The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018650	Escherichia coli O104:H4 str. 2009EL-2050, complete sequence	5253138	69549	93470	5253138	transposase,integrase	Escherichia_phage(36.36%)	25	84639:84698	89892:90712
WP_000844627.1|69549_69792_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000429836.1|70794_71229_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|71300_71651_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|71664_71940_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|71975_72398_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|72449_74144_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|74161_74524_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|74520_74757_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|74792_75461_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|76844_77549_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|77609_78446_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|78445_79249_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|79309_80125_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|80432_81284_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|82039_82744_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|83341_84202_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
84639:84698	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|84701_85406_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000454193.1|85602_85953_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|86155_87169_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000703418.1|87326_87800_+	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000679427.1|88029_88377_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259029.1|88370_89150_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_001067855.1|89183_89888_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001137316.1|89946_90501_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|90503_93470_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
89892:90712	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGCGCATTGGGTATATCAGGGTCAGCACCTTCGACCAGAACCCGGAACGGCAACTGGAAGGCGTCAAGGTTGATCGCGCTTTTAGCGACAAGGCATCCGGCAAGGATGTCAAGCGTCCGCAACTGGAAGCGCTGATAAGCTTCGCCCGCACCGGCGACACCGTGGTGGTGCATAGCATGGATCGCCTGGCGCGCAATCTCGATGATTTGCGCCGGATCGTGCAAACGCTGACACAACGCGGCGTGCATATCGAATTCGTCAAGGAACACCTCAGTTTTACTGGCGAAGACTCTCCGATGGCGAACCTGATGCTCTCGGTGATGGGCGCGTTCGCCGAGTTCGAGCGCGCCCTGATCCGCGAGCGTCAGCGCGAGGGTATTGCGCTCGCCAAGCAACGCGGGGCTTACCGTGGCAGGAAGAAATCCCTGTCGTCTGAGCGTATTGCCGAACTGCGCCAACGTGTCGAGGCTGGCGAGCAAAAGACCAAGCTTGCTCGTGAATTCGGAATCAGTCGCGAAACCCTGTATCAATACTTGAGAACGGATCAGTAAATATGCCACGTCGTTCCATCCTGTCCGCCGCCGAGCGGGAAAGCCTGCTGGCGTTGCCGGACTCCAAGGACGACCTGATCCGACATTACACATTCAACGATACCGACCTCTCGATCATCCGACAGCGGCGCGGGCCAGCCAATCGGCTGGGCTTCGCGGTGCAGCTCTGTTACCTGCGCTTTCCCGGCGTCATCCTGGGCGTCGATGAACT	NA	NA	NA	NA
>prophage 2
NC_018650	Escherichia coli O104:H4 str. 2009EL-2050, complete sequence	5253138	895198	920231	5253138	plate,transposase	Escherichia_phage(50.0%)	16	NA	NA
WP_001390300.1|895198_897001_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001173975.1|896991_897924_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000198270.1|897936_899919_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	35.6	2.2e-12
WP_000005080.1|899929_900397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001390299.1|900406_900706_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_001033155.1|900709_901786_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000152746.1|901793_902345_+	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001154665.1|902363_903776_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001028113.1|904114_904705_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000914956.1|904710_908115_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000029846.1|908118_910668_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.8	4.6e-92
WP_000587872.1|913833_914400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359994.1|914878_916033_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000555380.1|917347_918481_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077577697.1|918520_918883_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
WP_000019440.1|919250_920231_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
>prophage 3
NC_018650	Escherichia coli O104:H4 str. 2009EL-2050, complete sequence	5253138	1208787	1215927	5253138		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1208787_1209426_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1209422_1210685_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1210681_1211590_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1211785_1212553_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141316.1|1212603_1213260_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
WP_001272924.1|1213365_1215927_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 4
NC_018650	Escherichia coli O104:H4 str. 2009EL-2050, complete sequence	5253138	1576530	1590353	5253138	protease	Enterobacteria_phage(66.67%)	17	NA	NA
WP_000194515.1|1576530_1577964_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274887.1|1578179_1579094_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197025.1|1579165_1580413_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|1580942_1581143_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001277767.1|1581274_1581454_-	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_000208008.1|1581550_1582180_-	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	58.6	1.1e-55
WP_000951713.1|1582176_1582386_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000034245.1|1582748_1583420_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	73.2	3.0e-83
WP_001214454.1|1583416_1583584_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_032159494.1|1583580_1583862_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	9.7e-44
WP_001111297.1|1583881_1584178_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	98.0	1.9e-50
WP_000951329.1|1584201_1584585_-	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	1.2e-65
WP_000031367.1|1584584_1585190_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_000050554.1|1585200_1585371_-	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_001243355.1|1585446_1585599_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|1585583_1585715_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_000178979.1|1588442_1590353_-	acyltransferase	NA	C6ZR20	Salmonella_phage	32.6	4.7e-57
>prophage 5
NC_018650	Escherichia coli O104:H4 str. 2009EL-2050, complete sequence	5253138	1825541	1834983	5253138		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569326.1|1825541_1826468_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1826472_1827204_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1827184_1827292_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1827351_1828083_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1828304_1829990_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1829986_1830706_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1830752_1831223_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1831263_1831725_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001351453.1|1831849_1833850_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292767.1|1833846_1834983_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 6
NC_018650	Escherichia coli O104:H4 str. 2009EL-2050, complete sequence	5253138	2126339	2227333	5253138	transposase,protease,tRNA,capsid,tail,portal,head,lysis,holin,terminase	Enterobacteria_phage(43.28%)	110	NA	NA
WP_001025327.1|2126339_2128073_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001326063.1|2128288_2128855_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185740.1|2128868_2129615_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214304.1|2130002_2131103_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_000176815.1|2131127_2133557_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000399648.1|2133826_2134807_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000564745.1|2135000_2135972_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2135968_2136712_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|2136752_2137148_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_044713004.1|2137200_2137971_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000362003.1|2137952_2139263_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.4	3.0e-244
WP_000528718.1|2139318_2139555_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_001030156.1|2139563_2139710_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000457723.1|2139713_2139956_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_000628772.1|2140040_2140799_-	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.0	2.7e-109
WP_000065512.1|2141312_2141861_-	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	97.5	1.4e-59
WP_000476207.1|2141857_2142097_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	9.1e-35
WP_000111289.1|2142089_2142293_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_001242713.1|2142289_2142652_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_000008178.1|2142642_2143179_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_000081306.1|2143306_2144131_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
WP_000179185.1|2144196_2144559_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
WP_001387485.1|2145261_2145954_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
WP_001191669.1|2146051_2146312_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526669.1|2146304_2146862_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
WP_001087340.1|2146858_2148004_+	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
WP_000620687.1|2148000_2148225_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
WP_000061508.1|2148221_2149040_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
WP_001387484.1|2149036_2149531_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
WP_000066917.1|2149530_2150184_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210143.1|2150180_2150507_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000767110.1|2150503_2150899_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072669.1|2151061_2151877_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001358491.1|2151884_2152874_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001205470.1|2152891_2153248_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_000150292.1|2153227_2154442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355468.1|2154444_2155620_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000917745.1|2155886_2156084_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	3.4e-27
WP_000301785.1|2156218_2156932_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874454.1|2157698_2159660_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.2	3.9e-240
WP_000142785.1|2159795_2159990_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	9.4e-22
WP_001289722.1|2160015_2160285_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	74.2	8.2e-08
WP_000284510.1|2160360_2160576_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731267.1|2160580_2160925_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
