The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	3092	56492	3184851	transposase,tRNA	Escherichia_phage(28.57%)	53	NA	NA
WP_017378478.1|3092_4472_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017378479.1|4586_6479_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_017378480.1|6526_7153_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378481.1|7172_8057_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_027242747.1|8089_8980_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378483.1|9094_9493_+	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_017378484.1|9497_10313_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|10364_10769_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|10823_11294_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017378486.1|11305_11833_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378487.1|11849_13391_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027242748.1|13416_14277_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|14307_15699_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017378489.1|15723_16152_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_027242749.1|16245_17610_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.9	3.9e-37
WP_027242750.1|17666_19502_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	5.8e-121
WP_036773290.1|19615_20344_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_027242751.1|20870_22412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378498.1|22678_23335_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_174872529.1|25206_26073_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017376303.1|26017_26731_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_027242752.1|26922_27555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174872552.1|27719_28025_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174872530.1|28028_28691_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999959.1|28615_28855_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_048876031.1|29289_30693_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376720.1|30689_30950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|30993_31968_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_036815787.1|31987_32305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376724.1|32382_32595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|32841_33261_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036816796.1|33358_33805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242563.1|34149_35148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|35180_35534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929591.1|35578_35851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376728.1|36247_37666_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376729.1|37892_38834_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_026063560.1|38868_40848_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027242562.1|40844_41450_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_016211294.1|41451_41793_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242561.1|41793_42630_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_080963573.1|42795_43113_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242560.1|43190_44612_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376735.1|44608_45304_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_144420744.1|46778_47624_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_017376738.1|47633_47972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876080.1|48540_49944_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876181.1|50057_50921_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876079.1|51906_52956_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275379.1|53110_53329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|53648_55052_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|55062_55620_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772663.1|55616_56492_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	191890	322841	3184851	tRNA,tail,protease,transposase	Acinetobacter_phage(11.76%)	112	NA	NA
WP_017377604.1|191890_193873_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.0e-115
WP_026063651.1|194088_195426_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|195692_198362_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017377607.1|198385_200302_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_026063653.1|200471_201893_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	3.1e-45
WP_017377609.1|202037_203012_+	phospholipase A	NA	NA	NA	NA	NA
WP_027242692.1|203021_203321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377612.1|203438_203660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377613.1|203823_205485_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	7.7e-181
WP_016209850.1|205557_205848_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_017377614.1|206074_206530_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017377615.1|206594_207059_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_027242691.1|207150_208497_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017377618.1|208496_209402_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017377619.1|209463_210450_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|210442_210685_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377620.1|210803_212348_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.6e-63
WP_017377621.1|212394_213681_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_017377622.1|213723_215127_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_144420750.1|215131_217669_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_144420593.1|218065_218314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963589.1|218245_218707_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017377624.1|219201_219897_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080963590.1|219998_221561_-	APC family permease	NA	NA	NA	NA	NA
WP_017377626.1|221888_223682_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.0	2.2e-117
WP_017377627.1|223768_224041_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_017377628.1|224046_224673_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_017377629.1|224659_226090_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_017377630.1|226411_227467_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|227435_228113_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377632.1|228102_228951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210080.1|229096_229390_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_036772063.1|229501_230314_-	trfA family protein	NA	NA	NA	NA	NA
WP_017377635.1|230612_231467_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017377636.1|231620_232670_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_017377637.1|232715_233372_-	DedA family protein	NA	NA	NA	NA	NA
WP_017377638.1|233389_234670_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377639.1|234943_236305_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_036772069.1|236365_236917_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_017376225.1|242349_243621_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_017376226.1|243677_244661_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_048875884.1|244657_245383_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376227.1|245749_246199_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|246292_247696_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376228.1|248133_249615_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_017376229.1|249670_250780_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376230.1|250887_251055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|252352_252565_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243087.1|252605_253301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376236.1|256121_256688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243085.1|256845_257406_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_053856766.1|257525_258929_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875886.1|258925_259282_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376838.1|259537_260362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243084.1|261059_261584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|261869_262844_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243083.1|262943_263495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275261.1|263607_264120_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_144420594.1|264512_265970_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420595.1|266083_266563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|266800_267406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376843.1|267685_268801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376844.1|268772_269426_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_027243079.1|269419_270397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|270431_271595_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243078.1|271934_272159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|272541_272829_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_017376847.1|273003_273759_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|273791_274223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376849.1|274198_274675_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376850.1|274681_276259_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376851.1|276261_277026_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376852.1|277079_277616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|277612_278344_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027243077.1|278568_279330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|279655_280531_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378284.1|281933_282089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375925.1|282282_283950_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375924.1|284645_284954_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_017375923.1|284986_287164_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375921.1|288332_288566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375919.1|289333_290047_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420751.1|290674_291400_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_048875888.1|291408_293472_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_027243033.1|293651_294131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|294623_295991_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376531.1|296382_297180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|297291_298581_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_144420597.1|298761_299748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376534.1|299864_300044_+	rubredoxin	NA	NA	NA	NA	NA
WP_017376535.1|300055_300487_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376536.1|300699_301059_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376537.1|301228_302854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|303577_305005_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376538.1|305298_306480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376539.1|306862_308356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243035.1|309082_310381_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420752.1|310736_311630_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_047927468.1|311626_311932_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_017376543.1|311957_312737_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_144420598.1|312766_312997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|313148_313394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376547.1|313580_314372_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017376548.1|315071_315794_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376549.1|315790_316672_+	ROK family protein	NA	NA	NA	NA	NA
WP_027243038.1|316695_318186_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_027243039.1|318275_319163_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_016212130.1|319197_319374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|319835_320327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|320331_320559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|320651_321626_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971669.1|321602_322841_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	330807	384219	3184851	transposase	Staphylococcus_phage(57.14%)	50	NA	NA
WP_053856767.1|330807_332211_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|332316_332502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|333200_334604_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999963.1|334694_335198_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|335237_336212_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376774.1|336208_336778_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_017376776.1|337264_337957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420601.1|338564_339557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376778.1|339546_341319_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_080963634.1|341319_341508_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036774259.1|341545_342520_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036815640.1|342578_342773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|342839_343067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|343196_344072_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046623.1|344299_344449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420602.1|344440_344707_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420603.1|344851_345751_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046619.1|345837_346095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171824205.1|346695_347934_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_027243074.1|348023_348563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243073.1|348683_349322_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275265.1|349355_349844_-	VUT family protein	NA	NA	NA	NA	NA
WP_162038645.1|350090_350237_-	VUT family protein	NA	NA	NA	NA	NA
WP_036772686.1|350373_350862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875892.1|351432_352446_-	MFS transporter	NA	NA	NA	NA	NA
WP_048875893.1|352424_352670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|352846_353137_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_144420605.1|353175_355830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243070.1|356543_356798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063658.1|357107_357836_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_017377650.1|358606_359791_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_017377649.1|359809_360754_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027243069.1|361059_361845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377647.1|361958_362327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377646.1|362555_364133_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420753.1|364916_369341_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_065653746.1|369477_371001_+	methyltransferase regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_017377643.1|371205_371433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377642.1|371577_371835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|372402_373374_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080999964.1|373298_373538_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_036772729.1|373670_373892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|374011_374986_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771744.1|375039_376011_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|376090_377065_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_027242739.1|377425_380095_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036774478.1|380265_381147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378307.1|381157_381814_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_017378308.1|381880_382585_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_048876031.1|382815_384219_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	441216	667295	3184851	transposase,protease,tRNA	Acinetobacter_phage(17.54%)	221	NA	NA
WP_048875895.1|441216_442380_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_144420756.1|442433_443435_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|443516_444086_+	elongation factor P	NA	NA	NA	NA	NA
WP_017378363.1|444305_445271_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.9	7.2e-22
WP_017378364.1|445282_446878_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_036772406.1|446898_447930_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017378367.1|448261_449365_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_144420609.1|453884_455258_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378374.1|455275_456262_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	2.2e-42
WP_080963622.1|456264_457419_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	2.3e-14
WP_017378376.1|457415_458111_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.3	8.6e-09
WP_017378377.1|458253_459744_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_017378378.1|459764_460814_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_027242727.1|460880_462275_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378381.1|463207_465139_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
WP_075273353.1|465143_465674_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378382.1|465708_465903_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|465945_466305_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|466436_467432_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_017378384.1|467444_469826_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|469831_470119_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_080963621.1|470385_470592_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_017378388.1|472200_472974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378389.1|472975_473917_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378390.1|474050_475628_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378391.1|475821_476778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378393.1|477220_477427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875897.1|478231_478876_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_069971672.1|478943_480200_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|480455_480635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|480857_481085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377704.1|482360_483119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420757.1|483336_483900_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377702.1|484003_484552_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_157894716.1|485009_485147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|485148_486301_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377698.1|486646_486943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|487202_488114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|488348_488888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619481.1|489400_489997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046620.1|490050_490188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|490434_491163_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377686.1|491209_491818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|493092_493353_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377283.1|493526_495065_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_017377282.1|495243_496170_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_048875900.1|496274_497207_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377279.1|497703_500517_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_017377278.1|500509_501019_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377277.1|501022_501466_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_027243089.1|501561_502863_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377276.1|503125_503494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377275.1|503485_504208_-	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_155052690.1|505290_506622_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	2.4e-36
