The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018658	Escherichia coli O104:H4 str. 2011C-3493, complete sequence	5273097	68778	91393	5273097	transposase,integrase	Escherichia_phage(33.33%)	24	71348:71377	91389:91418
WP_000844627.1|68778_69021_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001300563.1|69892_71005_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
71348:71377	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_000429836.1|71372_71807_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|71878_72229_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|72242_72518_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|72553_72976_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|73027_74722_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|74739_75102_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|75098_75335_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|75370_76039_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|77428_78133_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|78193_79030_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|79029_79833_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|79893_80709_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|81016_81868_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|82623_83328_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|83452_84157_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000259029.1|84190_84970_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_000679427.1|84963_85311_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000703418.1|85540_86014_-	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000845048.1|86171_87185_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|87387_87738_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|87863_88424_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|88426_91393_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
91389:91418	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
>prophage 2
NC_018658	Escherichia coli O104:H4 str. 2011C-3493, complete sequence	5273097	890683	923836	5273097	transposase,protease,plate	Escherichia_phage(40.0%)	16	NA	NA
WP_001390300.1|890683_892486_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001173975.1|892476_893409_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000198270.1|893421_895404_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	35.6	2.2e-12
WP_000005080.1|895414_895882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001390299.1|895891_896191_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_001033155.1|896194_897271_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000152746.1|897278_897830_+	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001154665.1|897848_899261_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001028113.1|899599_900190_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000914956.1|900195_903600_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000029846.1|903603_906153_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.8	4.6e-92
WP_000587872.1|911587_912154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359994.1|912632_913787_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_077577697.1|916273_916636_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
WP_001390760.1|917431_918556_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.3e-199
WP_001045650.1|919717_923836_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
>prophage 3
NC_018658	Escherichia coli O104:H4 str. 2011C-3493, complete sequence	5273097	1205326	1212466	5273097		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1205326_1205965_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1205961_1207224_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1207220_1208129_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1208324_1209092_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141316.1|1209142_1209799_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
WP_001272924.1|1209904_1212466_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 4
NC_018658	Escherichia coli O104:H4 str. 2011C-3493, complete sequence	5273097	1572517	1604475	5273097	protease,terminase,portal,integrase,head	Enterobacteria_phage(47.06%)	38	1570049:1570065	1607729:1607745
1570049:1570065	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000194515.1|1572517_1573951_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274887.1|1574166_1575081_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197025.1|1575152_1576400_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|1576929_1577130_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001277767.1|1577261_1577441_-	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_000208008.1|1577537_1578167_-	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	58.6	1.1e-55
WP_000951713.1|1578163_1578373_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000034245.1|1578735_1579407_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	73.2	3.0e-83
WP_001214454.1|1579403_1579571_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_032159494.1|1579567_1579849_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	9.7e-44
WP_001111299.1|1579868_1580165_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	3.9e-51
WP_000951329.1|1580188_1580572_-	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	1.2e-65
WP_000031367.1|1580571_1581177_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_000050554.1|1581187_1581358_-	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_001243355.1|1581433_1581586_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|1581570_1581702_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_000807788.1|1582748_1582991_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000113732.1|1582993_1583434_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000200769.1|1583430_1584843_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	9.8e-278
WP_000852341.1|1584845_1586972_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.0	0.0e+00
WP_000426730.1|1586985_1587870_+	hypothetical protein	NA	Q716H1	Shigella_phage	99.0	2.0e-143
WP_001133485.1|1587881_1589153_+|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	1.2e-239
WP_000375637.1|1589195_1589381_+	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
WP_000246749.1|1589355_1589838_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	99.4	8.4e-88
WP_001122379.1|1589846_1591265_+	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.9	3.9e-274
WP_000785547.1|1591264_1592113_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.5	3.4e-100
WP_000614045.1|1592112_1592568_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	5.7e-86
WP_000964882.1|1592570_1593263_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000246924.1|1593272_1594739_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	62.0	8.4e-139
WP_001387755.1|1594738_1596583_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	73.8	4.0e-247
WP_000749286.1|1596597_1597083_-	lipoprotein	NA	NA	NA	NA	NA
WP_000820795.1|1597108_1597423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283829.1|1597419_1597671_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	93.9	1.5e-35
WP_000865490.1|1597776_1597917_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	56.8	7.5e-05
WP_000835342.1|1598149_1599028_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.1	5.8e-95
WP_000129924.1|1599128_1601108_+|head	phage head-binding domain-containing protein	head	A5VW57	Enterobacteria_phage	93.5	6.2e-60
WP_000178979.1|1601178_1603089_-	acyltransferase	NA	C6ZR20	Salmonella_phage	32.6	4.7e-57
WP_000958672.1|1603317_1604475_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.3e-221
1607729:1607745	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 5
NC_018658	Escherichia coli O104:H4 str. 2011C-3493, complete sequence	5273097	1838277	1847719	5273097		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569326.1|1838277_1839204_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1839208_1839940_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1839920_1840028_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1840087_1840819_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1841040_1842726_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1842722_1843442_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1843488_1843959_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1843999_1844461_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001351453.1|1844585_1846586_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292767.1|1846582_1847719_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 6
NC_018658	Escherichia coli O104:H4 str. 2011C-3493, complete sequence	5273097	2138299	2236700	5273097	tail,capsid,protease,tRNA,terminase,holin,portal,head	Enterobacteria_phage(35.71%)	113	NA	NA