WP_001092883.1|2160975_2161509_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_001082546.1|2161807_2162275_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.4e-78
WP_000347013.1|2162625_2162766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015674556.1|2162898_2163084_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	81.4	4.1e-19
WP_000867568.1|2163478_2164027_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000259002.1|2165911_2166118_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831738.1|2166114_2167707_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	4.2e-184
WP_001254006.1|2167696_2169202_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
WP_000256796.1|2169238_2169586_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522645.1|2169643_2170672_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	1.1e-113
WP_001390684.1|2170724_2171093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204567.1|2171085_2171439_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000975015.1|2171454_2172033_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	90.6	4.9e-74
WP_000683112.1|2172029_2172425_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_001401350.1|2172432_2173173_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
WP_000479153.1|2173188_2173611_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459468.1|2173592_2174027_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.7e-63
WP_000847379.1|2176578_2176908_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152493.1|2176907_2177606_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.8e-132
WP_000194780.1|2177610_2178354_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|2178290_2178923_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515636.1|2178983_2182463_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001580506.1|2182530_2183130_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	1.0e-106
WP_000216489.1|2183281_2186452_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	59.1	1.3e-83
WP_000885566.1|2186451_2187036_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	4.3e-102
WP_001217553.1|2187151_2187400_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000891610.1|2187754_2188321_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|2188630_2190403_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077221229.1|2190395_2190848_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|2190876_2191617_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|2191651_2192173_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024930.1|2192174_2192777_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|2192847_2192913_+	stress response small protein YobI	NA	NA	NA	NA	NA
WP_000580323.1|2193051_2193663_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|2193671_2194682_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|2194828_2195614_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|2195610_2196366_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|2196444_2197377_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|2197392_2198715_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|2198834_2199806_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091176.1|2199936_2201379_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056706.1|2201506_2202376_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301720.1|2202713_2204189_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001069467.1|2204423_2206235_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|2206271_2206913_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173474.1|2206968_2208147_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|2208280_2208571_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|2208637_2208994_+	protein YebF	NA	NA	NA	NA	NA
WP_000024745.1|2209320_2209980_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936951.1|2210188_2212249_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|2212245_2212908_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|2212931_2213588_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|2213689_2213920_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|2214058_2214433_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|2214436_2215309_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976472.1|2215321_2215663_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812712.1|2216058_2216715_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_001296140.1|2216715_2216907_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|2217011_2217248_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057022.1|2217365_2218805_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001297532.1|2218884_2221518_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207283.1|2221486_2222770_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|2222899_2223397_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431370.1|2223493_2224192_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001315679.1|2224211_2226260_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|2226451_2227333_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 7
NC_018650	Escherichia coli O104:H4 str. 2009EL-2050, complete sequence	5253138	2296709	2385813	5253138	transposase,tRNA,capsid,tail,plate,portal,head,holin,integrase,terminase	Enterobacteria_phage(73.08%)	103	2289949:2289965	2385005:2385021
2289949:2289965	attL	TCTTCCGGCGTCATATC	NA	NA	NA	NA
WP_000019440.1|2296709_2297690_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000373043.1|2298492_2299836_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000085233.1|2300071_2300344_+	YnjH family protein	NA	NA	NA	NA	NA
WP_000781892.1|2300309_2300717_-	CTP pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_001307237.1|2300803_2301424_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_001351355.1|2301432_2302740_-	thiosulfate sulfurtransferase YnjE	NA	NA	NA	NA	NA
WP_000882826.1|2302806_2303460_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.7	3.3e-10
WP_000258524.1|2303459_2304995_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001215298.1|2304967_2306134_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000524080.1|2306143_2306692_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000977124.1|2306691_2307399_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_000077942.1|2307412_2308090_-	protein YdjY	NA	NA	NA	NA	NA
WP_001351354.1|2308094_2308805_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_000673924.1|2308971_2309778_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_000082041.1|2310223_2311444_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.5e-27
WP_000989416.1|2311440_2312475_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_000177212.1|2312471_2313950_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000995007.1|2313946_2315290_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_000368485.1|2315282_2316251_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_001228991.1|2316580_2317066_+	ATP-independent periplasmic protein-refolding chaperone	NA	NA	NA	NA	NA
WP_001351353.1|2317268_2317844_+	environmental stress-induced protein Ves	NA	NA	NA	NA	NA
WP_000252388.1|2317803_2318691_-	excinuclease Cho	NA	NA	NA	NA	NA
WP_000175037.1|2318920_2319748_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
WP_001039044.1|2319949_2320288_+	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_000412169.1|2320586_2320907_+	PTS N,N'-diacetylchitobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_000073041.1|2320991_2322350_+	PTS N,N'-diacetylchitobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000968911.1|2322400_2322751_+	PTS N,N'-diacetylchitobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000983653.1|2322758_2323601_+	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_000078722.1|2323705_2325058_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_000440450.1|2325070_2325829_+	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_000077825.1|2325875_2328137_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	2.3e-143
WP_001241561.1|2328319_2328583_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_001326040.1|2328859_2329228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183004.1|2329237_2329675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001010722.1|2329678_2331070_-	cystine/sulfocysteine:cation symporter	NA	NA	NA	NA	NA
WP_001295408.1|2331202_2331793_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000106834.1|2331955_2332624_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_000222172.1|2332770_2333307_+	YniB family protein	NA	NA	NA	NA	NA
WP_000267645.1|2333347_2334208_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000146159.1|2334313_2334604_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000251735.1|2334704_2335634_-	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000771396.1|2335920_2336679_+	YdiY family protein	NA	NA	NA	NA	NA
WP_001142445.1|2336731_2336839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144190.1|2339436_2341365_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
WP_001700733.1|2341368_2341911_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2342007_2342205_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2342257_2342614_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2342736_2342781_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|2343063_2344047_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672359.1|2344061_2346449_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2346453_2346753_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078916.1|2347054_2347195_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488099.1|2347385_2347646_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000965749.1|2347965_2349048_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000132828.1|2349139_2350249_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	3.7e-195
WP_000005414.1|2350406_2351591_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
WP_000290443.1|2351590_2352103_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_000665305.1|2352157_2352523_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_000333498.1|2352531_2352687_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.3e-22
WP_001390260.1|2352673_2355481_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000979946.1|2355493_2355982_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954195.1|2356138_2356711_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144016.1|2356754_2357333_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_000108557.1|2357332_2359465_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	1.2e-130
WP_000071739.1|2359467_2359998_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111965.1|2359990_2360887_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_001067548.1|2360890_2361220_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001342219.1|2361237_2361804_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	2.5e-99
WP_000356370.1|2361815_2362451_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	5.3e-114
WP_000921128.1|2362443_2362911_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