WP_144420611.1|506654_506855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|507389_508364_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377271.1|508774_509104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377270.1|509489_509855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377269.1|509978_510839_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|510825_511605_+	putative DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377267.1|511680_512352_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036771941.1|512524_513130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377265.1|513346_513850_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_017377264.1|514051_514306_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377263.1|514807_515275_+	DoxX family protein	NA	NA	NA	NA	NA
WP_036771922.1|515841_517032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|517866_519270_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275269.1|519576_520197_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875903.1|520376_521351_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017376501.1|521516_521783_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_144420759.1|521779_522280_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048875904.1|522400_523276_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_146619445.1|523469_523775_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174872532.1|523778_524441_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275277.1|524365_524605_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_017375999.1|524935_525466_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_017376000.1|525465_525990_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017376001.1|526152_527268_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376003.1|527504_528665_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376004.1|529116_531120_+	transketolase	NA	NA	NA	NA	NA
WP_017376005.1|531188_532196_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376006.1|532269_533454_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376007.1|533463_534918_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376008.1|534948_535986_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376009.1|536308_536599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|537953_538928_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046691.1|539127_539724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|540247_540499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377795.1|540703_541867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169834761.1|541889_542612_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377799.1|543476_544136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|546197_546959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|547377_547638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|547723_548386_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017377802.1|548502_549630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|550005_550167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377804.1|550446_550905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420613.1|552298_552670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|552949_554191_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075275272.1|554328_554559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377811.1|554692_555577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243005.1|555605_556232_-	ribonuclease T	NA	NA	NA	NA	NA
WP_036773165.1|556262_557462_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_144420614.1|557700_558798_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_017377815.1|558951_560490_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_017375632.1|560810_561146_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_171824212.1|561392_562001_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.7	7.3e-28
WP_017377700.1|561958_562252_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_036773116.1|562622_563597_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377817.1|564108_564606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|564841_565486_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_053856754.1|565590_565842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|565986_566982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210814.1|568125_568323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210817.1|568564_569197_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210815.1|569617_570568_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_017377820.1|570564_572097_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_017377821.1|572093_572624_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_162038649.1|572782_573938_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_048875857.1|574195_575170_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_048876031.1|575592_576996_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420615.1|577029_577818_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_017376557.1|577948_578644_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_017376558.1|579148_579655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242585.1|579748_580306_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080999966.1|580603_581953_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046619.1|582039_582297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|582364_583075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376565.1|583219_583468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|583921_585181_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_017376567.1|585313_585787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376568.1|585795_587178_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_026063542.1|587170_587785_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376570.1|587864_588581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376571.1|588755_591080_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_036771330.1|591246_592221_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420616.1|593384_594893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376574.1|595064_596156_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376575.1|596188_596827_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376576.1|596865_597138_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376577.1|597236_597500_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376578.1|597496_597799_-	YciI family protein	NA	NA	NA	NA	NA
WP_017376579.1|597882_598425_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|598585_599212_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376580.1|599217_600057_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_017376581.1|600046_600697_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_026063543.1|600700_601534_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376583.1|601622_602750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894717.1|603016_603145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|603276_603471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376585.1|603663_604314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376586.1|604568_605660_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376587.1|605656_607021_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376588.1|607145_608342_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_144420764.1|608398_608962_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376590.1|609894_610563_-	Bax inhibitor-1 family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_017376591.1|610709_612011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174872533.1|612225_613086_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_017376593.1|613501_613906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243040.1|614139_615222_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376596.1|615206_615827_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|615891_616767_+	6-carboxytetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376598.1|616844_617420_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017377700.1|618228_618522_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_080999967.1|618638_618788_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619445.1|618931_619237_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174872534.1|619240_619945_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|620116_621091_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075275275.1|621263_621455_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_146619434.1|621624_621816_+	hypothetical protein	NA	A0A0P0I4A4	Acinetobacter_phage	51.7	8.1e-10
WP_157894718.1|621808_622228_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.5	6.7e-33
WP_026063680.1|622482_622707_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_144420618.1|622851_623673_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_017377700.1|623630_623924_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_162038639.1|624300_624792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243138.1|625400_625688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|626180_626951_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243137.1|627020_628364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|628799_630170_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|630166_630331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|630390_630678_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_048875911.1|630707_631142_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377833.1|631709_632300_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_026063682.1|632426_633812_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377835.1|633909_634107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243136.1|634199_635033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|635570_635924_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_027243135.1|635936_636173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243134.1|636172_636379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377840.1|636540_637260_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017377841.1|637348_639133_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155601396.1|639439_639595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377842.1|639521_639776_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|639921_640743_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_157894719.1|641015_641150_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|641255_642659_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377200.1|643223_643412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243131.1|643541_643808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377198.1|644193_645834_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_017377197.1|645946_647296_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_027243130.1|647292_648162_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377194.1|649086_650400_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_048875913.1|650396_651167_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|651163_651391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875914.1|652095_653256_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_069971647.1|653224_653821_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162038649.1|653860_655016_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_048875916.1|655984_656389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875923.1|656392_657388_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157894720.1|657373_658546_-	MFS transporter	NA	NA	NA	NA	NA
WP_036774946.1|658502_659117_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_155046615.1|659813_659975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377737.1|660254_660800_+	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_017377736.1|660833_661499_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_155764145.1|661558_662170_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	5.1e-13
WP_048875917.1|662109_662514_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_144420767.1|662792_663470_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875918.1|663512_664094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|664238_664910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927746.1|665512_666100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|666139_667295_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
>prophage 5
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	678046	710648	3184851	transposase,tRNA	Staphylococcus_phage(50.0%)	30	NA	NA
WP_162038649.1|678046_679202_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_017377716.1|679337_680801_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377715.1|680803_681856_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377714.1|681845_682301_+	arginine repressor	NA	NA	NA	NA	NA
WP_017377712.1|682993_683305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927332.1|683434_684217_+	lipoprotein	NA	NA	NA	NA	NA
WP_144420768.1|684229_685165_-	EamA family transporter	NA	NA	NA	NA	NA
WP_017377709.1|685296_685500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242901.1|685840_686530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|686556_686874_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377706.1|686891_687104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|687128_688284_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_146619445.1|688890_689196_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174872535.1|689442_690150_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275277.1|690074_690314_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_036771325.1|692394_693369_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242902.1|693493_694930_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017376308.1|695009_696470_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_017376309.1|696590_696878_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|697075_698119_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376312.1|699029_699548_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376313.1|699617_700235_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_026063524.1|700244_701732_+	ribonuclease G	NA	NA	NA	NA	NA
WP_048875921.1|701741_704582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157894721.1|704671_705421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376318.1|705494_706304_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017376319.1|706303_706984_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036773116.1|707608_708583_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|708625_709621_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|709673_710648_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 6
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	746098	887600	3184851	transposase,protease,tRNA,integrase	Staphylococcus_phage(16.67%)	114	871220:871279	887376:887872
WP_017376198.1|746098_747559_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_080999970.1|749156_750560_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|752471_754286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|754370_755774_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876031.1|755919_757323_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|757807_758782_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420769.1|759250_760141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243146.1|760801_761638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243147.1|761926_764599_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080963645.1|764847_766038_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046613.1|766370_766565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377214.1|766501_768154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|768754_769981_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243150.1|770376_770922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377217.1|770881_771259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|771255_772659_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|772877_773303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243151.1|773354_774842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|775151_775691_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_162038653.1|775980_777137_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.9	2.0e-50
WP_017377224.1|777453_778029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|778142_779546_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377226.1|779542_779833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377227.1|780200_780614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106211.1|781302_783090_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017377229.1|783256_783877_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155046612.1|784223_784364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377230.1|784383_786360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377231.1|786732_788190_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	9.4e-98
WP_017377232.1|788258_789839_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	1.1e-16
WP_017377234.1|790479_794376_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	3.4e-118
WP_016210741.1|794382_794706_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_017377235.1|794779_795253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772195.1|795284_796280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420625.1|796582_798169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910659.1|798528_799476_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_017377238.1|799794_800139_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_144420626.1|800232_800904_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_017377240.1|800944_801772_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|801858_802386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243013.1|803271_803691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106212.1|803800_804382_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_017377245.1|804736_806017_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_017377246.1|806137_807001_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_017377247.1|807089_807884_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036772212.1|808121_809108_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027243014.1|809113_810640_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_144420771.1|810735_811980_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017377251.1|812033_813413_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_026063614.1|813530_814316_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.7e-32
WP_016211687.1|814658_815303_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_017377253.1|815337_817143_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|817166_817742_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|818791_819766_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_174872536.1|820664_820808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174872537.1|820796_820988_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053093666.1|822302_822980_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_174872552.1|823791_824097_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174872538.1|824794_825256_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275277.1|825180_825420_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_081000005.1|825580_825742_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999972.1|825678_826179_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376821.1|826274_826703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|826962_827412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420628.1|827464_827899_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999973.1|827875_828841_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_017377288.1|829059_829320_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|829414_830149_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|830177_830330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|830534_831479_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377293.1|831464_831893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|832037_832289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243030.1|832676_833585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377295.1|834048_835014_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_016209646.1|835058_835634_-	VOC family protein	NA	NA	NA	NA	NA
