The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018649	Leptospirillum ferriphilum ML-04, complete sequence	2406157	2650	15498	2406157	transposase	Bacillus_virus(28.57%)	8	NA	NA
WP_014959781.1|2650_5107_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.0	1.4e-13
WP_014959782.1|5162_7613_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.0	2.3e-101
WP_041772002.1|7593_8409_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014959785.1|8454_9093_+	radical SAM protein	NA	S4TZT1	uncultured_phage	38.2	6.4e-27
WP_014959786.1|9095_9821_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	32.0	2.7e-21
WP_050995624.1|9936_11538_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	35.6	1.7e-44
WP_014959788.1|11600_12092_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.4	1.9e-26
WP_041772005.1|14301_15498_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	43.1	1.3e-73
>prophage 2
NC_018649	Leptospirillum ferriphilum ML-04, complete sequence	2406157	262500	316732	2406157	transposase,integrase,tRNA,protease	Brevibacillus_phage(10.0%)	50	276381:276395	284261:284275
WP_014960050.1|262500_263898_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_014960051.1|263887_264856_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	28.9	5.9e-24
WP_014960052.1|264839_265436_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_014960053.1|265432_266767_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.4	1.5e-38
WP_101494950.1|266823_267693_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_077305151.1|267975_268617_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	50.0	1.0e-35
WP_014960057.1|268644_270108_-	TolC family protein	NA	NA	NA	NA	NA
WP_014960058.1|270100_271231_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_101494951.1|271223_274403_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	1.5e-60
WP_014960060.1|274588_275434_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	48.2	5.0e-51
WP_014960061.1|275426_276287_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_041772394.1|276371_277187_+	carbon-nitrogen hydrolase	NA	M1I5T1	Acanthocystis_turfacea_Chlorella_virus	29.3	8.0e-14
276381:276395	attL	GTCCTTGTCCAGAAC	NA	NA	NA	NA
WP_014960063.1|277259_277547_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_014960065.1|278167_278695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960068.1|279866_280970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960069.1|281109_281601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960070.1|281971_282856_-|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	48.7	1.0e-59
WP_014960071.1|283025_283343_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_041772034.1|283320_283731_-	nucleotidyltransferase substrate binding protein	NA	NA	NA	NA	NA
WP_050995505.1|283945_284929_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
284261:284275	attR	GTCCTTGTCCAGAAC	NA	NA	NA	NA
WP_050995505.1|285153_286137_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_050995505.1|286361_287345_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_014960075.1|287945_289091_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014959795.1|290866_291925_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041772035.1|292099_292492_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014960079.1|292466_292787_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041772400.1|293070_294792_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_143461138.1|295260_295401_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041772403.1|296938_298435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960086.1|298642_299410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014960087.1|299658_300237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960088.1|300264_301527_-	MFS transporter	NA	NA	NA	NA	NA
WP_101494852.1|301905_302565_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014960090.1|302873_303305_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_014960091.1|303311_303605_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014960092.1|303769_304099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960093.1|304159_304537_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_038506638.1|304533_304731_-	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_014960095.1|304960_305896_-	radical SAM protein	NA	NA	NA	NA	NA
WP_014960096.1|305883_306870_-	thiamine biosynthesis protein	NA	NA	NA	NA	NA
WP_014960097.1|306866_307181_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_041772038.1|309848_310058_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_014960102.1|310057_310342_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_148274342.1|310474_311377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014960104.1|311394_312228_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A1V0SCZ1	Indivirus	26.9	5.3e-13
WP_014960105.1|312375_313101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960106.1|313107_314106_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.1	1.7e-10
WP_014960107.1|314092_314719_-	crossover junction resolvasome subunit RuvA	NA	NA	NA	NA	NA
WP_014960108.1|314715_315249_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_014960109.1|315229_316732_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.4	2.7e-31
>prophage 3
NC_018649	Leptospirillum ferriphilum ML-04, complete sequence	2406157	527149	580185	2406157	transposase,integrase	Acidithiobacillus_phage(20.0%)	54	520946:520966	547264:547284
520946:520966	attL	GAGTGACAAGAGAGTGACAAA	NA	NA	NA	NA
WP_014959795.1|527149_528208_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014959793.1|528603_529821_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	55.6	3.3e-112
WP_014960075.1|529977_531123_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_148274270.1|531875_532223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960336.1|532215_533646_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014960338.1|533911_534403_+	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_014960259.1|534618_536175_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.9	7.9e-111
WP_014960260.1|536168_536900_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.8	2.4e-57