WP_000202135.1|2362934_2364815_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.8e-301
WP_000780558.1|2364953_2365361_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.2e-63
WP_000072317.1|2365357_2365750_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
WP_000104350.1|2365746_2366070_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864897.1|2366072_2366273_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000063103.1|2366272_2366767_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632318.1|2366868_2367669_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_001055094.1|2367714_2368767_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_001262665.1|2368790_2369627_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.8e-149
WP_000613796.1|2369781_2371533_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_000087812.1|2371532_2372579_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000224219.1|2373090_2373354_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
WP_000201251.1|2373355_2373787_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
WP_000211292.1|2373806_2374121_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000686540.1|2374125_2375085_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.3e-180
WP_001272076.1|2375161_2378002_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.4	0.0e+00
WP_000564228.1|2377998_2378388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157847544.1|2378384_2379002_-	ash family protein	NA	S5MQL6	Escherichia_phage	49.4	1.5e-09
WP_000104300.1|2379013_2379313_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
WP_000153687.1|2379309_2379555_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	87.7	8.4e-36
WP_000985715.1|2379551_2379755_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	94.0	3.4e-30
WP_001038613.1|2379744_2380065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021658.1|2380153_2380267_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.4e-09
WP_000514277.1|2380263_2380506_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159452.1|2380517_2380805_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	2.7e-33
WP_000917807.1|2380815_2381154_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	2.2e-50
WP_000163908.1|2381168_2381447_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000094527.1|2381538_2381850_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_001247218.1|2381938_2382874_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.5	4.8e-79
WP_000416308.1|2382884_2383280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956518.1|2383469_2384450_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154183.1|2384512_2385064_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
2385005:2385021	attR	GATATGACGCCGGAAGA	NA	NA	NA	NA
WP_000029466.1|2385063_2385813_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
>prophage 8
NC_018650	Escherichia coli O104:H4 str. 2009EL-2050, complete sequence	5253138	2505557	2580190	5253138	protease,capsid,portal,tail,lysis,holin,integrase,terminase	Shigella_phage(43.48%)	85	2509661:2509678	2537711:2537728
WP_001260841.1|2505557_2506379_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2506478_2506562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2506654_2506990_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091806.1|2507386_2508640_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019532.1|2508746_2509640_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2509661:2509678	attL	CCCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000225276.1|2509774_2510995_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2511119_2511815_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071820512.1|2511830_2513060_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2513218_2513833_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2513875_2514730_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001387389.1|2515323_2516487_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
WP_000497813.1|2516748_2517000_-	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_000186868.1|2517047_2517728_-	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	98.2	1.5e-130
WP_000100829.1|2517724_2518510_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
WP_000995032.1|2518515_2518812_-	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_001271588.1|2518808_2520881_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	87.4	0.0e+00
WP_000660961.1|2520988_2521375_-	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
WP_000560214.1|2521458_2521680_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
WP_000189936.1|2522136_2522346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005963.1|2522314_2522674_-	hypothetical protein	NA	A0A088CBI5	Shigella_phage	72.6	2.3e-37
WP_000211196.1|2522705_2523419_-	hypothetical protein	NA	A0A088CC14	Shigella_phage	98.7	1.8e-126
WP_000198438.1|2523422_2523806_-	antitermination protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
WP_000528776.1|2524300_2525077_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001074607.1|2525064_2525607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274758.1|2525653_2526367_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.6	4.1e-131
WP_000437871.1|2526467_2526668_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_000438525.1|2526806_2527103_+	hypothetical protein	NA	A0A088CBI6	Shigella_phage	98.0	3.4e-47
WP_000438870.1|2527117_2527336_+	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_001390256.1|2527356_2528439_+	hypothetical protein	NA	V5URT9	Shigella_phage	96.4	2.8e-200
WP_000790392.1|2528445_2529186_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	87.4	2.3e-121
WP_000450864.1|2529211_2529982_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	8.1e-109
WP_001118163.1|2529997_2530393_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
WP_000206792.1|2530449_2531034_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278450.1|2531149_2531254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887482.1|2531442_2531655_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
WP_000119356.1|2531864_2532044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818160.1|2532062_2532548_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000042397.1|2532598_2532916_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000211990.1|2533622_2534294_+	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	82.6	9.0e-96
WP_001076834.1|2534348_2534759_+	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
WP_001254268.1|2534755_2534947_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	8.9e-25
WP_000002252.1|2534970_2535261_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
WP_001008115.1|2535257_2535620_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	98.3	9.2e-63
WP_000992060.1|2535619_2535814_+	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001204886.1|2535806_2536241_+	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
WP_000874468.1|2537006_2538917_+	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	74.8	6.4e-280
2537711:2537728	attR	CCCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000142783.1|2539055_2539238_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
WP_001290236.1|2539263_2539509_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
WP_000284506.1|2539585_2539801_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087450.1|2539805_2540339_+	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
WP_000675931.1|2540559_2540673_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001082713.1|2540674_2541133_+|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	99.3	6.4e-77
WP_000934362.1|2541213_2541795_-	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
WP_001086085.1|2542397_2543213_+|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
WP_001387707.1|2543193_2544900_+|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
WP_000787512.1|2544899_2547044_+|portal	portal protein	portal	A0A088CE71	Shigella_phage	99.6	0.0e+00
WP_000344999.1|2547201_2548209_+	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	93.4	1.2e-168
WP_000214480.1|2548231_2549446_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	99.0	1.8e-232
WP_001140435.1|2549500_2549890_+	hypothetical protein	NA	V5UT93	Shigella_phage	97.7	1.9e-61
WP_001290749.1|2549940_2550402_+	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	99.3	6.9e-71
WP_000829400.1|2550385_2550949_+	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
WP_000207910.1|2550948_2551599_+	hypothetical protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
WP_000117962.1|2551595_2553503_+|tail	tail fiber protein	tail	V5USF3	Shigella_phage	66.0	4.2e-82
WP_000537686.1|2553585_2554131_+	hypothetical protein	NA	A0A088CD67	Shigella_phage	99.4	2.0e-93
WP_000276176.1|2554143_2554371_+	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	98.7	2.6e-39
WP_001146337.1|2554711_2556337_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	96.7	0.0e+00
WP_000038927.1|2556333_2557602_+	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	94.3	1.6e-218
WP_000455633.1|2557616_2557895_+	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_001390575.1|2557900_2558518_+	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	6.3e-120
WP_000836186.1|2558597_2559335_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	80.8	1.2e-109
WP_000078908.1|2559569_2559710_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	97.8	2.0e-18
WP_001387532.1|2559766_2560168_+	hypothetical protein	NA	Q08J75	Stx2-converting_phage	98.5	5.0e-70
WP_000509022.1|2560259_2560916_+	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	99.1	7.4e-103
WP_000455643.1|2560918_2561365_+	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	100.0	4.0e-76
WP_000540395.1|2561374_2561626_+	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	97.5	7.9e-13
WP_000012439.1|2561636_2562902_+	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	95.0	1.5e-192
WP_000331660.1|2562970_2571322_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.8	0.0e+00
WP_000481378.1|2571445_2571721_+	hypothetical protein	NA	A0A088CD78	Shigella_phage	89.3	4.0e-18
WP_000628768.1|2571722_2572226_-	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	98.2	2.6e-95
WP_001290012.1|2572739_2573576_-	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	87.7	6.1e-126
WP_000020909.1|2573562_2573847_-	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	98.9	6.1e-46
WP_000763355.1|2573843_2574065_-	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	98.6	2.9e-35
WP_000184488.1|2574112_2574748_-	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	81.0	2.8e-91
WP_001342404.1|2575279_2577703_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000041536.1|2577763_2580190_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
>prophage 9
NC_018650	Escherichia coli O104:H4 str. 2009EL-2050, complete sequence	5253138	2870013	2931484	5253138	protease,capsid,tail,portal,head,holin,integrase,terminase	Enterobacteria_phage(41.18%)	73	2914716:2914730	2935655:2935669