WP_036771756.1|835664_836939_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420629.1|837587_838304_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_017377300.1|838382_839120_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017377301.1|839240_840596_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_075275279.1|840775_841447_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377304.1|843037_844342_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|844454_845060_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377305.1|845141_846443_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_017377306.1|846510_848943_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_016209655.1|849046_849319_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075275280.1|849401_851300_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017377308.1|851331_852216_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_017377309.1|852224_852620_-	CrcB family protein	NA	NA	NA	NA	NA
WP_048875932.1|853043_855191_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377313.1|855162_856512_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377314.1|856508_858629_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_017377315.1|858625_860329_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377316.1|860463_861606_-	galactokinase	NA	NA	NA	NA	NA
WP_017377317.1|861662_862691_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_026063623.1|862817_864332_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377319.1|864438_864639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|864783_865119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275281.1|865263_865500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420772.1|865770_866649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875933.1|867285_868230_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999974.1|868503_869907_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|869911_870697_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_075275282.1|871087_871930_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
871220:871279	attL	TCTAATTACCGAAATTTTAAGATGTATTATCTTCATGTAATAAAAGGTAGCATGGTAAAA	NA	NA	NA	NA
WP_017377467.1|871926_872223_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017377471.1|873704_874316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|875493_876468_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377475.1|876639_878532_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_027243186.1|879038_881420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|881834_883238_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|883678_884158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420633.1|884225_885482_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772665.1|885628_886153_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376899.1|886557_886698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|886895_887600_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
887376:887872	attR	TTTTACCATGCTACCTTTTATTACATGAAGATAATACATCTTAAAATTTCGGTAATTAGATTTGTGAAAATAAATCATAATTGTCATTATTTCACTTGTTGACATTTGTGAAGGCTTATTACGTTTTTTATTCGTATCTTCTAGCAAAATAGCATTCCATTGAGGTAATAACTCTTGGCAGAAATCATCTATTACACAAAAGAGAGAAATCAATGTTAAGTCCATTTTATTGCTTCTTTAGAACTAAATTTAGACTCTATTTAGCCGCAAAATCACTGGTTTTTCAAATACTTCTTATGTCGAACTCACGTTAGAATCACAAATGATTACTGATGAGGTGTTTTTATCATTTTGTCAAACAACTATCTTGACTATAACAAAAGTTATGAGTGATTTTTGTGTGGGTTATAAGGACTTTGAACATAAAGAAATTTGGCTGGAAGGCGTGAAAGATAAAATTCATCAGGGAGTAGACAAATTTTTTAATGCAGGAAATG	NA	NA	NA	NA
>prophage 7
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	892062	1032065	3184851	transposase,protease,tRNA	Staphylococcus_phage(20.0%)	117	NA	NA
WP_048875878.1|892062_893466_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063579.1|893571_893775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376909.1|893935_894913_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_027243158.1|895009_896470_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376911.1|896496_897150_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_017376912.1|897274_897841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774028.1|898137_899871_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_047927497.1|899942_901649_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_017376916.1|901640_902699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|902952_903801_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017375855.1|904395_904842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|907333_908776_+	MFS transporter	NA	NA	NA	NA	NA
WP_144420634.1|909174_910506_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771639.1|910610_911585_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377669.1|911634_912339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174872539.1|912383_912575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|912779_913592_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420636.1|913650_916161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|916506_917682_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_157894722.1|917889_918027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081049198.1|918023_918644_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	33.0	2.7e-14
WP_144420637.1|919028_919253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875940.1|919281_920445_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_036774146.1|922687_923833_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_027243152.1|924425_925361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|926858_927170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|928021_928249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377679.1|928564_928771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243160.1|928868_929399_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_017377681.1|929686_930865_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_027243161.1|931013_934850_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377683.1|934836_936339_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_036773927.1|936890_937526_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|938037_939285_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|939507_940944_+	methyltransferase regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|941119_942337_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|942798_943578_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|944584_945559_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_174872540.1|946323_946485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|946604_946916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|947767_947995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046609.1|948305_948512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174872541.1|948999_950136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|950232_951594_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|951704_952076_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|952298_952949_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375736.1|952991_954074_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069971648.1|954800_955775_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_157894723.1|959173_960607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376859.1|961395_961632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|961751_962795_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|963215_963443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774710.1|963616_964516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|964910_966122_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036771959.1|966132_966357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376857.1|966678_966909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|966935_968339_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243219.1|968505_968814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052687.1|969098_969269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|969897_970947_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|971015_972038_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_017378198.1|972083_972998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|973037_974193_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_017378197.1|974150_975020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093667.1|976457_977174_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376026.1|977618_979490_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_027243175.1|979581_981327_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|981406_981856_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_016211035.1|981908_982124_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|982370_983387_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|983435_984065_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|984405_985617_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|985649_985877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|985965_986646_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376035.1|986922_987342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875951.1|987487_988324_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|988367_989342_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420641.1|989361_989997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275290.1|990240_991242_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376037.1|991340_992549_-	MFS transporter	NA	NA	NA	NA	NA
WP_036771498.1|992538_994269_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036771517.1|994452_995589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875952.1|996333_996969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376043.1|997083_998418_-	dihydroorotase	NA	NA	NA	NA	NA
WP_017376044.1|998546_999188_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376045.1|999493_999916_+	universal stress protein	NA	NA	NA	NA	NA
WP_017376046.1|1000193_1001156_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_075275404.1|1001194_1002370_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_087910638.1|1002458_1004159_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_017376050.1|1004158_1005697_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_017376051.1|1005735_1007388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|1007461_1008217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|1009542_1009737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376053.1|1009881_1010511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|1010624_1010798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1011002_1012316_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|1012312_1012957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|1013475_1014663_-	MFS transporter	NA	NA	NA	NA	NA
WP_036772012.1|1014795_1015485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|1015558_1016908_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_048876123.1|1017011_1019192_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|1019261_1020137_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376064.1|1020279_1020480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|1020603_1021011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|1020990_1021569_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|1021991_1022654_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1022684_1023053_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_171824206.1|1023063_1024377_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|1024626_1025238_+	DedA family protein	NA	NA	NA	NA	NA
WP_017376070.1|1025340_1025493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1025663_1025957_-	cold shock domain-containing protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|1026197_1026500_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|1026554_1028828_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|1028887_1029133_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048875954.1|1029257_1030013_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875955.1|1030121_1031096_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036771709.1|1031303_1032065_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	1037916	1103031	3184851	transposase,tRNA	Bacillus_phage(25.0%)	60	NA	NA
WP_017376080.1|1037916_1038705_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376081.1|1038701_1039913_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_144420777.1|1039905_1040262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376083.1|1040356_1040785_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_036771725.1|1040936_1042046_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376085.1|1042042_1042771_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_017376086.1|1042828_1043716_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376087.1|1043800_1044175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376088.1|1044274_1045552_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_027242842.1|1045566_1046295_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144420645.1|1046266_1047523_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_027242841.1|1047632_1049036_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155046606.1|1049188_1049359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|1050764_1051595_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046605.1|1051822_1051972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375750.1|1053921_1054443_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375749.1|1054520_1055006_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_036771957.1|1056449_1057421_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377899.1|1057725_1058517_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_048875958.1|1058506_1059370_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_017377897.1|1059396_1059816_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_017377896.1|1059868_1060825_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_027242839.1|1061307_1063980_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377894.1|1064060_1064687_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_026063687.1|1064843_1066442_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377892.1|1066531_1067953_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|1067983_1068505_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|1068501_1069107_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377889.1|1069183_1070194_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377888.1|1070306_1071011_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|1071045_1071477_+	protein TolR	NA	NA	NA	NA	NA
WP_036771700.1|1071479_1072574_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|1072633_1073986_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|1074021_1074663_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|1074735_1075635_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|1075637_1076285_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_027242835.1|1076335_1077139_-	PhoH family protein	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_017377879.1|1077320_1077536_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|1077539_1077773_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_017377877.1|1077834_1079427_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377874.1|1080559_1081327_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377873.1|1081742_1082462_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_048875960.1|1082520_1083495_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|1083602_1083965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|1084134_1085844_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875961.1|1086084_1087488_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619530.1|1087539_1087797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875963.1|1088545_1089826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376710.1|1090136_1090307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|1090311_1090539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|1090833_1091235_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875964.1|1091799_1092579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|1092646_1092787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|1092987_1093185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|1093322_1093922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|1094104_1095577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|1095979_1097725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|1098160_1099021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378007.1|1099538_1101482_-	CHASE domain-containing protein	NA	NA	NA	NA	NA
WP_048875961.1|1101627_1103031_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	1111328	1153386	3184851	transposase,protease	Acinetobacter_phage(33.33%)	41	NA	NA
WP_027243145.1|1111328_1112384_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_017377998.1|1112394_1112925_+	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_017377997.1|1112959_1113409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174872552.1|1113528_1113834_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174872532.1|1113837_1114500_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275277.1|1114424_1114664_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_048875965.1|1115082_1116003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|1116147_1116288_-	phosphatase	NA	NA	NA	NA	NA
WP_017375623.1|1117176_1117560_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_036774918.1|1117569_1117929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|1118424_1118781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999979.1|1118863_1119010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|1119248_1120505_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|1120760_1120940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169834762.1|1121122_1121275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038657.1|1121280_1121913_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.6e-15
WP_157894725.1|1122210_1122444_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999971.1|1123215_1124619_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|1124789_1126160_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|1126206_1127106_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377763.1|1127086_1129891_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377764.1|1129970_1130567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|1130980_1131736_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_162038649.1|1131825_1132982_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_027242898.1|1133169_1133811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377768.1|1134080_1135406_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_047927230.1|1135402_1137460_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_017377771.1|1137437_1138010_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420781.1|1138092_1138425_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_017377773.1|1138489_1139524_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_027242897.1|1139511_1140633_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_017377777.1|1140726_1141704_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_027242896.1|1141866_1143534_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_048875967.1|1143878_1144670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377782.1|1145077_1147546_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_017377783.1|1147559_1148534_+	homoserine kinase	NA	NA	NA	NA	NA
WP_017377784.1|1148520_1149789_+	threonine synthase	NA	NA	NA	NA	NA
WP_017375591.1|1151749_1151953_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420652.1|1152171_1152849_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_169834764.1|1152986_1153151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963567.1|1153131_1153386_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	5.3e-09
>prophage 10
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	1193858	1229746	3184851	transposase,tRNA	uncultured_Mediterranean_phage(36.36%)	32	NA	NA
