790.1|5227178_5227790_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017453789.1|5227888_5228653_-	cytochrome c1	NA	NA	NA	NA	NA
WP_017453788.1|5228676_5230083_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_017453787.1|5230085_5230694_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_171427140.1|5230992_5231424_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_017453785.1|5231495_5232260_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017453784.1|5232302_5233484_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.8	8.3e-12
WP_017453783.1|5233501_5234191_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_017453782.1|5234278_5235052_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.6	3.1e-23
WP_017453781.1|5235092_5235617_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_017453780.1|5235741_5235945_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_017453779.1|5236016_5236397_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017453778.1|5236445_5236784_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_017453777.1|5236780_5237284_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_017453776.1|5237280_5238045_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_008332447.1|5238046_5238844_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_017453775.1|5238922_5239561_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_017453774.1|5239620_5240217_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_017453773.1|5240284_5241391_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_017453772.1|5241371_5242208_-	site-specific DNA-methyltransferase	NA	R4THJ7	Phaeocystis_globosa_virus	36.3	2.9e-35
WP_017453771.1|5242209_5243526_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_017453770.1|5243565_5244216_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_017453769.1|5244246_5245497_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_017453768.1|5245506_5245743_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_017453767.1|5245798_5246563_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017453766.1|5246559_5247471_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	3.7e-20
WP_017453765.1|5247786_5248080_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017453764.1|5248113_5248755_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017453763.1|5249006_5249747_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_017453762.1|5249752_5250229_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017453761.1|5250292_5251072_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_026052193.1|5251068_5251872_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	1.6e-22
WP_017455593.1|5252271_5253366_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017455592.1|5253612_5253903_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_026052407.1|5254121_5255348_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	2.3e-49