WP_000422045.1|2870013_2871063_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|2871282_2872041_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_001278904.1|2872037_2872628_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2872667_2873540_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2873640_2874261_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2874257_2875139_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001386774.1|2875276_2875321_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194599.1|2875412_2876975_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2876974_2878570_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983912.1|2878570_2879932_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000209520.1|2879943_2881137_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443069.1|2881136_2881943_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2882323_2882503_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2882588_2883089_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|2883134_2883641_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000251936.1|2884129_2884300_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000926528.1|2884414_2884684_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_000240999.1|2884740_2885409_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885576.1|2885463_2886048_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
WP_015674559.1|2886047_2888882_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	59.1	3.3e-83
WP_001228314.1|2889033_2889633_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_000515776.1|2889700_2893180_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001332187.1|2893246_2893585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090879.1|2893658_2894261_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000140761.1|2894197_2894941_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	1.8e-145
WP_001152522.1|2894945_2895644_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847379.1|2895643_2895973_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000082359.1|2895969_2898543_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_000533402.1|2898523_2898937_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|2898963_2899395_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000235040.1|2899408_2900161_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.7e-132
WP_000683079.1|2900168_2900564_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974999.1|2900560_2901136_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
WP_001204198.1|2901150_2901504_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_000201506.1|2901496_2901865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522596.1|2901916_2902945_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
WP_000256823.1|2903002_2903350_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253926.1|2903386_2904892_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	3.0e-99
WP_001387697.1|2904881_2906474_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_000259002.1|2906470_2906677_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000867569.1|2908561_2909110_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000240372.1|2909510_2909915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343118.1|2910368_2910656_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
WP_001390467.1|2910734_2910887_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
WP_001228710.1|2910915_2911122_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	95.6	2.9e-29
WP_032159578.1|2911343_2911430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092853.1|2911984_2912518_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
WP_000731197.1|2912560_2913367_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	94.8	3.3e-145
WP_000284510.1|2913371_2913587_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874307.1|2913737_2915591_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
2914716:2914730	attL	ACCGTGTTCTTGTTT	NA	NA	NA	NA
WP_000871291.1|2915851_2916187_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001438304.1|2916467_2916599_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000935536.1|2917397_2918447_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_000917746.1|2918597_2918795_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	1.4e-28
WP_000762880.1|2919021_2919843_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904106.1|2919839_2920214_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.8e-36
WP_001265083.1|2920226_2921273_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.9e-110
WP_001329966.1|2921274_2921547_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|2921714_2921927_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|2922107_2922773_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151211.1|2922947_2923373_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000095671.1|2923413_2924376_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693888.1|2924398_2924824_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2924820_2925075_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2925154_2925574_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379548.1|2925870_2926023_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000394541.1|2926034_2926373_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_001295058.1|2926361_2926556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2927122_2927311_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2927307_2927499_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048530.1|2927591_2930063_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.2	1.8e-56
WP_000113189.1|2930127_2930376_+	excisionase	NA	NA	NA	NA	NA
WP_000113686.1|2930353_2931484_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	4.4e-103
2935655:2935669	attR	ACCGTGTTCTTGTTT	NA	NA	NA	NA
>prophage 10
NC_018650	Escherichia coli O104:H4 str. 2009EL-2050, complete sequence	5253138	3218703	3308979	5253138	capsid,tail,portal,bacteriocin,lysis,holin,integrase,terminase	Escherichia_phage(86.84%)	95	3217242:3217257	3269617:3269632
3217242:3217257	attL	AAAACCTCTGCCTGCG	NA	NA	NA	NA
WP_000279857.1|3218703_3219921_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.7	6.5e-44
WP_000611858.1|3220468_3221455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627404.1|3221451_3221943_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000409841.1|3221983_3223342_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
WP_000287459.1|3223928_3226352_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_000945561.1|3226360_3228379_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000610451.1|3228371_3229697_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_001061095.1|3229698_3230112_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_000533522.1|3230161_3230950_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
WP_001199172.1|3231568_3232840_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154414.1|3232845_3233973_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|3234030_3234861_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018486.1|3235402_3236911_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|3237069_3237279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299828.1|3237333_3241296_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|3241335_3241974_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|3242261_3243353_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|3243352_3244045_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126777.1|3244056_3244443_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001307099.1|3244450_3245251_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001196.1|3245260_3245851_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028096.1|3245861_3246356_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_001326838.1|3246376_3247705_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001273658.1|3247787_3247961_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_000331688.1|3248892_3257274_-	hypothetical protein	NA	A0A0P0ZGX9	Escherichia_phage	100.0	0.0e+00
WP_000012452.1|3257343_3258609_-	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	100.0	2.4e-206
WP_000540391.1|3258619_3258871_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455649.1|3258880_3259327_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000509482.1|3259329_3259986_-	hypothetical protein	NA	A0A0P0ZGF6	Escherichia_phage	100.0	5.1e-104
WP_000035557.1|3260080_3260482_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000078907.1|3260538_3260679_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835361.1|3260909_3261644_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_001301884.1|3261734_3262352_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455635.1|3262357_3262636_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_000197192.1|3262650_3263919_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_024199968.1|3263915_3265541_-	hypothetical protein	NA	A0A0P0ZG99	Escherichia_phage	100.0	0.0e+00
WP_000513231.1|3265774_3266287_-	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_000117976.1|3266373_3268965_-|tail	tail fiber protein	tail	A0A0P0ZGL7	Escherichia_phage	100.0	6.1e-209
WP_000207922.1|3268961_3269612_-	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_000829202.1|3269611_3270175_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
3269617:3269632	attR	AAAACCTCTGCCTGCG	NA	NA	NA	NA
WP_001290743.1|3270158_3270620_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140445.1|3270670_3271060_-	hypothetical protein	NA	A0A0P0ZFT7	Escherichia_phage	100.0	3.8e-62
WP_000214467.1|3271114_3272329_-|capsid	N4-gp56 family major capsid protein	capsid	A0A0N7KZY1	Escherichia_phage	100.0	1.7e-233
WP_000345015.1|3272352_3273360_-	hypothetical protein	NA	A0A0P0ZGF7	Escherichia_phage	100.0	2.3e-180
WP_000787518.1|3273517_3275662_-|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|3275661_3277368_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3277348_3278155_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|3278210_3278414_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|3278563_3278857_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|3278888_3279353_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|3279360_3279510_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|3279509_3280079_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|3280353_3280887_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001072899.1|3280891_3281107_-|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|3281184_3281430_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3281470_3281650_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001441721.1|3281786_3283724_-	SASA family carbohydrate esterase	NA	A0A0P0ZGW7	Escherichia_phage	100.0	0.0e+00