WP_051929562.1|1193858_1194563_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036771332.1|1194813_1195788_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017376395.1|1196674_1199401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|1199924_1200899_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376397.1|1201096_1202578_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1203037_1203700_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376398.1|1203941_1205174_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017376399.1|1205330_1208102_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376400.1|1208170_1208614_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376401.1|1208766_1210239_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376402.1|1210350_1211412_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_027242800.1|1211408_1212443_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376405.1|1212445_1213486_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_026063528.1|1213670_1214786_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376407.1|1214824_1215178_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_017376408.1|1215198_1217067_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376409.1|1217088_1218033_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376410.1|1218266_1218545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1218907_1219546_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376411.1|1219520_1220945_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_017376412.1|1221145_1221823_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027242801.1|1221943_1223218_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376414.1|1223285_1224041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|1224092_1225010_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376416.1|1225144_1225315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420654.1|1225434_1226214_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1226266_1226554_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|1226613_1226964_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046603.1|1227157_1227310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999981.1|1227237_1227711_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_048875973.1|1227723_1228359_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773947.1|1228870_1229746_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	1239492	1299769	3184851	transposase	Escherichia_phage(20.0%)	50	NA	NA
WP_017375910.1|1239492_1240221_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1240623_1241352_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075275409.1|1241415_1242243_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242802.1|1242424_1242793_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_017376425.1|1242789_1243608_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_017376424.1|1243708_1244524_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376423.1|1244807_1246868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1246864_1247290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376421.1|1247475_1248969_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_017376420.1|1249101_1249917_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376419.1|1250012_1250429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376418.1|1250811_1251351_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_144420656.1|1252267_1252429_-	phosphatase	NA	NA	NA	NA	NA
WP_036772905.1|1255691_1256045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242803.1|1256253_1257966_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_027242804.1|1258412_1260266_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_016209821.1|1260368_1260701_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017377485.1|1260731_1261328_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_017377486.1|1261324_1262449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377487.1|1262560_1263208_+	class I SAM-dependent methyltransferase	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377488.1|1263259_1265173_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377489.1|1265377_1266415_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242805.1|1266473_1269800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|1270506_1271475_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242807.1|1271604_1272093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777920.1|1272534_1272768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|1273077_1273266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375667.1|1273754_1274240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169834767.1|1274388_1274541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275301.1|1274510_1274780_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_017377496.1|1274814_1276140_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_144420783.1|1276195_1276843_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242809.1|1277036_1278995_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_047927313.1|1279138_1282069_+	insulinase family protein	NA	NA	NA	NA	NA
WP_048875980.1|1282874_1284278_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378296.1|1285718_1286504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1286594_1288244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378294.1|1288388_1289234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1289347_1290751_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1291216_1292224_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1292223_1292481_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157894727.1|1293014_1293665_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_017378290.1|1293692_1294568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275303.1|1294703_1295693_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_053093670.1|1295669_1296350_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.0	1.1e-43
WP_144420659.1|1296463_1297243_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1297519_1298155_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1298151_1298316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1298514_1299489_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378288.1|1299547_1299769_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	1360372	1400778	3184851	transposase,tRNA	Tupanvirus(22.22%)	38	NA	NA
WP_017378228.1|1360372_1361293_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_155046600.1|1365456_1365600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378223.1|1366209_1367028_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|1367135_1367597_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378221.1|1367613_1368537_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_027242798.1|1368560_1369610_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_036773431.1|1369789_1370341_+	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.8	2.4e-14
WP_017378219.1|1370363_1370834_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_144420785.1|1370943_1372194_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_016211840.1|1372882_1373347_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_017378214.1|1373785_1375258_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_017378213.1|1375374_1375827_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155046599.1|1375951_1376107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1376251_1376455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378212.1|1376645_1377044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1377229_1377835_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017375549.1|1377843_1378140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1378144_1378681_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875985.1|1378825_1379431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1379474_1380449_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875986.1|1380445_1380943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910640.1|1381350_1381767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1381834_1383238_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275305.1|1383234_1383855_-	MFS transporter	NA	NA	NA	NA	NA
WP_036773116.1|1384126_1385101_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_036773538.1|1385265_1385889_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376442.1|1385885_1387826_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_017376443.1|1387981_1388635_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376444.1|1388803_1389979_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376445.1|1390332_1391658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376446.1|1391756_1392539_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376447.1|1392640_1393513_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_017376448.1|1393699_1394962_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376449.1|1395035_1395566_+	CvpA family protein	NA	NA	NA	NA	NA
WP_017376450.1|1395587_1397093_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376451.1|1397105_1397771_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376452.1|1397864_1399625_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_036773947.1|1399902_1400778_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	1567029	1582600	3184851	transposase	unidentified_phage(25.0%)	14	NA	NA
WP_048876002.1|1567029_1568013_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
WP_087910642.1|1568812_1569966_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876004.1|1570087_1570780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242833.1|1570788_1571976_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_017376484.1|1572125_1572752_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_017376485.1|1572797_1574027_+	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_144420789.1|1574221_1574668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1574859_1576218_+	dGTPase	NA	NA	NA	NA	NA
WP_048876005.1|1577186_1578104_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_053093673.1|1578445_1579105_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1579185_1579689_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_017376491.1|1579661_1579949_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771628.1|1580241_1581363_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_036771330.1|1581625_1582600_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 15
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	1586839	1702124	3184851	transposase,tRNA,protease,integrase	Staphylococcus_phage(24.0%)	120	1617770:1617829	1645503:1646497
WP_075275277.1|1586839_1587079_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_174872532.1|1587003_1587666_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_174872552.1|1587669_1587975_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876006.1|1588491_1589085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046592.1|1589060_1589207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929832.1|1589409_1589670_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017375982.1|1589868_1590489_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1590562_1591846_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_027243165.1|1592186_1593497_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1593644_1595033_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243163.1|1595168_1596497_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375989.1|1596567_1597068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1597587_1598562_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420675.1|1598637_1598955_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174872542.1|1598958_1599231_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174872543.1|1599435_1599909_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243029.1|1600060_1601029_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_027243028.1|1601238_1602651_-	MFS transporter	NA	NA	NA	NA	NA
WP_017375994.1|1602838_1603552_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_017375995.1|1603572_1603986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1604086_1605160_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_027243027.1|1605296_1606196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1606451_1606703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243025.1|1606751_1607387_+	chorismate mutase	NA	NA	NA	NA	NA
WP_036772872.1|1607511_1608369_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_053856766.1|1608556_1609960_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927520.1|1610135_1610639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377328.1|1610715_1612017_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_027243024.1|1612185_1613286_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_027243023.1|1613636_1613879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772851.1|1613872_1614190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038662.1|1614483_1615639_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	2.2e-49
WP_174872544.1|1615596_1615926_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275277.1|1615850_1616090_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_036774927.1|1616250_1616721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1616943_1617243_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|1617239_1617485_-	hypothetical protein	NA	NA	NA	NA	NA
1617770:1617829	attL	TGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGAT	NA	NA	NA	NA
WP_144420679.1|1617777_1618734_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375591.1|1619018_1619222_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_065653736.1|1619352_1620381_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047927336.1|1620744_1620990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971648.1|1621352_1622327_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_174872545.1|1623143_1623584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275420.1|1623798_1625505_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_036773893.1|1625550_1626402_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_146619459.1|1626604_1629061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420677.1|1629580_1629982_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|1630568_1631543_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378512.1|1631583_1632912_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1633175_1633745_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378513.1|1633760_1634072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1634081_1635050_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1635162_1635516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378515.1|1635519_1636584_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_017378516.1|1636584_1638324_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378517.1|1638330_1638753_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378518.1|1638736_1639366_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275322.1|1639601_1639700_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927346.1|1639732_1641604_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_048876007.1|1641751_1642726_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_017378522.1|1642769_1642949_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243017.1|1643122_1644466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420678.1|1644964_1645243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1645510_1646467_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375696.1|1646793_1647177_+	hypothetical protein	NA	NA	NA	NA	NA
1645503:1646497	attR	TGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTACCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGCGTGATGGTGCTTACGCTTAGTTGTCACTTTATAAGCTTTACGTTGCAGCACCTTTAAACCGAGTTTTTGCATTAGGCTTCTCGCCCGATAACGGCCTACTTGAAAGCCTTCTTCTTGAAGTTTATATGCCATCATTCGTGATCCTAAGCTGCCGCGACTTTCTTTAAAAAGCTCCTTACAGCGCCGATAAAGCTGAAGCTCTTCAATTGAAATCACTTTAGCAGGCCGCTTGTCCCAAGCATAAAAGGCAGAACGGCTTACCTTCATCACTTTACAGGTCAGATTAATAGGATATAACACTTTGTTCTTCCGAATAAAATTAAATTTTACTTCATTTCTTTCGCGAAGAAGGCACTCGCCTTTTTTAAAATTTCTTTCTCCATCTGCAGTTGCTTTACTTTCTTTCGCAGGGATTGAAGCTCAGCCTTTTCATCAGGAGTCAGA	NA	NA	NA	NA
WP_162038663.1|1647192_1647993_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_162038664.1|1647919_1648138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1648428_1649304_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1649305_1649470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420681.1|1649649_1649835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876008.1|1649878_1650853_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_162038665.1|1650849_1652061_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_027242578.1|1652168_1652705_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_017376785.1|1653167_1654073_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171824204.1|1655464_1655641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376787.1|1655789_1656218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046588.1|1656175_1656385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174872546.1|1656646_1656976_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_174872552.1|1656979_1657285_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243099.1|1657500_1658814_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_027243098.1|1659049_1660195_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243097.1|1660260_1660446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1660481_1661114_-	MarC family protein	NA	NA	NA	NA	NA
WP_144420683.1|1661290_1661947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1661935_1664221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376797.1|1664494_1664854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376798.1|1665135_1665771_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017376801.1|1666958_1667783_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_144420791.1|1667838_1669050_-	protein kinase	NA	NA	NA	NA	NA
WP_027243094.1|1669833_1670541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1670603_1670783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312151.1|1670844_1671177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376807.1|1671274_1672018_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017376808.1|1672031_1673075_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376809.1|1673213_1674983_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_048876146.1|1675207_1676341_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_026063564.1|1677190_1680010_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_017376814.1|1680384_1681110_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_157894730.1|1683704_1684229_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.6	2.5e-37
WP_174872547.1|1684193_1684346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929542.1|1684469_1684802_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1684861_1685149_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_075275277.1|1685691_1685931_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_174872548.1|1685855_1686827_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1686954_1687929_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243041.1|1688123_1689077_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_144420684.1|1689246_1689495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420792.1|1689677_1690202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1690656_1691484_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_144420685.1|1691552_1691738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1691938_1692397_+	amino acid permease	NA	NA	NA	NA	NA
WP_017376829.1|1692537_1692765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1692929_1694315_-	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376830.1|1694610_1694925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243043.1|1695033_1696659_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376832.1|1697071_1698061_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1698382_1698568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376833.1|1698957_1700913_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_080963614.1|1700984_1701107_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1701149_1702124_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 16
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	1721888	1764971	3184851	transposase,tRNA	Acinetobacter_phage(25.0%)	38	NA	NA