WP_001025327.1|2138299_2140033_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001326063.1|2140248_2140815_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185740.1|2140828_2141575_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214304.1|2141962_2143063_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_000176815.1|2143087_2145517_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564745.1|2145682_2146654_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2146650_2147394_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|2147434_2147830_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_044713004.1|2147882_2148653_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000362003.1|2148634_2149945_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.4	3.0e-244
WP_000528718.1|2150000_2150237_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_001030156.1|2150245_2150392_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000457723.1|2150395_2150638_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_000628772.1|2150722_2151481_-	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.0	2.7e-109
WP_000065512.1|2151994_2152543_-	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	97.5	1.4e-59
WP_000476208.1|2152539_2152779_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	94.9	1.6e-34
WP_000111289.1|2152771_2152975_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_001242713.1|2152971_2153334_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_000008178.1|2153324_2153861_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_000081306.1|2153988_2154813_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
WP_000179185.1|2154878_2155241_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
WP_001387485.1|2155943_2156636_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
WP_001191669.1|2156733_2156994_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526669.1|2156986_2157544_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
WP_001087340.1|2157540_2158686_+	Rha family transcriptional regulator	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
WP_000620687.1|2158682_2158907_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
WP_000061508.1|2158903_2159722_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
WP_001387484.1|2159718_2160213_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
WP_000066917.1|2160212_2160866_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210143.1|2160862_2161189_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000767110.1|2161185_2161581_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072672.1|2161743_2162559_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.6	2.2e-149
WP_001390267.1|2162566_2163556_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.4e-193
WP_001205460.1|2163573_2163915_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131905.1|2163927_2164476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|2164462_2165389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|2165653_2165857_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000935520.1|2166008_2167058_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.4	3.1e-188
WP_000874354.1|2167849_2169703_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	90.6	0.0e+00
WP_000284510.1|2169853_2170069_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731196.1|2170073_2170880_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	99.6	4.8e-152
WP_000551290.1|2170889_2171204_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
WP_001092910.1|2171332_2171866_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	1.1e-101
WP_001151822.1|2172022_2172205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|2172219_2172351_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_071587457.1|2172573_2172759_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	9.9e-21
WP_000347013.1|2173171_2173312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|2173444_2173630_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000867568.1|2174024_2174573_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001390579.1|2174544_2176473_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
WP_000259002.1|2176456_2176663_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831738.1|2176659_2178252_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	4.2e-184
WP_001253924.1|2178241_2179747_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	3.0e-99
WP_000256823.1|2179783_2180131_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522601.1|2180188_2181217_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.1e-113
WP_000201501.1|2181268_2181652_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204556.1|2181644_2181998_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000975010.1|2182012_2182588_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
WP_000683079.1|2182584_2182980_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|2182987_2183740_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479035.1|2183753_2184176_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.1	1.1e-70
WP_000533444.1|2184202_2184616_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.2	2.1e-42
WP_000081813.1|2184596_2187209_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.1	0.0e+00
WP_000847379.1|2187205_2187535_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152522.1|2187534_2188233_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140762.1|2188237_2188981_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090891.1|2188917_2189550_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515718.1|2189610_2193006_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_001228314.1|2193073_2193673_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_001387718.1|2193824_2195363_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	92.2	8.8e-54
WP_000227779.1|2195371_2195980_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	44.7	2.2e-37
WP_071827722.1|2196122_2196383_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001217553.1|2196518_2196767_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000891610.1|2197121_2197688_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|2197997_2199770_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077221229.1|2199762_2200215_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|2200243_2200984_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|2201018_2201540_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024930.1|2201541_2202144_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|2202214_2202280_+	stress response small protein YobI	NA	NA	NA	NA	NA
WP_000580323.1|2202418_2203030_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|2203038_2204049_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|2204195_2204981_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|2204977_2205733_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|2205811_2206744_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|2206759_2208082_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|2208201_2209173_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091176.1|2209303_2210746_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056706.1|2210873_2211743_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301720.1|2212080_2213556_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001069467.1|2213790_2215602_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|2215638_2216280_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173474.1|2216335_2217514_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|2217647_2217938_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|2218004_2218361_+	protein YebF	NA	NA	NA	NA	NA
WP_000024745.1|2218687_2219347_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936951.1|2219555_2221616_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|2221612_2222275_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|2222298_2222955_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|2223056_2223287_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|2223425_2223800_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|2223803_2224676_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|2224688_2225030_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812712.1|2225425_2226082_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_001296140.1|2226082_2226274_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|2226378_2226615_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057022.1|2226732_2228172_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001297532.1|2228251_2230885_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207283.1|2230853_2232137_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|2232266_2232764_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431370.1|2232860_2233559_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001315679.1|2233578_2235627_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|2235818_2236700_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 7