WP_000738068.1|3284209_3284479_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3284490_3285450_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|3285832_3285985_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|3286233_3286668_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|3286660_3286855_-	phage NinH family protein	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|3286851_3287415_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|3287422_3287872_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001260358.1|3287871_3288843_-	toprim domain-containing protein	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000913116.1|3288832_3290353_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001271433.1|3290346_3290724_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001369601.1|3290890_3291085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|3291255_3291459_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|3291554_3292268_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939558.1|3292362_3293832_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001064714.1|3293828_3294782_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_113690331.1|3295399_3296185_+	Rha family phage regulatory protein	NA	A0A0P0ZGC2	Escherichia_phage	96.2	2.6e-139
WP_000917252.1|3296255_3296468_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_000934197.1|3296479_3296761_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000995345.1|3296781_3297063_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000459721.1|3297079_3298030_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000187063.1|3298026_3298716_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344637.1|3298715_3299303_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_001071603.1|3299377_3299725_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|3299788_3300610_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001159715.1|3300686_3301082_+	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
WP_000206047.1|3301232_3301958_+	ead/Ea22-like family protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
WP_000034212.1|3301954_3302362_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|3302363_3302555_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000206786.1|3302557_3303454_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
WP_000203837.1|3303809_3304094_+	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	100.0	4.1e-50
WP_000211520.1|3304343_3304973_+	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000809302.1|3305028_3305460_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163448.1|3305456_3306083_+	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_001291843.1|3306042_3306255_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994793.1|3306290_3306671_+	DUF1627 domain-containing protein	NA	A0A0P0ZFT6	Escherichia_phage	100.0	1.2e-52
WP_000497812.1|3307034_3307286_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_001208772.1|3307331_3307616_+	excisionase family protein	NA	A0A0P0ZGY2	Escherichia_phage	100.0	7.0e-50
WP_001401545.1|3307668_3308979_+	DUF3596 domain-containing protein	NA	A0A0P0ZGT7	Escherichia_phage	100.0	2.4e-254
>prophage 11
NC_018650	Escherichia coli O104:H4 str. 2009EL-2050, complete sequence	5253138	3519795	3616338	5253138	transposase,lysis,capsid,tail,portal,head,integrase	Enterobacteria_phage(47.69%)	107	3546079:3546113	3617772:3617806
WP_000399648.1|3519795_3520776_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000961458.1|3521054_3522647_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_001056384.1|3522865_3523786_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000056442.1|3523844_3524963_-	anion transporter	NA	NA	NA	NA	NA
WP_000091016.1|3524959_3525427_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_001001761.1|3525612_3525741_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001054697.1|3526012_3527596_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001295296.1|3527644_3528160_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|3528212_3528278_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|3528512_3529400_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|3529698_3530202_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|3530605_3531352_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|3531490_3532150_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|3532146_3532869_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001267242.1|3532985_3535211_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001387659.1|3535207_3536134_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_001387658.1|3536409_3536670_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430039.1|3536934_3539217_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990161.1|3539258_3539936_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	3.1e-19
WP_000146343.1|3540009_3540276_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|3540540_3540801_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443512.1|3541029_3542115_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386540.1|3542255_3543218_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|3543245_3545396_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145128.1|3545515_3545998_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
3546079:3546113	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000007101.1|3546229_3547594_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|3547822_3548494_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|3548496_3549492_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|3549484_3551221_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000070131.1|3551213_3552347_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|3552357_3553464_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|3553425_3553836_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_001113348.1|3553968_3554730_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|3554726_3555968_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045450.1|3555967_3556924_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_001088647.1|3556959_3557673_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_001331162.1|3557742_3558390_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|3558591_3559296_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|3559432_3559885_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598616.1|3559886_3560132_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|3560124_3560610_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084632.1|3560612_3561125_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|3561146_3562136_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|3562532_3563441_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|3563632_3565654_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|3566239_3566917_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|3566909_3567665_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118840.1|3567651_3568806_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|3568802_3569843_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001307065.1|3569929_3571219_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|3571277_3571754_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000586343.1|3572499_3573831_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
WP_000885623.1|3573904_3574489_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	9.2e-105
WP_001387657.1|3574488_3577563_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001233090.1|3577627_3578227_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_000515635.1|3578297_3581795_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.5	0.0e+00
WP_000090917.1|3581855_3582488_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000140717.1|3582424_3583168_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
WP_001152576.1|3583173_3583872_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_000847379.1|3583871_3584201_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_015674562.1|3584197_3586759_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000459457.1|3586751_3587186_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479200.1|3587167_3587590_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
WP_001390429.1|3587605_3588346_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000683129.1|3588353_3588749_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975081.1|3588745_3589324_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|3589335_3589689_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|3589700_3590096_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063238.1|3590137_3591163_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_001299443.1|3591218_3591551_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123216.1|3591560_3592880_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
WP_001316944.1|3592860_3594462_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000198149.1|3594458_3594665_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000453580.1|3596560_3597106_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_000105084.1|3597494_3597728_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3597784_3598195_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001028465.1|3598544_3599066_-	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000092234.1|3599270_3599708_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001135297.1|3599704_3600202_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000839596.1|3600201_3600417_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737263.1|3601005_3602088_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_001204791.1|3602276_3602660_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|3602745_3602886_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_000774504.1|3603240_3603531_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224912.1|3603523_3603694_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_001053034.1|3603693_3604149_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_072147432.1|3604145_3604247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001391403.1|3604343_3604595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338663.1|3605171_3605411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145901.1|3606562_3606865_-	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_000788812.1|3606861_3607563_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000147903.1|3607559_3608579_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	9.7e-110
WP_001182903.1|3608575_3609115_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|3609184_3609415_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3609520_3610210_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|3610807_3611014_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995433.1|3611089_3611386_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|3611391_3612177_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|3612173_3612854_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682318.1|3612850_3613033_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548541.1|3613005_3613197_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	4.7e-26
WP_000188870.1|3613273_3613489_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763367.1|3613587_3613809_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000120064.1|3614019_3614622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3614864_3615032_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3615071_3615290_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533642.1|3615267_3616338_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