WP_048876011.1|1721888_1722938_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772296.1|1723137_1723515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1724704_1724992_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036773200.1|1725051_1725348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1725492_1726149_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_017377324.1|1726388_1726769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1727420_1728824_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910660.1|1728820_1729102_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_048876013.1|1729496_1729961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927610.1|1730141_1730735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876007.1|1730920_1731895_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_051929845.1|1732298_1733123_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243222.1|1733197_1734346_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027243221.1|1734361_1735990_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_169834770.1|1735932_1736073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375698.1|1736333_1737527_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_026063486.1|1743641_1744142_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_155046587.1|1744555_1744696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772592.1|1744818_1746279_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_026063485.1|1746356_1746839_-	YiiD C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017375881.1|1746997_1748263_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_027243180.1|1748347_1749607_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_017375878.1|1749678_1749951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1750288_1750624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155069586.1|1750849_1751233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876016.1|1751503_1751914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1752058_1752595_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420687.1|1752605_1752791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376772.1|1753226_1754198_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243181.1|1754179_1755151_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420793.1|1755264_1756038_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017376768.1|1756308_1756638_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162038666.1|1757464_1758621_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_075275326.1|1758673_1759525_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1759740_1760118_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876011.1|1760677_1761727_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376108.1|1762040_1763426_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_017376107.1|1763432_1764971_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
>prophage 17
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	1776103	1844852	3184851	transposase,tRNA,plate	Acinetobacter_phage(40.0%)	56	NA	NA
WP_051929528.1|1776103_1776820_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063521.1|1777948_1778365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420690.1|1779279_1780209_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_017376276.1|1780487_1780802_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_026063520.1|1781711_1782695_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376274.1|1782845_1783193_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_017376273.1|1783192_1783792_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_075275328.1|1784166_1784505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376272.1|1784455_1784713_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048876152.1|1784716_1785661_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420693.1|1785648_1785792_+	phosphatase	NA	NA	NA	NA	NA
WP_075275332.1|1789378_1790380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157894731.1|1790536_1790917_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_169834771.1|1792287_1792425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376672.1|1793099_1796156_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242910.1|1796237_1797692_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027242911.1|1798126_1799143_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017376669.1|1799251_1799650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376668.1|1799689_1801513_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_027242912.1|1801509_1804812_+	translocation/assembly module TamB domain-containing protein	NA	NA	NA	NA	NA
WP_036772026.1|1804916_1805792_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376663.1|1805829_1806744_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027242913.1|1806808_1807438_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_017376662.1|1807482_1807917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376661.1|1807897_1808638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376660.1|1808651_1810049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242914.1|1810051_1813000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772028.1|1812999_1814721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242917.1|1814735_1815140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376655.1|1815140_1818020_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075275426.1|1818022_1818745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242919.1|1819106_1820999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376650.1|1821030_1823571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162287773.1|1823602_1824709_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242921.1|1824771_1825395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242922.1|1825409_1826909_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_036772036.1|1826925_1827432_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_075275427.1|1828687_1828759_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_075275333.1|1828941_1829124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376646.1|1829272_1829998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169834772.1|1830020_1830188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971656.1|1830325_1830598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420695.1|1830613_1832047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420696.1|1832191_1833457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242924.1|1833742_1835494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894733.1|1835506_1836598_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_144420697.1|1836673_1836970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|1837009_1838166_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_036771639.1|1839105_1840080_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_081000010.1|1840138_1840402_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_144420643.1|1840411_1841725_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|1841929_1842103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1842170_1842314_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027243218.1|1842332_1842530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772025.1|1842547_1843054_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_036772663.1|1843976_1844852_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	1874607	1909795	3184851	transposase	Acinetobacter_phage(16.67%)	28	NA	NA
WP_048876022.1|1874607_1875459_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375648.1|1875528_1875714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|1875871_1877025_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876023.1|1877115_1878219_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_017375861.1|1878558_1879059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1879755_1880109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375862.1|1880409_1882137_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_047927270.1|1882240_1882966_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375864.1|1882958_1884197_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375865.1|1884334_1885372_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_026063482.1|1885453_1886329_+	acyltransferase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.1e-56
WP_017375867.1|1886438_1887692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|1887749_1891241_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_144420795.1|1891357_1892035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375871.1|1892162_1892711_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017375873.1|1894581_1894743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929533.1|1895131_1895461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063558.1|1895934_1896501_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_087910646.1|1896503_1897628_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063557.1|1897712_1898531_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_027242970.1|1898661_1900641_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_017376714.1|1900700_1901354_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_080999995.1|1902038_1903409_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376707.1|1905124_1905772_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376706.1|1905809_1906202_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376705.1|1906454_1907201_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243123.1|1907799_1908705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1908820_1909795_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 19
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	1923918	2054374	3184851	transposase,tRNA	Staphylococcus_phage(31.25%)	114	NA	NA
WP_036771330.1|1923918_1924893_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376683.1|1925640_1926342_-	cyclase family protein	NA	NA	NA	NA	NA
WP_027243126.1|1926416_1927046_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_026063554.1|1927213_1928470_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_017376681.1|1928744_1929407_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_017376680.1|1929396_1930629_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_027243127.1|1930760_1931378_+	VOC family protein	NA	NA	NA	NA	NA
WP_036773258.1|1931455_1931962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|1931972_1933129_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_157894734.1|1933482_1933725_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876027.1|1933885_1935097_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|1935349_1935577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1935587_1936001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|1937209_1937374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1937410_1938286_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929862.1|1938472_1938985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038642.1|1941120_1941360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1941416_1942616_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_017375900.1|1942869_1943151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927375.1|1943206_1945198_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_026063491.1|1945271_1946249_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_027242984.1|1946384_1947167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774087.1|1947323_1947647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876030.1|1947714_1948818_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1948887_1949763_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|1949876_1950104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275338.1|1950125_1950575_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_027242985.1|1950588_1951980_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_027242986.1|1952021_1955009_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242987.1|1955078_1955912_-	rod-binding protein	NA	NA	NA	NA	NA
WP_087910648.1|1955966_1957154_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242989.1|1957141_1957846_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_027242990.1|1957891_1958677_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242991.1|1958704_1959442_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|1959546_1961742_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|1961816_1962500_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|1962510_1962942_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242994.1|1962987_1963386_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242995.1|1963762_1964470_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242996.1|1964534_1964831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242997.1|1964872_1965349_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242998.1|1965402_1965924_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242999.1|1966005_1967100_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|1968066_1969470_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375890.1|1969639_1970203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375891.1|1970338_1971814_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375892.1|1971820_1972027_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375893.1|1972084_1973155_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243001.1|1973352_1975323_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375757.1|1975683_1977243_+	APC family permease	NA	NA	NA	NA	NA
WP_144420701.1|1977839_1978196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243002.1|1979036_1979696_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027243003.1|1979791_1981153_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_162038649.1|1981294_1982451_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_017375762.1|1982573_1983914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963648.1|1984564_1984726_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420702.1|1986006_1986882_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036771330.1|1986925_1987900_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_157894736.1|1988097_1988244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876032.1|1988254_1988725_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157894737.1|1988744_1988897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894728.1|1990259_1990412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1995856_1996531_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_036771308.1|1996693_1996915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771376.1|1996942_1997722_-	signal peptidase I	NA	NA	NA	NA	NA
WP_027242763.1|1997880_1999683_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_027242764.1|1999992_2000562_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242765.1|2000716_2002291_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242766.1|2002298_2002757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242767.1|2002737_2002983_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_027242768.1|2003063_2004062_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242769.1|2004208_2004535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|2004691_2005102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771378.1|2005244_2005556_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_048876034.1|2005827_2006520_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375561.1|2006516_2006660_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162038649.1|2008003_2009160_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_017375766.1|2009536_2011567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|2011633_2012659_-	FUSC family protein	NA	NA	NA	NA	NA
WP_027242772.1|2012651_2013698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771312.1|2013838_2014834_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_048876036.1|2015131_2015770_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_017375978.1|2016483_2017671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375977.1|2017836_2018790_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036771316.1|2018812_2020831_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_017375975.1|2020919_2021243_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155046584.1|2021491_2021668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093677.1|2021895_2022615_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_016209463.1|2023230_2023614_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_048876037.1|2024258_2024732_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027242774.1|2024837_2026208_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876038.1|2026323_2027055_+	glucosaminidase domain-containing protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242775.1|2027079_2028177_-	alanine racemase	NA	NA	NA	NA	NA
WP_048876039.1|2028212_2029631_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242777.1|2029840_2030293_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|2030304_2030532_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|2030581_2030908_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_027242779.1|2031111_2031801_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771340.1|2031949_2032438_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_027242781.1|2032478_2033582_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|2033624_2034707_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_157894738.1|2034699_2035230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|2035250_2036555_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_048876041.1|2036608_2037631_-	chorismate mutase	NA	NA	NA	NA	NA
WP_027242785.1|2037655_2038672_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_157894739.1|2038820_2038994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929892.1|2039103_2042226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|2042622_2043246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|2044028_2045579_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_017378207.1|2045873_2046629_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_036771639.1|2047337_2048312_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378201.1|2051220_2051892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053063458.1|2052616_2052865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2052970_2054374_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	2066048	2114977	3184851	transposase	Acinetobacter_phage(33.33%)	50	NA	NA
WP_048876012.1|2066048_2067452_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378188.1|2067448_2068519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242790.1|2068764_2070939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|2070961_2071642_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144420705.1|2071670_2071871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038666.1|2071956_2073113_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_048876044.1|2073262_2073763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171824210.1|2074255_2074426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420800.1|2074723_2075425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375730.1|2075576_2076824_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_017375729.1|2077202_2077814_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375728.1|2077899_2078766_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2078769_2079531_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375727.1|2079694_2080600_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_080963658.1|2080822_2081638_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375724.1|2081823_2082213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375723.1|2082491_2082950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275340.1|2083220_2083829_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|2084359_2085235_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|2085475_2086150_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|2086178_2086667_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|2087712_2088147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2088352_2089756_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927811.1|2090003_2091515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|2092475_2092769_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|2092726_2093305_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|2093390_2094266_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|2094258_2094615_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|2094623_2095019_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_169834775.1|2095519_2095678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300708.1|2096343_2096904_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876048.1|2098026_2099916_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_048876049.1|2099950_2100376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876050.1|2100561_2101155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|2101157_2102456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243104.1|2102436_2103660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|2103709_2104510_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_017377848.1|2104506_2104905_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_027243102.1|2104901_2105210_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|2105603_2106332_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377851.1|2106372_2107017_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|2107029_2107497_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2107551_2108526_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377854.1|2108555_2109155_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|2109151_2109613_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|2109656_2110592_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|2110619_2111615_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|2111858_2112821_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_169834776.1|2113864_2114014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2114248_2114977_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 21