NC_018658	Escherichia coli O104:H4 str. 2011C-3493, complete sequence	5273097	2337799	2396379	5273097	transposase,tail,head,capsid,plate,terminase,holin,portal,integrase,tRNA	Enterobacteria_phage(77.55%)	71	2348164:2348180	2400371:2400387
WP_000019456.1|2337799_2338780_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	2.0e-184
WP_001010722.1|2339045_2340437_-	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_001295408.1|2340569_2341160_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000106834.1|2341322_2341991_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_000222172.1|2342137_2342674_+	YniB family protein	NA	NA	NA	NA	NA
WP_000267645.1|2342714_2343575_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000146159.1|2343680_2343971_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000251735.1|2344071_2345001_-	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000771396.1|2345287_2346046_+	YdiY family protein	NA	NA	NA	NA	NA
WP_001142445.1|2346098_2346206_-	hypothetical protein	NA	NA	NA	NA	NA
2348164:2348180	attL	GAGCTGGCGCGCAAATT	NA	NA	NA	NA
WP_001144190.1|2348803_2350732_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
WP_001700733.1|2350735_2351278_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2351374_2351572_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2351624_2351981_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2352103_2352148_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|2352430_2353414_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672359.1|2353428_2355816_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2355820_2356120_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078916.1|2356421_2356562_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488099.1|2356752_2357013_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000019440.1|2357206_2358187_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000965749.1|2358531_2359614_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000132828.1|2359705_2360815_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	3.7e-195
WP_000005414.1|2360972_2362157_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
WP_000290443.1|2362156_2362669_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_000665305.1|2362723_2363089_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_000333498.1|2363097_2363253_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.3e-22
WP_001390260.1|2363239_2366047_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000979946.1|2366059_2366548_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954195.1|2366704_2367277_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144016.1|2367320_2367899_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_000108557.1|2367898_2370031_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	1.2e-130
WP_000071739.1|2370033_2370564_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111965.1|2370556_2371453_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_001067548.1|2371456_2371786_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001342219.1|2371803_2372370_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	2.5e-99
WP_000356370.1|2372381_2373017_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	5.3e-114
WP_000921128.1|2373009_2373477_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
WP_000202135.1|2373500_2375381_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.8e-301
WP_000780558.1|2375519_2375927_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.2e-63
WP_000072317.1|2375923_2376316_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
WP_000104350.1|2376312_2376636_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864897.1|2376638_2376839_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000063103.1|2376838_2377333_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632318.1|2377434_2378235_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_001055094.1|2378280_2379333_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_001262665.1|2379356_2380193_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.8e-149
WP_000613796.1|2380347_2382099_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_000087812.1|2382098_2383145_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000224219.1|2383656_2383920_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
WP_000201251.1|2383921_2384353_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
WP_000211292.1|2384372_2384687_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000686540.1|2384691_2385651_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.3e-180
WP_001272076.1|2385727_2388568_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.4	0.0e+00
WP_000564228.1|2388564_2388954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157847544.1|2388950_2389568_-	ash family protein	NA	S5MQL6	Escherichia_phage	49.4	1.5e-09
WP_000104300.1|2389579_2389879_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
WP_000153687.1|2389875_2390121_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	87.7	8.4e-36
WP_000985715.1|2390117_2390321_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	94.0	3.4e-30
WP_001038613.1|2390310_2390631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021658.1|2390719_2390833_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.4e-09
WP_000514277.1|2390829_2391072_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159452.1|2391083_2391371_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	2.7e-33
WP_000917807.1|2391381_2391720_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	2.2e-50
WP_000163908.1|2391734_2392013_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000094527.1|2392104_2392416_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_001247218.1|2392504_2393440_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.5	4.8e-79
WP_000416308.1|2393450_2393846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956518.1|2394035_2395016_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154183.1|2395078_2395630_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|2395629_2396379_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
2400371:2400387	attR	AATTTGCGCGCCAGCTC	NA	NA	NA	NA
>prophage 8
NC_018658	Escherichia coli O104:H4 str. 2011C-3493, complete sequence	5273097	2516028	2590661	5273097	tail,capsid,protease,lysis,terminase,holin,portal,integrase	Shigella_phage(43.48%)	85	2520132:2520149	2548182:2548199
WP_001260841.1|2516028_2516850_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2516949_2517033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2517125_2517461_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091806.1|2517857_2519111_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019532.1|2519217_2520111_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2520132:2520149	attL	CCCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000225276.1|2520245_2521466_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2521590_2522286_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071820512.1|2522301_2523531_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2523689_2524304_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2524346_2525201_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001387389.1|2525794_2526958_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
WP_000497813.1|2527219_2527471_-	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_000186868.1|2527518_2528199_-	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	98.2	1.5e-130
WP_000100829.1|2528195_2528981_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
WP_000995032.1|2528986_2529283_-	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_001271588.1|2529279_2531352_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	87.4	0.0e+00
WP_000660961.1|2531459_2531846_-	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
WP_000560214.1|2531929_2532151_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
WP_000189936.1|2532607_2532817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005963.1|2532785_2533145_-	hypothetical protein	NA	A0A088CBI5	Shigella_phage	72.6	2.3e-37
WP_000211196.1|2533176_2533890_-	hypothetical protein	NA	A0A088CC14	Shigella_phage	98.7	1.8e-126
WP_000198438.1|2533893_2534277_-	antitermination protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_000528776.1|2534771_2535548_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001074607.1|2535535_2536078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274758.1|2536124_2536838_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.6	4.1e-131