3617772:3617806	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 12
NC_018650	Escherichia coli O104:H4 str. 2009EL-2050, complete sequence	5253138	4120629	4176591	5253138	plate,transposase,integrase	Escherichia_phage(18.18%)	54	4120318:4120331	4136320:4136333
4120318:4120331	attL	AAGAATGGCGGCAG	NA	NA	NA	NA
WP_001269640.1|4120629_4121907_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000378354.1|4121987_4122272_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	57.7	5.1e-16
WP_000019440.1|4122352_4123333_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000891726.1|4123911_4125753_-	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.5	1.9e-18
WP_001387927.1|4125787_4125985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999102.1|4126136_4127168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013184.1|4127182_4127566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807036.1|4127570_4127768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390662.1|4128758_4129058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000580786.1|4129057_4129261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532776.1|4129318_4129702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221926.1|4129799_4130069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000594462.1|4130078_4130747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296967.1|4130894_4131077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273869.1|4132751_4133303_+	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	3.2e-30
WP_000550450.1|4133643_4133802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788776.1|4133868_4134021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000893256.1|4134817_4136071_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.3e-95
WP_001285288.1|4136082_4137186_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
4136320:4136333	attR	AAGAATGGCGGCAG	NA	NA	NA	NA
WP_000749877.1|4137473_4138529_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.2e-117
WP_000174677.1|4138567_4138969_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|4139026_4140271_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4140362_4140821_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293014.1|4141081_4142539_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602103.1|4142595_4143210_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_000528869.1|4143206_4144346_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.0e-31
WP_001059855.1|4144591_4145044_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226164.1|4145040_4146096_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207574.1|4146166_4146952_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001386594.1|4146896_4148636_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000598758.1|4148740_4149019_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030484.1|4149011_4149368_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000543895.1|4149424_4150198_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|4150383_4150644_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615974.1|4150646_4150925_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4151080_4151821_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4151791_4152559_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4152764_4153343_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973081.1|4153582_4156027_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4156069_4156543_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118029.1|4156696_4157467_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_122985282.1|4159954_4160140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939262.1|4160054_4160537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103304.1|4164259_4166401_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	3.7e-26
WP_001142958.1|4166610_4167129_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037389.1|4167825_4168326_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4168360_4168585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|4168635_4170111_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611748.1|4170117_4170531_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393853.1|4170534_4172385_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4172348_4173431_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|4173455_4174736_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4174732_4175257_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246421.1|4175259_4176591_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 13
NC_018650	Escherichia coli O104:H4 str. 2009EL-2050, complete sequence	5253138	4493257	4557254	5253138	transposase,holin	Stx2-converting_phage(33.33%)	59	NA	NA
WP_000181142.1|4493257_4494214_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.5	2.7e-61
WP_001137018.1|4494680_4495913_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001037377.1|4495953_4497234_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001298930.1|4497349_4498501_+	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_000222495.1|4498510_4499278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000657676.1|4499274_4499532_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_001298932.1|4499596_4500457_+	YjiK family protein	NA	NA	NA	NA	NA
WP_001141192.1|4500524_4501703_+	MFS transporter	NA	NA	NA	NA	NA
WP_001151854.1|4501715_4502270_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
WP_001295597.1|4502519_4503203_+	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_000211971.1|4503199_4503661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000568407.1|4503673_4504846_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000340758.1|4504910_4505822_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000986215.1|4505814_4506207_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_120795393.1|4506203_4506287_-	iraD leader peptide IdlP	NA	NA	NA	NA	NA
WP_000062571.1|4506878_4507709_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000833686.1|4507849_4508623_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000208220.1|4508837_4510298_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	3.6e-49
WP_000438591.1|4510378_4511563_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000558251.1|4511902_4513246_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_000250224.1|4514352_4515030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329788.1|4515861_4516059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813456.1|4516230_4516833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235221.1|4516927_4517134_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840367.1|4517274_4517541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000221550.1|4518758_4519328_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270971.1|4519587_4519989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221614.1|4519976_4520411_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001390365.1|4520765_4521146_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	3.9e-64
WP_000612591.1|4521142_4521490_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998014.1|4521539_4522925_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.4e-257
WP_000823241.1|4523163_4524522_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|4525272_4525530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4526447_4526969_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|4526965_4527919_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188245.1|4528005_4530330_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879153.1|4530374_4531277_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125175.1|4531273_4532272_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|4532268_4533225_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4533225_4533993_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|4534550_4534808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189126.1|4535458_4536967_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_160371899.1|4538542_4539385_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001388979.1|4539387_4540476_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_001387303.1|4540480_4541431_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_001390363.1|4541495_4542440_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000088357.1|4542620_4543760_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
WP_001293435.1|4543913_4545911_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625669.1|4545973_4547251_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145474.1|4547496_4548153_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001422798.1|4548333_4548462_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000422741.1|4548600_4549026_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4549022_4549373_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|4549403_4551017_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_001295538.1|4552200_4552983_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|4553288_4554209_+	ribokinase	NA	NA	NA	NA	NA
WP_000998350.1|4554236_4555553_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107474.1|4555564_4556578_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_001327567.1|4556999_4557254_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.0e-21
>prophage 14
NC_018650	Escherichia coli O104:H4 str. 2009EL-2050, complete sequence	5253138	4616602	4757024	5253138	integrase,transposase,protease,tRNA	Enterobacteria_phage(19.23%)	118	4701674:4701689	4743661:4743676