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	2125849	2174641	3184851	transposase	Acinetobacter_phage(22.22%)	46	NA	NA
WP_162287774.1|2125849_2126275_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	35.0	2.3e-12
WP_048876051.1|2126271_2126628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|2126741_2127488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2127456_2128185_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017377223.1|2128929_2129217_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2129276_2129441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876053.1|2129437_2130841_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_053093670.1|2130954_2131635_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.0	1.1e-43
WP_017376296.1|2131920_2132637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|2133414_2134320_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376294.1|2134806_2136099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|2136334_2139085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242868.1|2140723_2141191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|2141191_2141893_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420801.1|2142154_2142337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773579.1|2142590_2142965_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_144420802.1|2143074_2145066_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2145055_2146102_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376284.1|2146542_2147394_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_017376283.1|2147394_2148312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046581.1|2148707_2148881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2149483_2150455_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157894741.1|2152678_2153809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162038643.1|2153777_2153921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|2154148_2154460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|2154937_2155243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242870.1|2155564_2156095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|2156541_2157471_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_144420711.1|2157627_2158053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2158169_2158397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2158550_2159525_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999998.1|2159791_2160061_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876057.1|2160205_2161255_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377028.1|2161322_2162228_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242871.1|2162544_2163306_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211971.1|2163507_2164119_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|2164139_2165339_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|2165433_2165574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|2165586_2165991_-	SufE family protein	NA	NA	NA	NA	NA
WP_017377022.1|2166221_2166791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377021.1|2166857_2167898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162038649.1|2167924_2169081_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_027242872.1|2169202_2170060_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_017377019.1|2170056_2170902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|2170902_2173632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2173765_2174641_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	2195384	2307164	3184851	tRNA,protease,integrase,transposase	Staphylococcus_phage(22.73%)	99	2235141:2235200	2262892:2263995
WP_017377003.1|2195384_2196008_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017377002.1|2196084_2196285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377001.1|2196714_2197413_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377000.1|2197556_2198126_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_026063589.1|2198441_2199068_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376998.1|2199264_2200011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376997.1|2200106_2200946_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_016210463.1|2200996_2201344_-	phosphomannose isomerase type II C-terminal cupin domain	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376996.1|2201534_2202422_+	ROK family protein	NA	NA	NA	NA	NA
WP_017376995.1|2202536_2203139_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376994.1|2203135_2203855_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_080963631.1|2203923_2205636_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376991.1|2205783_2207721_+	AsmA family protein	NA	NA	NA	NA	NA
WP_027242882.1|2207833_2208883_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376990.1|2208882_2209158_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_017376989.1|2209238_2209787_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_162038666.1|2210111_2211268_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	4.4e-50
WP_027243109.1|2212038_2212695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774751.1|2212969_2213893_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047927028.1|2213906_2214830_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027243112.1|2214777_2215434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|2215736_2216564_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_017376518.1|2216714_2217086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927029.1|2217314_2218805_+	nuclease	NA	NA	NA	NA	NA
WP_017376516.1|2218872_2220210_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_017376515.1|2220352_2221819_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376514.1|2221815_2222865_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_027243115.1|2222988_2225097_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|2225259_2225664_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2225725_2226451_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_017376511.1|2226536_2227430_+	YicC family protein	NA	NA	NA	NA	NA
WP_017376510.1|2227470_2228091_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_016210310.1|2228151_2228358_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376509.1|2228379_2230524_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_017376506.1|2232719_2233643_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376505.1|2233709_2234993_+	MFS transporter	NA	NA	NA	NA	NA
2235141:2235200	attL	TCGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAAC	NA	NA	NA	NA
WP_036771330.1|2235233_2236208_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|2236523_2236685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2236681_2238085_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|2238198_2238966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2239324_2240728_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963604.1|2241548_2241749_-	zf-TFIIB domain-containing protein	NA	NA	NA	NA	NA
WP_017377826.1|2241989_2243435_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875904.1|2244630_2245506_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243174.1|2246957_2247239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927196.1|2247796_2248816_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|2248802_2249225_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_017376521.1|2249226_2249700_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|2249825_2250482_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|2250478_2251153_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|2251158_2252307_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|2252303_2252765_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|2252840_2254091_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376527.1|2254217_2255897_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_027243172.1|2256008_2256890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772261.1|2257991_2258585_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017375619.1|2259732_2260257_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	29.0	1.4e-11
WP_017375618.1|2260401_2260686_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169834777.1|2260714_2260852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420804.1|2261235_2261511_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2261883_2262858_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242983.1|2263014_2263653_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_017377745.1|2263734_2264133_-	VOC family protein	NA	NA	NA	NA	NA
2262892:2263995	attR	GTTTATCTGTATGAATATGAACTCTCTACTGAGTGTTGCACTTCAGATGACGGAGGGCGATTTTTTTAGCTCAAGTTAACAAGTTAAAATACGAGACTAAACACCTAGTATAAAATAGAGCGATTAAACTATTAAAATCCCTTTTACTTTTTCAGCAACAGCTCGACCTAACTTTATATTCTCTTCAGCAAGCAAATGAACACCCTCACCAGGTGCTGCGCTGATAAAAGTCGCAGTATCTAAATAAGCAATTTTGAAAAATTCTGCGACATTTTCATAATGACTGGAAATTTGCATGGACACTTCTTTTTGACTGCCAAAAATAGTATCCATTAGCCCAGAAGTCTCTCCCAGATGAGGTGGTGATAATAATAACACCTGAGGTGCGCCGCCATTTGGCCCCGTGCAGCTATATAAAGCTTTTCTCACTAAACTCCCACAACCTAGCGCAATTTCATTTGCCTGGCCTGAAATATGTGCTTTTAAATCATTCGTTCCTAATAAAAAAATAACCAAATCTACCGGCATATTCGACTCTAAATACACCGGTAAAAATGCTGCACCATTACGCATCACTCCATCCATCATTGGGTCATCATAAATGGTAGTCCGCCCATTTAAACCTGCTTCAATGACTCGGTAATCACCCCCTAAGTTCTCCTGCAATACACCAGTCCAACGTTGATCAAATGAATAACGTCCAGAATTTTCTGGATTATAACCCCAGGTTAAAGAATCACCATAGCATAGAATAGTTTTCAAGATAAAACTCCATAATATTTTAATATAAAAATAAATTTCAAACAGCAATTGATATTAATTATTCCCAAGCAAATTAAGCCGTTATATTTCATAAAGCTCTAAAGGCAAGCCATCAGGATCAGAAAAAAAAGTATATTTTTTTCCCGTTAACGCATCAACTCTCACCGGCTCCACATCAATCCTGTGCTGTTGTAAACATTTCACTGACTCATTAACATTCTCAACAGCAAAAGCTAAATGTCGCAGCCCACAAGCTTCAGGAAAACTTAAACGCTTGGGAGGGTTAACAAATGAAAATAATTCCAGTTGATTACCATTCATTAATTTTAAGTCTAACTTATA	NA	NA	NA	NA
WP_017377746.1|2264285_2264603_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377747.1|2264681_2264936_-	LapA family protein	NA	NA	NA	NA	NA
WP_017377748.1|2265088_2266750_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377749.1|2266810_2267494_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_036773645.1|2267493_2268579_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377751.1|2268620_2271257_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	6.9e-99
WP_155051395.1|2272236_2272380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377754.1|2273061_2274381_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|2274384_2275101_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377756.1|2275097_2275739_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_144420715.1|2275731_2275866_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242981.1|2276114_2276570_-	VOC family protein	NA	NA	NA	NA	NA
WP_027242980.1|2276661_2277006_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048876031.1|2278124_2279528_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375702.1|2279990_2281022_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|2281490_2281838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|2281872_2282535_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_027242979.1|2282578_2283181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375707.1|2283410_2284466_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242978.1|2284469_2287655_+	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375710.1|2287732_2288689_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242977.1|2288737_2289274_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375712.1|2289270_2290032_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242976.1|2290134_2292723_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_144420805.1|2293150_2293762_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242975.1|2294020_2294896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375718.1|2296054_2296453_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_146619445.1|2296456_2296762_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242974.1|2297281_2297938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242973.1|2297954_2300165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242972.1|2300553_2301846_-	MFS transporter	NA	NA	NA	NA	NA
WP_027242971.1|2302172_2304236_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_017376742.1|2304238_2304886_+	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_017376743.1|2304901_2305534_+	endonuclease III	NA	NA	NA	NA	NA
WP_017376744.1|2305594_2306032_+	DUF1841 family protein	NA	NA	NA	NA	NA
WP_048875904.1|2306288_2307164_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	2334446	2387039	3184851	transposase,tRNA	Synechococcus_phage(14.29%)	45	NA	NA
WP_048875859.1|2334446_2335241_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|2335530_2336454_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|2336721_2337015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|2338217_2339141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|2339276_2340119_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|2340206_2340857_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_026063695.1|2340870_2341929_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	3.0e-69
WP_036773623.1|2342033_2343119_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_027243121.1|2343145_2344255_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|2344559_2344877_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|2344873_2345233_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|2345335_2348068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052106250.1|2349557_2350082_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_036773260.1|2350361_2350700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|2350844_2352053_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065653755.1|2352480_2353938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|2354773_2355049_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773050.1|2357752_2357932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063690.1|2357928_2358300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2358310_2359624_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_169834778.1|2359919_2360087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|2360609_2360828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|2361318_2361585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243154.1|2363549_2364800_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_036773486.1|2364788_2365646_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|2365662_2366748_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377907.1|2366744_2368004_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|2368172_2368832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|2369002_2369665_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|2370011_2370959_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|2371055_2371682_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|2371687_2372269_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|2372340_2373432_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|2373521_2374235_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_027243155.1|2374328_2375153_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420808.1|2375386_2376064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|2377741_2377999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2378399_2379374_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|2379548_2380193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420720.1|2380366_2381167_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774583.1|2381865_2382516_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927392.1|2382765_2383617_+	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_017377925.1|2383908_2384301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927390.1|2384802_2385894_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	31.7	3.4e-36
WP_087910651.1|2386862_2387039_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
>prophage 24
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	2404661	2423141	3184851	transposase,protease	Staphylococcus_phage(28.57%)	15	NA	NA
WP_017377942.1|2404661_2405168_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243059.1|2405213_2408165_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017377945.1|2408186_2408519_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_047927125.1|2408636_2409146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|2410909_2412076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|2412220_2412973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2413328_2414303_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016209908.1|2414435_2415146_+	winged helix-turn-helix domain-containing protein	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|2415142_2416177_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_017377691.1|2416280_2416622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|2417132_2418293_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|2418261_2418858_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046570.1|2419826_2419997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2419993_2420968_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910645.1|2421987_2423141_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
>prophage 25
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	2456623	2504038	3184851	transposase,tRNA,plate	Staphylococcus_phage(40.0%)	44	NA	NA
WP_027242850.1|2456623_2457580_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_027242851.1|2457561_2459250_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_017376356.1|2459246_2459645_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_017376355.1|2459644_2461117_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027242852.1|2461122_2461611_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027242853.1|2461603_2463073_-	type VI secretion system domain-containing protein	NA	NA	NA	NA	NA
WP_027242854.1|2463077_2463770_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_027242855.1|2463747_2464776_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242856.1|2464769_2465996_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242857.1|2466001_2467513_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_017376343.1|2467773_2468211_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_027242858.1|2468287_2469595_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242859.1|2469599_2470310_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242860.1|2470322_2473493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|2473559_2474696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169834779.1|2475243_2475414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376336.1|2475558_2476416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|2476557_2477358_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376334.1|2477456_2478032_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_027242862.1|2478114_2478786_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027242863.1|2478831_2479731_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|2479765_2480149_-	response regulator	NA	NA	NA	NA	NA