WP_000437871.1|2536938_2537139_+	Cro/Cl family transcriptional regulator	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_000438525.1|2537277_2537574_+	hypothetical protein	NA	A0A088CBI6	Shigella_phage	98.0	3.4e-47
WP_000438870.1|2537588_2537807_+	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_001390256.1|2537827_2538910_+	hypothetical protein	NA	V5URT9	Shigella_phage	96.4	2.8e-200
WP_000790392.1|2538916_2539657_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	87.4	2.3e-121
WP_000450864.1|2539682_2540453_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	8.1e-109
WP_001118163.1|2540468_2540864_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
WP_000206792.1|2540920_2541505_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278450.1|2541620_2541725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887482.1|2541913_2542126_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
WP_000119356.1|2542335_2542515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818160.1|2542533_2543019_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000042397.1|2543069_2543387_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000211990.1|2544093_2544765_+	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	82.6	9.0e-96
WP_001076834.1|2544819_2545230_+	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
WP_001254268.1|2545226_2545418_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	8.9e-25
WP_000002252.1|2545441_2545732_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
WP_001008115.1|2545728_2546091_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	98.3	9.2e-63
WP_000992060.1|2546090_2546285_+	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001204886.1|2546277_2546712_+	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
WP_000874468.1|2547477_2549388_+	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	74.8	6.4e-280
2548182:2548199	attR	CCCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000142783.1|2549526_2549709_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
WP_001290236.1|2549734_2549980_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000284506.1|2550056_2550272_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087450.1|2550276_2550810_+	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
WP_000675931.1|2551030_2551144_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001082713.1|2551145_2551604_+|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	99.3	6.4e-77
WP_000934362.1|2551684_2552266_-	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
WP_001086085.1|2552868_2553684_+|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
WP_001387707.1|2553664_2555371_+|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
WP_000787512.1|2555370_2557515_+|portal	portal protein	portal	A0A088CE71	Shigella_phage	99.6	0.0e+00
WP_000344999.1|2557672_2558680_+	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	93.4	1.2e-168
WP_000214480.1|2558702_2559917_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	99.0	1.8e-232
WP_001140435.1|2559971_2560361_+	hypothetical protein	NA	V5UT93	Shigella_phage	97.7	1.9e-61
WP_001290749.1|2560411_2560873_+	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	99.3	6.9e-71
WP_000829400.1|2560856_2561420_+	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
WP_000207910.1|2561419_2562070_+	hypothetical protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
WP_000117962.1|2562066_2563974_+|tail	tail fiber protein	tail	V5USF3	Shigella_phage	66.0	4.2e-82
WP_000537686.1|2564056_2564602_+	hypothetical protein	NA	A0A088CD67	Shigella_phage	99.4	2.0e-93
WP_000276176.1|2564614_2564842_+	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	98.7	2.6e-39
WP_001146337.1|2565182_2566808_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	96.7	0.0e+00
WP_000038927.1|2566804_2568073_+	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	94.3	1.6e-218
WP_000455633.1|2568087_2568366_+	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_001390575.1|2568371_2568989_+	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	6.3e-120
WP_000836186.1|2569068_2569806_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	80.8	1.2e-109
WP_000078908.1|2570040_2570181_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	97.8	2.0e-18
WP_001387532.1|2570237_2570639_+	hypothetical protein	NA	Q08J75	Stx2-converting_phage	98.5	5.0e-70
WP_000509022.1|2570730_2571387_+	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	99.1	7.4e-103
WP_000455643.1|2571389_2571836_+	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	100.0	4.0e-76
WP_000540395.1|2571845_2572097_+	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	97.5	7.9e-13
WP_000012439.1|2572107_2573373_+	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	95.0	1.5e-192
WP_000331660.1|2573441_2581793_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.8	0.0e+00
WP_000481378.1|2581916_2582192_+	hypothetical protein	NA	A0A088CD78	Shigella_phage	89.3	4.0e-18
WP_000628768.1|2582193_2582697_-	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	98.2	2.6e-95
WP_001290012.1|2583210_2584047_-	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	87.7	6.1e-126
WP_000020909.1|2584033_2584318_-	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	98.9	6.1e-46
WP_000763355.1|2584314_2584536_-	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	98.6	2.9e-35
WP_000184488.1|2584583_2585219_-	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	81.0	2.8e-91
WP_001342404.1|2585750_2588174_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000041536.1|2588234_2590661_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
>prophage 9
NC_018658	Escherichia coli O104:H4 str. 2011C-3493, complete sequence	5273097	2878509	2939977	5273097	tail,capsid,protease,terminase,holin,portal,integrase,head	Enterobacteria_phage(41.18%)	73	2923209:2923223	2944148:2944162
WP_000422045.1|2878509_2879559_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|2879778_2880537_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_001278904.1|2880533_2881124_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2881163_2882036_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2882136_2882757_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2882753_2883635_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001386774.1|2883772_2883817_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194599.1|2883908_2885471_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2885470_2887066_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983912.1|2887066_2888428_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000209520.1|2888439_2889633_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443069.1|2889632_2890439_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2890819_2890999_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2891084_2891585_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|2891630_2892137_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000251936.1|2892625_2892796_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000926528.1|2892910_2893180_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_000240999.1|2893236_2893905_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885576.1|2893959_2894544_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
WP_000216502.1|2894543_2897378_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	59.1	5.7e-83
WP_001228314.1|2897529_2898129_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_000515776.1|2898196_2901676_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001332187.1|2901742_2902081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090879.1|2902154_2902757_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000140761.1|2902693_2903437_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	1.8e-145
WP_001152522.1|2903441_2904140_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847379.1|2904139_2904469_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000082359.1|2904465_2907039_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_000533402.1|2907019_2907433_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|2907459_2907891_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000683079.1|2908662_2909058_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974999.1|2909054_2909630_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
WP_001204198.1|2909644_2909998_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_000201506.1|2909990_2910359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522596.1|2910410_2911439_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
WP_000256823.1|2911496_2911844_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_014966177.1|2911880_2913386_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.8e-99
WP_014966178.1|2913375_2914968_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_000259002.1|2914964_2915171_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001390573.1|2915154_2917083_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