WP_081579018.1|537040_539368_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_041772068.1|539424_539628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960341.1|539641_539980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041772069.1|539963_540179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041772070.1|540348_541080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148274271.1|541104_541734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960344.1|541744_542074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148274272.1|542120_542450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960346.1|542655_542898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041772073.1|542990_543521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960347.1|543535_543781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960348.1|543777_544020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187288716.1|544102_545068_+	AAA family ATPase	NA	A0A2P0VN73	Tetraselmis_virus	25.6	2.7e-08
WP_014960350.1|545060_545699_-	YqhA family protein	NA	NA	NA	NA	NA
WP_014960351.1|545688_545847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041772074.1|545984_546191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014960353.1|546187_547207_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	42.9	1.7e-66
WP_014960354.1|547436_547649_-	CbtB-domain containing protein	NA	NA	NA	NA	NA
547264:547284	attR	GAGTGACAAGAGAGTGACAAA	NA	NA	NA	NA
WP_038506735.1|547725_548022_-	glutaredoxin	NA	NA	NA	NA	NA
WP_014960356.1|548310_549663_+	CbbQ/NirQ/NorQ C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014960357.1|549666_551319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960358.1|551365_551986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960359.1|551977_552592_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_014960360.1|552998_555107_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	31.4	6.4e-15
WP_023525849.1|555371_555992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960362.1|556109_556298_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_014960364.1|556566_557496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960365.1|557552_558200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179108891.1|558910_559705_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014960367.1|560305_560632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041772078.1|560631_563985_+	toprim domain-containing protein	NA	A0A088C3Q3	Shewanella_sp._phage	26.2	1.2e-18
WP_014960370.1|564203_564617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960371.1|564629_565304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960372.1|565358_566027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179108892.1|566023_566194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960374.1|566488_569386_+	relaxase domain-containing protein	NA	V5UQN3	Mycobacterium_phage	23.2	1.7e-13
WP_014960375.1|569559_569691_+	ORF6N domain-containing protein	NA	NA	NA	NA	NA
WP_014960377.1|570364_570769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101494909.1|570888_571242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014960379.1|571268_571649_-	copper-binding protein	NA	NA	NA	NA	NA
WP_179108894.1|571645_574834_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	21.9	6.9e-61
WP_014960381.1|574842_576099_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014960382.1|576088_577516_-	TolC family protein	NA	NA	NA	NA	NA
WP_143461203.1|577999_578215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179108893.1|578542_578818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960386.1|578874_580185_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	39.2	8.5e-82
>prophage 4
NC_018649	Leptospirillum ferriphilum ML-04, complete sequence	2406157	622469	640682	2406157	integrase,terminase	Pseudomonas_phage(15.38%)	30	636154:636169	650094:650109
WP_014960441.1|622469_623726_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J196	uncultured_Caudovirales_phage	51.3	3.4e-112
WP_014960442.1|623709_624252_-|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	33.6	2.6e-13
WP_014960443.1|624248_624458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014960444.1|624468_625773_-	AAA family ATPase	NA	U5PWH9	Acinetobacter_phage	30.0	3.7e-29
WP_014960445.1|626025_627972_-	PriCT-2 domain-containing protein	NA	M4QC51	Vibrio_phage	34.5	2.2e-25
WP_014960446.1|627968_628376_-	RusA family crossover junction endodeoxyribonuclease	NA	F8TV31	EBPR_siphovirus	41.3	2.9e-17
WP_014960447.1|628372_628612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014960448.1|628679_628964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081579079.1|629078_629255_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_187288717.1|629318_630014_+	LexA family transcriptional regulator	NA	A0A1B0T6H5	Thiobacimonas_phage	36.6	9.2e-19
WP_041772093.1|630051_630567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960450.1|630629_630917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148274273.1|631066_631333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960451.1|631575_631854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179110176.1|631853_631994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041772096.1|632005_632197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960452.1|632190_632592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960453.1|632588_633269_+	ATP-binding protein	NA	A0A0R6PKU1	Moraxella_phage	53.5	2.5e-61
WP_014960454.1|633265_633763_+	DUF669 domain-containing protein	NA	A0A088FAP5	Vibrio_phage	44.2	8.6e-27
WP_087586898.1|633780_634329_+	HNH endonuclease	NA	J7I0T2	Pseudomonas_phage	42.7	9.5e-11
WP_014960456.1|634492_635155_+	hypothetical protein	NA	A0A2I2L6K5	Escherichia_phage	40.8	6.2e-41
WP_179110175.1|635127_636765_+	DEAD/DEAH box helicase family protein	NA	A0A1J0GWD7	Alteromonas_phage	40.5	3.4e-112
636154:636169	attL	ACCCGGATCGCGGAAG	NA	NA	NA	NA
WP_014960458.1|636727_637234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960459.1|637220_637718_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041772098.1|637714_638371_+	HNH endonuclease	NA	M1PKJ5	Streptococcus_phage	35.4	1.8e-16