WP_017376330.1|2480298_2481063_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376329.1|2481053_2481764_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_017376328.1|2481760_2482786_-	phosphotransferase	NA	NA	NA	NA	NA
WP_048876074.1|2482916_2485421_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376325.1|2485427_2486696_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_017376324.1|2486697_2487681_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376323.1|2487693_2488515_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376322.1|2488559_2488952_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376321.1|2489026_2489833_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_036774104.1|2490020_2490449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2490507_2491482_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375660.1|2491505_2491943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2491977_2493381_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376011.1|2493961_2494123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376015.1|2495343_2495715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242569.1|2495822_2497373_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376017.1|2497405_2498245_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017376018.1|2498241_2498757_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376019.1|2498760_2499753_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376020.1|2500131_2501502_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_027242570.1|2501710_2502850_+	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_075275355.1|2503063_2504038_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
>prophage 26
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	2529337	2573904	3184851	transposase,tRNA	Escherichia_phage(12.5%)	38	NA	NA
WP_026063546.1|2529337_2530012_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2530040_2530445_+	RidA family protein	NA	NA	NA	NA	NA
WP_027243116.1|2530469_2531429_-	response regulator	NA	NA	NA	NA	NA
WP_017376616.1|2531561_2532344_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275357.1|2532445_2533405_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376613.1|2533549_2533897_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376611.1|2535109_2535646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376610.1|2536453_2537464_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_053856763.1|2537805_2538816_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875883.1|2538960_2539497_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929685.1|2539756_2540659_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376607.1|2541648_2542638_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_017376606.1|2542806_2543145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|2543141_2543717_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376604.1|2543765_2543981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|2544167_2545007_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376601.1|2548703_2549612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275358.1|2549742_2550303_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174872528.1|2550228_2550384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|2550507_2551434_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772137.1|2551752_2552313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377036.1|2552782_2554102_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017377037.1|2554169_2555036_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_036772169.1|2555028_2555904_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377039.1|2555962_2556181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377041.1|2557581_2557911_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_026063593.1|2558145_2558850_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377043.1|2558830_2561059_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377044.1|2561321_2562335_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377045.1|2562443_2562665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377046.1|2562669_2564307_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377047.1|2564445_2564979_+	GspH/FimT family pseudopilin	NA	NA	NA	NA	NA
WP_017377048.1|2565099_2566218_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_162038676.1|2566276_2567533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|2567519_2568656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|2568886_2569312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242609.1|2572640_2572994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2573028_2573904_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	2633458	2686545	3184851	transposase	Staphylococcus_phage(28.57%)	47	NA	NA
WP_036773116.1|2633458_2634433_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971661.1|2634429_2634867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|2635041_2636445_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377105.1|2636455_2636731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377106.1|2637007_2637478_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377107.1|2637780_2639151_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_075275363.1|2639480_2639948_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377110.1|2639960_2640971_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_053856766.1|2641172_2642576_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_169834780.1|2642639_2642780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242632.1|2643002_2643791_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_171824211.1|2643777_2644800_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_017377113.1|2644783_2645188_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_017377115.1|2645415_2647383_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377116.1|2647578_2648070_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_026063598.1|2648104_2648947_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377118.1|2648992_2649445_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_017377119.1|2649734_2650367_+	LysE family translocator	NA	NA	NA	NA	NA
WP_027242633.1|2651650_2652748_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017375625.1|2653077_2653305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2657175_2658579_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375801.1|2658575_2659616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927106.1|2660007_2660403_+	YchJ family protein	NA	NA	NA	NA	NA
WP_144420816.1|2660399_2661188_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_017375804.1|2661373_2662099_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017375805.1|2662343_2663531_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375806.1|2663823_2664366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375807.1|2664362_2665049_-	acireductone synthase	NA	NA	NA	NA	NA
WP_017375808.1|2665052_2665664_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375809.1|2665710_2666730_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375811.1|2667639_2668440_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375812.1|2668518_2669568_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_026063478.1|2669743_2671024_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_048875876.1|2671069_2671444_+	DUF47 family protein	NA	NA	NA	NA	NA
WP_017375815.1|2671831_2672113_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_075275366.1|2672204_2673059_-	MFS transporter	NA	NA	NA	NA	NA
WP_162287775.1|2672998_2673394_-	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_027242636.1|2673924_2674866_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017375821.1|2675584_2675806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875923.1|2675802_2676798_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773936.1|2678647_2679403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764754.1|2679597_2681202_-	amino acid permease	NA	NA	NA	NA	NA
WP_129556626.1|2681536_2682925_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375827.1|2683356_2683794_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_027242638.1|2684041_2684470_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_047927246.1|2684590_2685028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|2685141_2686545_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	2729505	2763827	3184851	transposase	Staphylococcus_phage(16.67%)	31	NA	NA
WP_048876031.1|2729505_2730909_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420729.1|2731028_2731667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2732014_2732989_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242659.1|2733297_2734323_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.9	2.0e-17
WP_017377361.1|2734430_2735636_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	1.7e-36
WP_017377360.1|2735870_2736284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377358.1|2736785_2737355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377357.1|2737357_2737696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377356.1|2737688_2738222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377355.1|2738240_2738531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242660.1|2738617_2740249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377353.1|2740801_2741305_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	41.2	1.9e-13
WP_017377352.1|2741267_2741975_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_017377351.1|2742039_2742900_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_017377350.1|2742880_2743654_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377349.1|2743684_2744923_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_036773024.1|2744922_2745885_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_017377347.1|2746734_2748618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377345.1|2749207_2749444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420819.1|2749462_2749912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377343.1|2750132_2751557_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.0e-16
WP_017377342.1|2751621_2752122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157894746.1|2752259_2752658_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_036818827.1|2752960_2753692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420730.1|2753722_2754613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377336.1|2755955_2758766_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_075275277.1|2758948_2759188_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_174872551.1|2759112_2760084_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_027242662.1|2760497_2761325_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_017377694.1|2761494_2762223_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_048876012.1|2762423_2763827_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	2788651	2830625	3184851	transposase,protease,tRNA	Staphylococcus_phage(42.86%)	44	NA	NA
WP_069971662.1|2788651_2789626_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_027242664.1|2789909_2791112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929598.1|2791408_2791666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|2791623_2792064_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_053856769.1|2792169_2792736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875862.1|2792880_2793135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|2793279_2794149_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063584.1|2794670_2795630_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_017376953.1|2795626_2796274_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_017376954.1|2796302_2797154_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376955.1|2797168_2798446_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376956.1|2798486_2799002_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376957.1|2799079_2800141_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_036818645.1|2800162_2801251_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016210381.1|2803171_2803642_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2803678_2804014_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_162039067.1|2804026_2804671_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_036772771.1|2804679_2805720_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_017376963.1|2805692_2806172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|2806258_2808739_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_036772765.1|2808801_2809233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376966.1|2809433_2809724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242666.1|2809783_2811382_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376969.1|2811546_2811882_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017376970.1|2811910_2813575_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_027242667.1|2813574_2814216_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376972.1|2814215_2814959_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017376973.1|2815017_2815254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|2815404_2816772_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|2816782_2817334_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_065653729.1|2817414_2818518_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376977.1|2818519_2820277_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062312189.1|2820499_2821123_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2821177_2821597_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_047927116.1|2821737_2822352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242668.1|2822409_2823195_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376980.1|2823826_2824843_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144420820.1|2824845_2825358_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|2825399_2825873_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_048875860.1|2825928_2826714_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_036771653.1|2826757_2827498_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
WP_017376985.1|2827587_2827836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420733.1|2828833_2829013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856770.1|2829410_2830625_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	2916268	2976604	3184851	transposase,tRNA	Bodo_saltans_virus(16.67%)	56	NA	NA
WP_017378106.1|2916268_2917213_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_017378107.1|2917212_2917566_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_017378108.1|2917614_2920290_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	1.3e-25
WP_017378109.1|2920306_2921824_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|2921900_2922353_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_017378111.1|2924008_2925547_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_017378112.1|2925561_2927532_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|2927535_2927841_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_017378113.1|2927864_2928488_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|2928507_2928996_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_027242679.1|2929009_2930035_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_017378117.1|2930039_2932433_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|2932482_2933772_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378119.1|2934277_2935531_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_017378120.1|2935532_2936210_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|2936227_2936713_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|2936703_2937072_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_017378122.1|2937750_2938113_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017378123.1|2938126_2938888_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017378124.1|2939189_2940536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771461.1|2940632_2941175_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_017378126.1|2941290_2942124_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_027242680.1|2942145_2942739_+	thymidine kinase	NA	A0A0B7MRR0	Enterobacteria_phage	53.6	6.4e-53
WP_048875856.1|2942914_2943934_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2944378_2944606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378129.1|2944616_2944940_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_065653735.1|2944963_2945974_-	lipase	NA	NA	NA	NA	NA
WP_026063707.1|2947004_2947916_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_036772169.1|2948682_2949558_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063708.1|2949616_2949997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063709.1|2950143_2950380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378135.1|2950676_2951147_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_017378136.1|2951201_2952056_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378137.1|2952527_2952746_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378138.1|2952848_2954099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|2954154_2954637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242682.1|2954873_2955302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2955637_2956612_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017378141.1|2956670_2957723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378142.1|2958041_2959007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378143.1|2959309_2960134_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378144.1|2960335_2961412_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378145.1|2961496_2962483_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378146.1|2962501_2963146_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_027242684.1|2963157_2964267_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_027242685.1|2964333_2964996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242686.1|2965255_2967139_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_017378149.1|2967452_2968952_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_017378150.1|2969042_2969825_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378151.1|2969952_2970873_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378152.1|2970896_2971355_+	NfeD family protein	NA	NA	NA	NA	NA
WP_048875854.1|2971476_2972352_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|2972385_2973651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2973838_2974714_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|2974912_2975104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|2975308_2976604_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	2987341	3027094	3184851	transposase	Bacillus_virus(20.0%)	34	NA	NA
WP_017375951.1|2987341_2987800_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|2988518_2989394_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420737.1|2989625_2990024_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081000012.1|2990027_2990270_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375794.1|2991159_2992911_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375795.1|2992921_2993722_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375796.1|2993824_2994313_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_047927156.1|2994812_2995736_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375799.1|2995832_2996177_+	DMT family protein	NA	NA	NA	NA	NA
WP_017377528.1|3001872_3002835_-	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_036772663.1|3002873_3003749_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063646.1|3004008_3005268_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|3005490_3005817_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_048875850.1|3006011_3006962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242725.1|3007019_3009086_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_017377534.1|3009091_3010087_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242724.1|3010826_3012407_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|3012554_3013964_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_017377536.1|3014023_3015157_-	cation transporter	NA	NA	NA	NA	NA