WP_000867569.1|2917054_2917603_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000240372.1|2918003_2918408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343118.1|2918861_2919149_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
WP_001390467.1|2919227_2919380_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
WP_001228710.1|2919408_2919615_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	95.6	2.9e-29
WP_032159578.1|2919836_2919923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092853.1|2920477_2921011_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
WP_000731197.1|2921053_2921860_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	94.8	3.3e-145
WP_000284510.1|2921864_2922080_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874307.1|2922230_2924084_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
2923209:2923223	attL	ACCGTGTTCTTGTTT	NA	NA	NA	NA
WP_000871291.1|2924344_2924680_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001438304.1|2924960_2925092_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000935536.1|2925890_2926940_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_000917746.1|2927090_2927288_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	1.4e-28
WP_000762880.1|2927514_2928336_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904106.1|2928332_2928707_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.8e-36
WP_001265083.1|2928719_2929766_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.9e-110
WP_001329966.1|2929767_2930040_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|2930207_2930420_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|2930600_2931266_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151211.1|2931440_2931866_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000095671.1|2931906_2932869_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693888.1|2932891_2933317_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2933313_2933568_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2933647_2934067_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379548.1|2934363_2934516_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000394541.1|2934527_2934866_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_012601410.1|2934854_2935121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2935615_2935804_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2935800_2935992_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048530.1|2936084_2938556_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.2	1.8e-56
WP_000113189.1|2938620_2938869_+	excisionase	NA	NA	NA	NA	NA
WP_000113686.1|2938846_2939977_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	4.4e-103
2944148:2944162	attR	ACCGTGTTCTTGTTT	NA	NA	NA	NA
>prophage 10
NC_018658	Escherichia coli O104:H4 str. 2011C-3493, complete sequence	5273097	3225182	3316983	5273097	transposase,tail,capsid,lysis,terminase,bacteriocin,holin,portal,integrase	Escherichia_phage(88.16%)	95	3223719:3223736	3276961:3276978
3223719:3223736	attL	GAAAAACCTCTGCCTGCG	NA	NA	NA	NA
WP_000279857.1|3225182_3226400_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.7	6.5e-44
WP_000611858.1|3226947_3227934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627404.1|3227930_3228422_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_085948466.1|3228524_3229686_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000409841.1|3229727_3231086_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
WP_000287459.1|3231672_3234096_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_000945561.1|3234104_3236123_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000610451.1|3236115_3237441_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_001061095.1|3237442_3237856_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_000533522.1|3237905_3238694_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
WP_001199172.1|3239312_3240584_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154414.1|3240589_3241717_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|3241774_3242605_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018486.1|3243146_3244655_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|3244813_3245023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299828.1|3245077_3249040_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|3249079_3249718_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|3250005_3251097_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|3251096_3251789_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126777.1|3251800_3252187_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001307099.1|3252194_3252995_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001196.1|3253004_3253595_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028096.1|3253605_3254100_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_001326838.1|3254120_3255449_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001273658.1|3255531_3255705_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_000331685.1|3256636_3265018_-	hypothetical protein	NA	A0A0P0ZFK4	Escherichia_phage	100.0	0.0e+00
WP_000012452.1|3265087_3266353_-	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	100.0	2.4e-206
WP_000540391.1|3266363_3266615_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455649.1|3266624_3267071_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000509489.1|3267073_3267730_-	hypothetical protein	NA	A0A0P0ZGB7	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3267823_3268225_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3268281_3268422_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|3268654_3269389_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|3269479_3270097_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|3270102_3270381_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|3270395_3271664_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001391593.1|3271660_3273286_-	hypothetical protein	NA	A0A0P0ZG21	Escherichia_phage	100.0	0.0e+00
WP_000513231.1|3273519_3274032_-	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_000117967.1|3274118_3276311_-|tail	tail fiber protein	tail	A0A0H4IU95	Shigella_phage	98.0	1.9e-86
WP_000207927.1|3276307_3276958_-	hypothetical protein	NA	A0A0P0ZGL1	Escherichia_phage	100.0	4.6e-121
WP_000829200.1|3276957_3277521_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
3276961:3276978	attR	GAAAAACCTCTGCCTGCG	NA	NA	NA	NA
WP_001367376.1|3277504_3277966_-	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_001140442.1|3278015_3278405_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3278460_3279675_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3279698_3280706_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787034.1|3280863_3283008_-|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|3283007_3284714_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086073.1|3284694_3285501_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_001109019.1|3285793_3286345_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_024017835.1|3286547_3286985_-|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	100.0	1.4e-70
WP_000455397.1|3286987_3287137_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	100.0	4.8e-18
WP_001056879.1|3287136_3287706_-	hypothetical protein	NA	A0A0N7KZV8	Escherichia_phage	100.0	1.8e-105
WP_000087737.1|3287979_3288513_-	lysozyme	NA	A0A0P0ZGA2	Escherichia_phage	100.0	5.1e-102
WP_001072901.1|3288517_3288733_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|3288810_3289056_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3289096_3289276_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874432.1|3289412_3291350_-	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	100.0	0.0e+00
WP_000738068.1|3291835_3292105_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3292116_3293076_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|3293458_3293611_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|3293859_3294294_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|3294286_3294481_-	phage NinH family protein	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|3294477_3295041_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|3295048_3295498_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001260358.1|3295497_3296469_-	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000913116.1|3296458_3297979_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001271433.1|3297972_3298350_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001369601.1|3298516_3298711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|3298881_3299085_-	Cro/Cl family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|3299180_3299894_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939558.1|3299988_3301458_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001064714.1|3301454_3302408_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_016051777.1|3303024_3303810_+	Rha family transcriptional regulator	NA	A0A0P0ZG86	Escherichia_phage	100.0	9.4e-145