WP_001162171.1|4616602_4617955_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4618048_4618600_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219816.1|4618750_4620124_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|4620299_4621298_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595979.1|4621330_4622326_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001387274.1|4622312_4623335_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205794.1|4623348_4624851_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|4625160_4626117_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|4626426_4626957_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000239579.1|4627036_4627387_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223208.1|4627380_4627632_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4627843_4628185_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060946.1|4628187_4631967_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4631963_4633697_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|4633902_4634541_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935042.1|4634863_4636207_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4636268_4636475_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175289.1|4636799_4637357_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|4637346_4638087_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589423.1|4638276_4640220_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4640348_4640729_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560563.1|4640817_4641678_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001296686.1|4641785_4642751_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|4642858_4643521_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4643565_4644978_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4645286_4645907_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|4646125_4646764_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826425.1|4646898_4648107_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_000604912.1|4648114_4648546_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001351393.1|4649168_4649963_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4650033_4650483_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4650524_4650752_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4650756_4651071_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4651077_4651473_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4651799_4652075_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000996728.1|4652149_4652701_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4652797_4653484_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949539.1|4653483_4654338_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4654347_4654998_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776505.1|4655011_4655476_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4655485_4655791_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001300695.1|4655806_4657204_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4657558_4658623_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4658730_4659486_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569708.1|4659482_4660232_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4660413_4660743_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4660891_4661167_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001339483.1|4661283_4662909_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943976.1|4662992_4664156_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.3e-81
WP_000101644.1|4664158_4664797_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|4665222_4665882_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|4665932_4666631_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|4666649_4667051_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4667177_4667909_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|4668088_4670530_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|4670568_4670994_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4671198_4672497_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4672600_4672798_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4672879_4673884_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312490.1|4673886_4675146_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|4675231_4676512_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4676588_4676897_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|4676982_4677933_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122523.1|4677925_4679773_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.6	2.6e-60
WP_000990321.1|4679782_4681120_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4681138_4681600_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|4681571_4683119_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|4683117_4684257_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4684239_4684293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4685035_4685581_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|4685675_4686728_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934933.1|4686824_4687793_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236813.1|4687814_4691138_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|4691166_4691481_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|4691477_4691792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|4691843_4693346_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|4693564_4694542_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192973.1|4694866_4696675_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|4696667_4697402_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|4697412_4697808_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|4697818_4698178_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001367937.1|4698240_4699374_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|4699462_4699996_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|4699992_4700310_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|4700484_4700631_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|4700741_4700867_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|4700918_4701485_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|4701526_4702555_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
4701674:4701689	attL	CTGTTTGCCCTGCGTG	NA	NA	NA	NA
WP_001008073.1|4702944_4703814_+	YjeJ family protein	NA	NA	NA	NA	NA
WP_000558209.1|4704016_4704370_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|4704507_4706154_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4706197_4706491_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|4706766_4708023_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|4708038_4708515_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|4708851_4710288_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961957.1|4710405_4711707_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883400.1|4711822_4712161_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068978.1|4712136_4713834_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001387262.1|4713870_4714446_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218804.1|4714825_4716088_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
WP_001034110.1|4722527_4726385_+|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
WP_000291751.1|4726431_4727013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080172.1|4727204_4728818_-|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_000624688.1|4728848_4729199_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|4729195_4729630_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000422750.1|4732168_4732594_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
WP_001189118.1|4734279_4735788_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001387241.1|4736752_4738948_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750143.1|4738953_4740291_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015710.1|4740287_4742030_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287497.1|4742029_4742977_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001387605.1|4742977_4744702_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
4743661:4743676	attR	CACGCAGGGCAAACAG	NA	NA	NA	NA
WP_000074478.1|4744837_4746031_+	MFS transporter	NA	NA	NA	NA	NA
WP_001387604.1|4745980_4746907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000555385.1|4747646_4748789_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_162886171.1|4748828_4750042_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
WP_001390760.1|4750619_4751744_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.3e-199
WP_001045650.1|4752905_4757024_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
>prophage 1
NC_018651	Escherichia coli O104:H4 str. 2009EL-2050 plasmid p09EL50, complete sequence	109274	0	108169	109274	tRNA,portal,tail,integrase,terminase	Salmonella_phage(81.31%)	120	74489:74504	84791:84806
WP_162767289.1|3507_3732_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	3.4e-31
WP_014962232.1|3857_4175_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	95.2	1.5e-48
WP_014962233.1|4242_4980_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	88.6	1.0e-113
WP_014962234.1|5053_5437_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	79.5	1.5e-55
WP_014962235.1|5438_5912_-	hypothetical protein	NA	J9Q711	Salmonella_phage	89.2	2.8e-75
WP_014962236.1|5902_6247_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	94.7	5.1e-55
WP_014962237.1|6318_7152_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	88.8	1.8e-138
WP_014962238.1|7151_7586_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.2	1.0e-60
WP_014962239.1|7683_8604_-	hypothetical protein	NA	J9Q710	Salmonella_phage	87.9	8.7e-150
WP_014962240.1|8629_9517_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	88.3	2.4e-133
WP_001717193.1|9538_11113_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	93.1	2.2e-286
WP_001007300.1|11139_12396_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.9	3.4e-245
WP_014962241.1|12395_13028_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	84.6	8.2e-91
WP_000176292.1|13223_13490_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_014962242.1|13499_14390_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.3	2.9e-166
WP_014962243.1|14386_15052_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_000161986.1|15048_15717_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_021547990.1|15716_16397_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	87.6	4.6e-108
WP_014962245.1|16479_18039_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	93.1	5.8e-279
WP_001291061.1|18041_18320_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_041032003.1|18352_18952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014962247.1|19097_19586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014962248.1|19601_20201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014962249.1|20197_20722_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	79.1	1.5e-66
WP_014962250.1|21010_21661_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	1.1e-98
WP_000255469.1|21709_21913_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
WP_000497810.1|21934_22165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014962251.1|22780_23263_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.2	3.0e-61
WP_014962252.1|23613_23988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014962253.1|24106_24502_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	1.8e-32
WP_000749406.1|24628_24940_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	64.1	3.3e-29
WP_014962254.1|25094_25424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160384357.1|25562_25778_-	hypothetical protein	NA	J9Q804	Salmonella_phage	90.1	1.4e-31
WP_000910477.1|27321_27507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014962256.1|27543_27843_-	hypothetical protein	NA	J9Q750	Salmonella_phage	44.8	1.1e-21
WP_014962257.1|28004_30038_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	1.7e-44
WP_000004356.1|30195_31296_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_014962258.1|31333_31723_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	92.2	1.2e-65
WP_024199972.1|31895_32420_-	toprim domain-containing protein	NA	A0A2D2W4T4	Escherichia_phage	48.5	3.8e-33
WP_024199973.1|32433_33288_-	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	94.8	1.5e-23
WP_014962262.1|33498_34074_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	55.3	5.6e-38
WP_014962263.1|34075_34462_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	74.2	9.5e-42
WP_014962264.1|34472_34736_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	1.5e-30