WP_017377537.1|3015295_3016120_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377539.1|3016643_3016856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|3016869_3017007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052673.1|3017144_3017369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169834782.1|3017930_3018071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|3018429_3018801_-	isochorismatase	NA	NA	NA	NA	NA
WP_017377542.1|3019111_3019399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377543.1|3019550_3020399_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_048875849.1|3020521_3021493_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377545.1|3021595_3022636_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_017377546.1|3022698_3024174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377547.1|3024378_3024762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|3025174_3025465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377551.1|3025732_3025993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3026119_3027094_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 32
NZ_CP011849	Piscirickettsia salmonis LF-89 = ATCC VR-1361 chromosome, complete genome	3184851	3060088	3121550	3184851	transposase,tRNA	Acinetobacter_phage(33.33%)	56	NA	NA
WP_053093682.1|3060088_3060832_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_162039070.1|3062172_3062595_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_017377391.1|3062865_3063444_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377386.1|3067966_3069472_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_017377385.1|3069499_3069781_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3069929_3070271_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_017377384.1|3070391_3072296_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_047927397.1|3072428_3074000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875845.1|3074017_3075241_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377379.1|3075362_3076361_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_144420826.1|3076364_3077123_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_017377377.1|3077124_3078324_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_162287776.1|3078307_3078946_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_017377375.1|3079000_3079777_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	31.1	2.0e-22
WP_017377374.1|3079780_3080779_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.4	2.7e-40
WP_017377373.1|3080780_3081359_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	1.1e-44
WP_017377372.1|3081355_3082825_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3082868_3083156_-	trp operon repressor	NA	NA	NA	NA	NA
WP_026063627.1|3083356_3084277_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017377369.1|3084392_3084947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377368.1|3085062_3085488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771981.1|3085758_3086109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242711.1|3086302_3086842_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_017377365.1|3086926_3087463_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_027242710.1|3088122_3088425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242709.1|3088873_3089443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242708.1|3089511_3089856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376171.1|3090034_3091009_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046560.1|3091275_3091449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|3091554_3092958_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875844.1|3092962_3093982_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275373.1|3094598_3094928_+	VUT family protein	NA	NA	NA	NA	NA
WP_017378398.1|3095153_3095552_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|3096419_3097370_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378400.1|3097369_3099448_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378401.1|3099589_3100105_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378402.1|3100113_3100677_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378403.1|3100657_3101404_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378404.1|3101542_3101995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927132.1|3102130_3102967_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_027242707.1|3102963_3103860_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017378407.1|3103892_3104960_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_080963575.1|3105660_3107112_-	potassium transporter	NA	NA	NA	NA	NA
WP_017378410.1|3107118_3108498_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_036773239.1|3108538_3109852_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_026063734.1|3109841_3110816_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_017378413.1|3110909_3111413_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_017378414.1|3111547_3112699_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3112695_3113175_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_027242705.1|3113321_3115643_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_080963576.1|3115587_3116214_+	Sua5/YciO/YrdC/YwlC family protein	NA	NA	NA	NA	NA
WP_017378416.1|3116218_3117118_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036773242.1|3117305_3117860_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|3117899_3118874_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|3119463_3119841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3120575_3121550_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 1
NZ_CP011850	Piscirickettsia salmonis LF-89 = ATCC VR-1361 plasmid pPSLF89-1, complete sequence	180124	1129	125456	180124	integrase,portal,terminase,transposase	Streptococcus_phage(42.22%)	120	15049:15108	54691:55611
WP_081000017.1|1129_1381_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_080999971.1|1645_3049_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_174872553.1|3189_6270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243203.1|7225_8020_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_017375836.1|8113_8317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|8511_8847_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_048876182.1|9546_11442_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_048876184.1|11797_12373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876185.1|12835_13984_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|14279_14546_+|transposase	transposase	transposase	NA	NA	NA	NA
15049:15108	attL	ACGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTA	NA	NA	NA	NA
WP_036771330.1|15085_16060_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027243200.1|16366_16771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|16771_17518_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_048876223.1|18026_19088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963627.1|20067_20286_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036772541.1|20304_21033_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243198.1|21172_21868_+	Fic family protein	NA	NA	NA	NA	NA
WP_027243197.1|21872_22442_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_036772541.1|22612_23341_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_036815648.1|23824_24553_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|25294_26023_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929623.1|26180_29522_-	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_027243201.1|29585_29825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|29990_30719_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243202.1|30993_31929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774373.1|33589_34318_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_036774376.1|34627_35056_+	nucleotidyltransferase substrate binding protein	NA	NA	NA	NA	NA
WP_036774316.1|35052_35352_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774378.1|35394_35964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420833.1|36168_36360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|36373_37414_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242592.1|37480_37810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774388.1|37833_38796_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017377694.1|40173_40902_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|41148_41298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|41309_42038_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_048876190.1|42067_42397_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876191.1|42389_42818_-	nucleotidyltransferase substrate binding protein	NA	NA	NA	NA	NA
WP_162287777.1|43440_44596_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	2.2e-49
WP_155046637.1|45329_45821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|45902_46631_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_047927778.1|46974_47259_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876193.1|47426_49292_+	RecX family transcriptional regulator	NA	V5K3E8	Pseudomonas_phage	32.7	6.0e-57
WP_080963664.1|49364_49631_-|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_080963665.1|49811_50153_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_048876194.1|50333_50867_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_036774350.1|52106_52835_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_027243215.1|53317_54340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876196.1|56153_57302_+	hypothetical protein	NA	NA	NA	NA	NA
54691:55611	attR	ACGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCGATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAACTTCATTAAAATCCGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGTTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCGGCAAACTCTGTTCCGTTGTCAGAAGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGGTCACGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGTTGTTCAATACCAACGCGATTAGGTATTTTTGTTTGATCACCACGACTCACCTTCTTCTTATAAGGTTTTCCTGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCCGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTCTCACTCACCTGAATATTATGCTCACGTATAAGTTCTTGACTGATAACATCGGGGGATGTATGAGTGCTTAACCGCTGATGAATCAACATTTTTTCCTCTTCTGAAATTTGTTGAAAAGCTTGTCCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCGCAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAA	NA	NA	NA	NA
WP_036771347.1|57331_58309_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_047927782.1|58224_58614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169834791.1|59258_59411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420843.1|59409_61293_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|61411_62389_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|62546_62759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|63759_64737_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_048876199.1|64723_65014_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	52.6	1.3e-11
WP_027243211.1|65003_65258_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_155046636.1|65475_65637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|65651_66629_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|67109_68087_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_144420849.1|68552_69533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|69764_70274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242596.1|70313_70676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275482.1|70989_71964_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_017377509.1|72057_72786_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_157894750.1|72966_76251_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_144420848.1|76314_76500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876202.1|77878_78592_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_036771649.1|78638_79373_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_087910668.1|79410_79797_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_157894751.1|79883_80240_-	hypothetical protein	NA	A0A1X9I6B3	Streptococcus_phage	49.6	2.6e-25
WP_048876205.1|80522_81854_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_081049201.1|81856_82339_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242929.1|82425_82809_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_017375952.1|83004_83208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242930.1|83397_84780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242931.1|84925_85333_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242932.1|85341_85569_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_026063496.1|85701_86067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817204.1|86766_87762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|88032_88458_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_155048090.1|88408_88927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375966.1|89071_89638_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_048876207.1|89638_91114_+	response regulator	NA	NA	NA	NA	NA
WP_144420845.1|91619_91850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|91977_92430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|92426_92645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375841.1|92951_93161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375972.1|93605_93914_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027242938.1|93915_94284_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_048876229.1|94697_95669_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046634.1|95587_95788_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_036771279.1|95857_96586_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375850.1|96946_97723_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_169834792.1|97934_98102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275480.1|98139_98676_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_155046633.1|99882_100026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771289.1|100919_101390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876208.1|102243_103071_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_157894752.1|103483_103663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174872554.1|103842_104907_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|105476_106205_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036772441.1|106280_106553_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|106556_106817_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_036775032.1|109448_110264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375909.1|110311_111001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|111289_112018_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036771347.1|113038_114016_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_169834791.1|114605_114758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420843.1|114756_116640_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_174872555.1|117413_117692_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|117721_118699_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771359.1|118826_119555_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_017375754.1|119737_121024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046630.1|121044_121209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082884401.1|121625_121748_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|121845_122574_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772437.1|122995_124894_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|125189_125456_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011850	Piscirickettsia salmonis LF-89 = ATCC VR-1361 plasmid pPSLF89-1, complete sequence	180124	135811	145403	180124	transposase	Staphylococcus_phage(25.0%)	14	NA	NA
WP_157894754.1|135811_136906_-	RepB family plasmid replication initiator protein	NA	A0A218MNI2	uncultured_virus	29.8	3.6e-25
WP_017375840.1|137892_138111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|138155_138560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|138573_138912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162287778.1|138904_139054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815979.1|139500_140109_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_017375910.1|140111_140840_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_051929563.1|140862_141252_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_036772541.1|141281_142010_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_048876211.1|142021_142726_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_144420840.1|143108_143540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876212.1|143570_144449_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243191.1|144402_145110_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_075275473.1|145226_145403_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
>prophage 1
NZ_CP011851	Piscirickettsia salmonis LF-89 = ATCC VR-1361 plasmid pPSLF89-2, complete sequence	33516	4842	20864	33516	capsid,tail,integrase,terminase,transposase,head	unidentified_phage(35.71%)	24	4172:4231	18345:18636
4172:4231	attL	CAAACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGT	NA	NA	NA	NA
WP_036771330.1|4842_5817_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_081049205.1|5930_6287_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212329.1|6352_6943_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|7173_7434_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|7426_7780_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|7956_8931_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|9463_9829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|9973_10228_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_027242952.1|10220_10568_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.6e-16
WP_036771330.1|10665_11640_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_169834793.1|11871_12018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242951.1|12265_13132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|13344_13728_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|13814_14297_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|14299_14485_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|14504_15479_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|15575_15968_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|16003_16585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168183246.1|16752_16908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|16965_17940_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_171824220.1|17983_18229_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|19032_19548_-	hypothetical protein	NA	NA	NA	NA	NA
18345:18636	attR	ACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGCATTGATCCTACTCAGCTTATTGATACGCCGACCGGTACGATACTGATACATTCTCACCCTGATGGCACGGTTGAGCCGTCACTCGCGGATATGGTGGGTCAACGCGATACTGGATTATTATGGGGGATTGTTGCACTCAATCAACACGCTGTGACGGATGCCATTGTTTTTGGTGAGCAGTTATTCACCCAGCAATTACTCGAGCGGCCGTTTTTGCATGGTATTTTTGAT	NA	NA	NA	NA
WP_027242944.1|19893_20451_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|20447_20864_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
>prophage 1
NZ_CP011852	Piscirickettsia salmonis LF-89 = ATCC VR-1361 plasmid pPSLF89-3, complete sequence	51573	3154	14404	51573	tail,transposase,head	Moraxella_phage(25.0%)	14	NA	NA
WP_017375778.1|3154_3466_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375780.1|4066_4462_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|4458_4809_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|4808_5231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|5232_5556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|5612_5879_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|5882_7961_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|7953_8295_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_017375787.1|8291_8963_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|8892_9678_+	C40 family peptidase	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|9667_10225_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_048876251.1|10221_12912_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	8.0e-111
WP_017375652.1|12970_13399_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|13426_14404_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