WP_001369605.1|3304065_3304740_+	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_000917252.1|3304810_3305023_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_000934197.1|3305034_3305316_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000995345.1|3305336_3305618_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000459721.1|3305634_3306585_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000187063.1|3306581_3307271_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344637.1|3307270_3307858_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_001071603.1|3307932_3308280_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|3308343_3309165_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001159715.1|3309241_3309637_+	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_000206047.1|3309787_3310513_+	ead/Ea22-like family protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
WP_000034212.1|3310509_3310917_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|3310918_3311110_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000206786.1|3311112_3312009_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
WP_000203831.1|3312364_3313003_+	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	100.0	4.2e-119
WP_000809302.1|3313058_3313490_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163446.1|3313486_3314113_+	adenine methylase	NA	A0A0P0ZG10	Escherichia_phage	100.0	8.0e-123
WP_001291842.1|3314072_3314285_+	DUF1382 family protein	NA	A0A0P0ZG72	Escherichia_phage	100.0	2.7e-30
WP_000994790.1|3314320_3314674_+	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	100.0	3.5e-59
WP_000497815.1|3315038_3315290_+	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	100.0	8.4e-39
WP_001208773.1|3315335_3315620_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013658.1|3315672_3316983_+	DUF3596 domain-containing protein	NA	A0A0P0ZGA8	Escherichia_phage	100.0	9.2e-254
>prophage 11
NC_018658	Escherichia coli O104:H4 str. 2011C-3493, complete sequence	5273097	3527799	3624335	5273097	transposase,tail,capsid,lysis,portal,integrase,head	Enterobacteria_phage(44.62%)	107	3554083:3554117	3625769:3625803
WP_000399648.1|3527799_3528780_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000961458.1|3529058_3530651_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_001056384.1|3530869_3531790_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000056442.1|3531848_3532967_-	anion transporter	NA	NA	NA	NA	NA
WP_000091016.1|3532963_3533431_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_001001761.1|3533616_3533745_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001054697.1|3534016_3535600_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001295296.1|3535648_3536164_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|3536216_3536282_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|3536516_3537404_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|3537702_3538206_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|3538609_3539356_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|3539494_3540154_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|3540150_3540873_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001267242.1|3540989_3543215_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001387659.1|3543211_3544138_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_001387658.1|3544413_3544674_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430039.1|3544938_3547221_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990161.1|3547262_3547940_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	3.1e-19
WP_000146343.1|3548013_3548280_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|3548544_3548805_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443512.1|3549033_3550119_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386540.1|3550259_3551222_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|3551249_3553400_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145128.1|3553519_3554002_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
3554083:3554117	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000007101.1|3554233_3555598_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|3555826_3556498_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|3556500_3557496_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|3557488_3559225_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000070131.1|3559217_3560351_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|3560361_3561468_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|3561429_3561840_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_001113348.1|3561972_3562734_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|3562730_3563972_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045450.1|3563971_3564928_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_001088647.1|3564963_3565677_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_001331162.1|3565746_3566394_-	Bax inhibitor-1 family protein	NA	NA	NA	NA	NA
WP_000373624.1|3566595_3567300_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|3567436_3567889_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598616.1|3567890_3568136_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|3568128_3568614_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084632.1|3568616_3569129_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|3569150_3570140_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|3570536_3571445_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|3571636_3573658_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|3574236_3574914_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|3574906_3575662_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118840.1|3575648_3576803_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|3576799_3577840_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001307065.1|3577926_3579216_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|3579274_3579751_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000586343.1|3580496_3581828_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
WP_000885623.1|3581901_3582486_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	9.2e-105
WP_001387657.1|3582485_3585560_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001233090.1|3585624_3586224_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_000515639.1|3586294_3589792_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_000090917.1|3589852_3590485_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000140717.1|3590421_3591165_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
WP_001152576.1|3591170_3591869_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_000847391.1|3591868_3592198_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	90.8	8.7e-52
WP_014966180.1|3592194_3594756_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.7	0.0e+00
WP_000459457.1|3594748_3595183_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479200.1|3595164_3595587_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
WP_001390429.1|3595602_3596343_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000683129.1|3596350_3596746_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975081.1|3596742_3597321_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|3597332_3597686_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|3597697_3598093_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063238.1|3598134_3599160_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_001299443.1|3599215_3599548_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123216.1|3599557_3600877_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
WP_001316944.1|3600857_3602459_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000198149.1|3602455_3602662_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000453580.1|3604557_3605103_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_000105084.1|3605491_3605725_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3605781_3606192_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001028465.1|3606541_3607063_-	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000092234.1|3607267_3607705_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001135297.1|3607701_3608199_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000839596.1|3608198_3608414_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737263.1|3609002_3610085_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_001204791.1|3610273_3610657_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|3610742_3610883_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_000774504.1|3611237_3611528_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224912.1|3611520_3611691_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_001053034.1|3611690_3612146_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_072147432.1|3612142_3612244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001391403.1|3612340_3612592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338663.1|3613168_3613408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145901.1|3614559_3614862_-	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_000788812.1|3614858_3615560_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000147903.1|3615556_3616576_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	9.7e-110