WP_000672511.1|34737_35259_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	72.6	1.8e-35
WP_000213528.1|35255_35579_-	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	86.3	4.7e-42
WP_014962265.1|35580_36111_-	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	47.3	5.9e-34
WP_014962266.1|36097_36352_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	4.2e-38
WP_014962267.1|36348_36891_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	78.6	1.3e-44
WP_014962268.1|37029_37410_-	hypothetical protein	NA	J9Q801	Salmonella_phage	66.3	1.9e-26
WP_014962269.1|37409_38114_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	75.0	2.6e-85
WP_014962270.1|38175_39861_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	91.6	0.0e+00
WP_014962271.1|39964_40579_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	80.4	8.2e-96
WP_014962272.1|40920_41490_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	60.3	1.5e-51
WP_014962273.1|41629_41788_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000900262.1|41787_42213_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.1	4.4e-56
WP_014962274.1|42306_42495_-	hypothetical protein	NA	J9Q800	Salmonella_phage	51.6	9.4e-11
WP_024199974.1|42504_42999_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	46.1	2.6e-23
WP_014962275.1|43144_43738_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	4.8e-93
WP_014962276.1|44319_44550_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	3.4e-31
WP_014962277.1|44737_45331_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.0e-98
WP_014962278.1|45513_46323_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.6	1.2e-65
WP_014962279.1|46483_47041_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.6	2.8e-87
WP_014962280.1|47050_47470_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.2	9.3e-51
WP_000386470.1|47531_48176_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.8	4.6e-97
WP_014962281.1|48175_48652_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.2	1.3e-80
WP_014962282.1|48648_49050_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	86.5	2.3e-62
WP_014962283.1|49063_50167_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.2	1.7e-192
WP_001011861.1|50334_51204_-	hypothetical protein	NA	J9Q742	Salmonella_phage	80.6	5.3e-133
WP_014962284.1|51281_52424_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.4	7.6e-196
WP_014962285.1|52532_54848_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.0	0.0e+00
WP_014962286.1|54921_55491_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	85.7	1.1e-89
WP_014962287.1|55500_56244_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	46.8	7.5e-51
WP_014962288.1|56233_58150_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	72.7	1.1e-247
WP_000174803.1|58379_59465_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
WP_014962289.1|59719_60364_-	hypothetical protein	NA	J9Q739	Salmonella_phage	85.8	4.1e-106
WP_001348683.1|60565_61780_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	8.4e-76
WP_001229345.1|62359_62572_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_001404454.1|62571_62907_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	8.6e-39
WP_014962290.1|63122_63398_-	hypothetical protein	NA	J9Q738	Salmonella_phage	73.6	9.8e-33
WP_014962291.1|63453_63879_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	75.4	5.0e-60
WP_014962292.1|63940_64330_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	82.5	4.3e-58
WP_001718066.1|64350_65091_-	hypothetical protein	NA	G4KK93	Yersinia_phage	32.7	9.8e-27
WP_014962293.1|65138_65963_-	hypothetical protein	NA	A0A0U4IID7	Pseudomonas_phage	25.3	4.1e-18
WP_000715581.1|66058_66889_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_000591156.1|66892_67093_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	60.6	3.2e-09
WP_000920225.1|68261_68528_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	78.4	6.8e-31
WP_001108395.1|68527_69472_-	hypothetical protein	NA	J9Q7S6	Salmonella_phage	90.8	2.3e-166
WP_014962294.1|69532_70561_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	87.6	5.5e-145
WP_000627054.1|70678_71110_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.7	1.5e-64
WP_014962295.1|71235_74754_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.1	0.0e+00
74489:74504	attL	AATGATTCCATACATC	NA	NA	NA	NA
WP_014962296.1|74934_76170_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	80.8	3.3e-197
WP_014962297.1|76265_78374_-	porphyrin biosynthetic protein	NA	J9Q7G6	Salmonella_phage	65.9	1.5e-226
WP_014962298.1|78474_78687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014962299.1|78934_79321_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014962300.1|79315_80419_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	2.9e-27
WP_014962301.1|80626_82540_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	49.9	3.3e-175
WP_014962302.1|84365_84656_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	78.1	6.9e-37
WP_014962303.1|84801_85017_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.5	5.7e-20
84791:84806	attR	GATGTATGGAATCATT	NA	NA	NA	NA
WP_014962304.1|85000_85180_-	hypothetical protein	NA	J9Q729	Salmonella_phage	70.7	5.4e-16
WP_014962305.1|85176_86499_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.1	1.5e-240
WP_000989357.1|86495_86753_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	59.0	3.9e-15
WP_014962306.1|87033_87816_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	1.7e-53
WP_024199976.1|87891_89007_-	hypothetical protein	NA	J9Q720	Salmonella_phage	93.2	6.5e-208
WP_014962308.1|89154_90495_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	5.7e-235
WP_014962309.1|90538_91279_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	1.4e-126
WP_014962310.1|91459_93154_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.7	4.1e-12
WP_160378290.1|93205_93559_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_000161228.1|93564_94233_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_001351987.1|94551_94821_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_014962311.1|94828_95350_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001404395.1|95517_95769_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	78.0	1.1e-25
WP_000856758.1|95770_96463_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	93.9	1.4e-123
WP_014962312.1|96476_96800_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	84.1	3.2e-43
WP_014962313.1|96897_97410_-	hypothetical protein	NA	A0A0P0ZFL3	Escherichia_phage	68.2	8.2e-65
WP_014962314.1|97495_100867_-|tail	tail fiber protein	tail	A0A077SK37	Escherichia_phage	42.8	8.5e-86
WP_014962315.1|100961_105668_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	73.7	0.0e+00
WP_014962316.1|105684_106275_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	95.9	2.9e-106
WP_014962317.1|106262_107060_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	93.6	3.9e-154
WP_000511445.1|107052_107751_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_014962318.1|107833_108169_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
>prophage 1
NC_018654	Escherichia coli O104:H4 str. 2009EL-2050 plasmid pAA-09EL50, complete sequence	74213	0	5442	74213		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001144032.1|249_894_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030204.1|980_1289_+	molecular chaperone GroEL	NA	NA	NA	NA	NA
WP_000688504.1|1702_2683_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	2.2e-79
WP_001278815.1|2675_3092_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000457137.1|4366_4744_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.2	6.1e-25
WP_032159540.1|4875_5442_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	45.6	4.8e-34
>prophage 2
NC_018654	Escherichia coli O104:H4 str. 2009EL-2050 plasmid pAA-09EL50, complete sequence	74213	11428	19060	74213	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
WP_001401984.1|11428_11809_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.7e-65
WP_000612591.1|11805_12153_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000033204.1|14757_15258_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	28.2	2.4e-08
WP_000869859.1|15693_16722_+	class 1 isoprenoid biosynthesis enzyme	NA	NA	NA	NA	NA
WP_001387337.1|16725_17265_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000565591.1|17767_17920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019427.1|18079_19060_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
>prophage 3
NC_018654	Escherichia coli O104:H4 str. 2009EL-2050 plasmid pAA-09EL50, complete sequence	74213	23943	27906	74213	transposase	Pseudomonas_phage(50.0%)	3	NA	NA
WP_041032008.1|23943_25452_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	4.7e-44
WP_000721276.1|26218_26569_-	dispersin Aap	NA	NA	NA	NA	NA
WP_000019440.1|26925_27906_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
>prophage 4
NC_018654	Escherichia coli O104:H4 str. 2009EL-2050 plasmid pAA-09EL50, complete sequence	74213	31986	32223	74213	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_000239755.1|31986_32223_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	63.8	2.0e-18
>prophage 5
NC_018654	Escherichia coli O104:H4 str. 2009EL-2050 plasmid pAA-09EL50, complete sequence	74213	36069	36699	74213		Planktothrix_phage(100.0%)	1	NA	NA
WP_000621743.1|36069_36699_+	dispersin export ABC transporter ATP-binding protein AatC	NA	G9BWD6	Planktothrix_phage	35.4	1.2e-20
>prophage 6
NC_018654	Escherichia coli O104:H4 str. 2009EL-2050 plasmid pAA-09EL50, complete sequence	74213	41754	49586	74213	protease	Stx2-converting_phage(25.0%)	4	NA	NA
WP_015674546.1|41754_42093_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.0	1.0e-39
WP_001387845.1|42089_42524_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	3.4e-19
WP_001034126.1|43117_47212_-|protease	serine protease autotransporter toxin SepA	protease	Q9LA58	Enterobacterial_phage	42.2	3.3e-281
WP_001234427.1|48785_49586_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.5	2.8e-43
>prophage 7
NC_018654	Escherichia coli O104:H4 str. 2009EL-2050 plasmid pAA-09EL50, complete sequence	74213	57310	64264	74213	transposase	Stx2-converting_phage(57.14%)	8	NA	NA
WP_000205736.1|57310_58057_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_000139330.1|58111_58672_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001387845.1|58900_59335_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	3.4e-19
WP_000624689.1|59331_59628_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.4	3.4e-31
WP_000381397.1|59940_61512_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_000624622.1|61531_61879_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|61878_62556_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000019427.1|63283_64264_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
>prophage 8
NC_018654	Escherichia coli O104:H4 str. 2009EL-2050 plasmid pAA-09EL50, complete sequence	74213	68381	70378	74213	integrase	Macacine_betaherpesvirus(50.0%)	2	60392:60404	71319:71331
60392:60404	attL	ATGGCATACAGTT	NA	NA	NA	NA
WP_001066951.1|68381_69122_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001387465.1|69400_70378_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	8.8e-100
71319:71331	attR	AACTGTATGCCAT	NA	NA	NA	NA