WP_014960462.1|638354_638591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041772099.1|638587_638794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041772100.1|638790_639021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960463.1|639017_639434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014960464.1|639659_640682_+|integrase	site-specific integrase	integrase	Q7Y5X7	Haemophilus_phage	46.3	3.0e-82
650094:650109	attR	ACCCGGATCGCGGAAG	NA	NA	NA	NA
>prophage 5
NC_018649	Leptospirillum ferriphilum ML-04, complete sequence	2406157	818116	824726	2406157	integrase	Acinetobacter_phage(16.67%)	7	812323:812337	826269:826283
812323:812337	attL	ATGACCAAGCTCCGG	NA	NA	NA	NA
WP_014960623.1|818116_818320_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	47.9	2.2e-05
WP_014960624.1|818333_819518_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	31.0	8.8e-38
WP_014960626.1|820236_821394_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	57.0	2.6e-119
WP_014960627.1|821470_822727_+	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	36.0	9.0e-65
WP_014960628.1|822730_822961_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101494882.1|822896_823877_+	cysteine synthase A	NA	A0A1W6JIM2	Lactococcus_phage	50.7	1.5e-70
WP_014960630.1|823913_824726_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	26.3	3.3e-12
826269:826283	attR	ATGACCAAGCTCCGG	NA	NA	NA	NA
>prophage 6
NC_018649	Leptospirillum ferriphilum ML-04, complete sequence	2406157	1228591	1238275	2406157	tRNA	Staphylococcus_phage(28.57%)	10	NA	NA
WP_014961032.1|1228591_1230064_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	32.4	3.9e-43
WP_041772140.1|1230078_1230795_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_179110116.1|1230937_1231576_+	redoxin domain-containing protein	NA	A0A1J0GW78	Streptomyces_phage	35.8	3.7e-06
WP_014961035.1|1231572_1233351_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	30.7	8.0e-75
WP_014961036.1|1233402_1234605_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.1	9.1e-99
WP_143461499.1|1234629_1235109_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	34.8	3.8e-16
WP_014961038.1|1235105_1235612_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_014961039.1|1235608_1236109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014961040.1|1236195_1237509_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	8.6e-18
WP_143461497.1|1237474_1238275_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	39.2	3.1e-42
>prophage 7
NC_018649	Leptospirillum ferriphilum ML-04, complete sequence	2406157	1542930	1591965	2406157	transposase,integrase,tRNA,protease	Escherichia_phage(20.0%)	43	1567105:1567120	1592502:1592517
WP_014961328.1|1542930_1543494_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_014961329.1|1543512_1544136_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_014961330.1|1544198_1545143_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	2.7e-45
WP_014961331.1|1545291_1546173_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_023525312.1|1546169_1547558_-	DUF512 domain-containing protein	NA	NA	NA	NA	NA
WP_143461514.1|1547571_1548108_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_148274311.1|1548122_1549370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014961335.1|1549518_1550172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014961336.1|1550168_1551449_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.9	8.1e-130
WP_014961337.1|1551475_1552087_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.8	1.6e-54
WP_148274312.1|1552111_1553527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014961339.1|1553712_1554957_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_014961340.1|1554953_1556702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014961341.1|1556712_1558200_-	glucose-6-phosphate dehydrogenase	NA	E3SKF6	Synechococcus_phage	35.8	2.6e-79
WP_014961342.1|1558296_1561230_-	bifunctional transaldolase/phosoglucose isomerase	NA	NA	NA	NA	NA
WP_014961343.1|1561288_1563322_-	transketolase	NA	NA	NA	NA	NA
WP_014961344.1|1563358_1564189_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_014961345.1|1564326_1565361_-	glucokinase	NA	NA	NA	NA	NA
WP_099590563.1|1565915_1566482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014959795.1|1566698_1567757_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
1567105:1567120	attL	TCAACCACATCCGGGG	NA	NA	NA	NA
WP_014959793.1|1568152_1569370_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	55.6	3.3e-112
WP_014961348.1|1569423_1570830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041772164.1|1570975_1571434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041772165.1|1571456_1571912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041772167.1|1572257_1572461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014961350.1|1572805_1573639_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_014961351.1|1573847_1574174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014961352.1|1574650_1575679_+	adenosyl-hopene transferase HpnH	NA	NA	NA	NA	NA
WP_014961353.1|1575761_1576763_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014961354.1|1576788_1577472_+	metallophosphoesterase	NA	Q71TJ1	Escherichia_phage	31.7	3.3e-13
WP_014961355.1|1577485_1578874_-	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036083671.1|1579082_1579319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143468997.1|1579390_1579942_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014961359.1|1579938_1581651_+	chloride channel protein	NA	NA	NA	NA	NA
WP_041772168.1|1581892_1582969_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	42.0	5.5e-63
WP_050995547.1|1583181_1583757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014961362.1|1583747_1584689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014961363.1|1584861_1585263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014961364.1|1585720_1586452_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.4	1.2e-58
WP_014961366.1|1587626_1589237_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	32.7	9.5e-51
WP_014961367.1|1589227_1589971_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	31.1	1.3e-23
WP_014961369.1|1590818_1590971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014961371.1|1591407_1591965_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
1592502:1592517	attR	CCCCGGATGTGGTTGA	NA	NA	NA	NA