WP_001182903.1|3616572_3617112_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|3617181_3617412_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3617517_3618207_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|3618804_3619011_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995433.1|3619086_3619383_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|3619388_3620174_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|3620170_3620851_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682318.1|3620847_3621030_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548541.1|3621002_3621194_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	4.7e-26
WP_000188870.1|3621270_3621486_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763367.1|3621584_3621806_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000120064.1|3622016_3622619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3622861_3623029_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3623068_3623287_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533642.1|3623264_3624335_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
3625769:3625803	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 12
NC_018658	Escherichia coli O104:H4 str. 2011C-3493, complete sequence	5273097	4142577	4198882	5273097	integrase,plate	Enterobacteria_phage(27.27%)	54	4143958:4143977	4156918:4156937
WP_000772650.1|4142577_4143792_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.7	8.8e-134
4143958:4143977	attL	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_001269640.1|4144119_4145397_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001240678.1|4145477_4146155_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	51.8	8.6e-46
WP_000891726.1|4146202_4148044_-	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.5	1.9e-18
WP_001387927.1|4148078_4148276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999102.1|4148427_4149459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013184.1|4149473_4149857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807036.1|4149861_4150059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390662.1|4151049_4151349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000580786.1|4151348_4151552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532776.1|4151609_4151993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221926.1|4152090_4152360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000594462.1|4152369_4153038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296967.1|4153185_4153368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273869.1|4155042_4155594_+	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	3.2e-30
WP_000550450.1|4155934_4156093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788776.1|4156159_4156312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000893256.1|4157108_4158362_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.3e-95
4156918:4156937	attR	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_001285288.1|4158373_4159477_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749877.1|4159764_4160820_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.2e-117
WP_000174677.1|4160858_4161260_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|4161317_4162562_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4162653_4163112_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293014.1|4163372_4164830_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602103.1|4164886_4165501_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_000528869.1|4165497_4166637_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.0e-31
WP_001059855.1|4166882_4167335_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226164.1|4167331_4168387_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207574.1|4168457_4169243_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001386594.1|4169187_4170927_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000598758.1|4171031_4171310_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030484.1|4171302_4171659_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000543895.1|4171715_4172489_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|4172674_4172935_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615974.1|4172937_4173216_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4173371_4174112_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4174082_4174850_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4175055_4175634_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973081.1|4175873_4178318_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4178360_4178834_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118029.1|4178987_4179758_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_122985282.1|4182245_4182431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939262.1|4182345_4182828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103304.1|4186550_4188692_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	3.7e-26
WP_001142958.1|4188901_4189420_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037389.1|4190116_4190617_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4190651_4190876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|4190926_4192402_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611748.1|4192408_4192822_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393853.1|4192825_4194676_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4194639_4195722_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|4195746_4197027_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4197023_4197548_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246421.1|4197550_4198882_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 13
NC_018658	Escherichia coli O104:H4 str. 2011C-3493, complete sequence	5273097	4515547	4579544	5273097	transposase,holin	Stx2-converting_phage(33.33%)	59	NA	NA
WP_000181142.1|4515547_4516504_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.5	2.7e-61
WP_001137018.1|4516970_4518203_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001037377.1|4518243_4519524_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001298930.1|4519639_4520791_+	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_000222495.1|4520800_4521568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000657676.1|4521564_4521822_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_001298932.1|4521886_4522747_+	YjiK family protein	NA	NA	NA	NA	NA
WP_001141192.1|4522814_4523993_+	MFS transporter	NA	NA	NA	NA	NA
WP_001151854.1|4524005_4524560_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
WP_001295597.1|4524809_4525493_+	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_000211971.1|4525489_4525951_+	YjiG family protein	NA	NA	NA	NA	NA
WP_000568407.1|4525963_4527136_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000340758.1|4527200_4528112_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000986215.1|4528104_4528497_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_120795393.1|4528493_4528577_-	iraD leader peptide IdlP	NA	NA	NA	NA	NA
WP_000062571.1|4529168_4529999_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000833686.1|4530139_4530913_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000208220.1|4531127_4532588_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	3.6e-49
WP_000438591.1|4532668_4533853_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000558251.1|4534192_4535536_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_000250224.1|4536642_4537320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329788.1|4538151_4538349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813456.1|4538520_4539123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235221.1|4539217_4539424_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840367.1|4539564_4539831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000221544.1|4541048_4541618_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270971.1|4541877_4542279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221614.1|4542266_4542701_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001390365.1|4543055_4543436_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	3.9e-64
WP_000612591.1|4543432_4543780_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_014966184.1|4543829_4545215_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	2.9e-258
WP_000823241.1|4545453_4546812_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|4547562_4547820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4548737_4549259_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|4549255_4550209_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188245.1|4550295_4552620_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879153.1|4552664_4553567_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125175.1|4553563_4554562_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|4554558_4555515_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4555515_4556283_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4556840_4557098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189126.1|4557748_4559257_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_160371899.1|4560832_4561675_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001388979.1|4561677_4562766_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_001387303.1|4562770_4563721_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_001390363.1|4563785_4564730_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000088357.1|4564910_4566050_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
WP_001293435.1|4566203_4568201_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625669.1|4568263_4569541_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145474.1|4569786_4570443_+	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001422798.1|4570623_4570752_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000422741.1|4570890_4571316_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4571312_4571663_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|4571693_4573307_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_001295538.1|4574490_4575273_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|4575578_4576499_+	ribokinase	NA	NA	NA	NA	NA
WP_000998350.1|4576526_4577843_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107474.1|4577854_4578868_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_001327567.1|4579289_4579544_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
>prophage 14
NC_018658	Escherichia coli O104:H4 str. 2011C-3493, complete sequence	5273097	4637975	4696519	5273097	transposase,protease	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4637975_4639328_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4639421_4639973_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219816.1|4640123_4641497_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|4641672_4642671_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595979.1|4642703_4643699_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001387274.1|4643685_4644708_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205794.1|4644721_4646224_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|4646533_4647490_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|4647799_4648330_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000239579.1|4648409_4648760_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223208.1|4648753_4649005_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4649216_4649558_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060946.1|4649560_4653340_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4653336_4655070_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|4655275_4655914_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935042.1|4656236_4657580_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4657641_4657848_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175289.1|4658172_4658730_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|4658719_4659460_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589423.1|4659649_4661593_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4661721_4662102_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560563.1|4662190_4663051_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001296686.1|4663158_4664124_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|4664231_4664894_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4664938_4666351_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4666659_4667280_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|4667498_4668137_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826425.1|4668271_4669480_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_000604912.1|4669487_4669919_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001351393.1|4670541_4671336_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4671406_4671856_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4671897_4672125_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4672129_4672444_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4672450_4672846_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4673172_4673448_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000996728.1|4673522_4674074_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4674170_4674857_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949539.1|4674856_4675711_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4675720_4676371_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776505.1|4676384_4676849_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4676858_4677164_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001300695.1|4677179_4678577_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4678931_4679996_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4680103_4680859_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569708.1|4680855_4681605_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4681786_4682116_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4682264_4682540_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001339483.1|4682656_4684282_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943976.1|4684365_4685529_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.3e-81
WP_000101644.1|4685531_4686170_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|4686595_4687255_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|4687305_4688004_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|4688022_4688424_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4688550_4689282_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|4689461_4691903_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|4691941_4692367_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4692571_4693870_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4693973_4694171_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4694252_4695257_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312490.1|4695259_4696519_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 1
NC_018666	Escherichia coli O104:H4 str. 2011C-3493 plasmid pAA-EA11, complete sequence	74217	38617	45571	74217	transposase	Stx2-converting_phage(57.14%)	8	NA	NA
WP_000019440.1|38617_39598_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_001339397.1|40325_41003_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|41002_41350_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381397.1|41369_42941_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_000624689.1|43253_43550_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.4	3.4e-31
WP_001387845.1|43546_43981_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	3.4e-19
WP_000139330.1|44209_44770_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205736.1|44824_45571_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
>prophage 1
NC_018659	Escherichia coli O104:H4 str. 2011C-3493 plasmid pESBL-EA11, complete sequence	88544	45167	55465	88544	transposase	Salmonella_phage(22.22%)	12	NA	NA
WP_000239590.1|45167_46043_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|46298_47561_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|48124_48682_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|48864_49725_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001245884.1|49993_50296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587689.1|50292_50919_-	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_000457515.1|51122_52394_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	2.2e-143
WP_000109071.1|52393_52831_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|52827_53076_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_023383827.1|53494_54397_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_001310011.1|54393_54705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086153.1|54781_55465_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	5.1e-30
