The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015506	Bacillus oceanisediminis 2691 chromosome, complete genome	5461741	348240	356651	5461741		Synechococcus_phage(50.0%)	8	NA	NA
WP_009336739.1|348240_349533_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.5	1.3e-18
WP_019382939.1|349648_350374_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	47.2	5.2e-49
WP_019382938.1|350361_350616_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_019382937.1|350612_351299_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_019382936.1|351282_353499_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.6	3.9e-164
WP_009336744.1|353483_354881_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.1	1.4e-50
WP_019382935.1|355030_356056_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	41.2	2.9e-61
WP_019382934.1|356069_356651_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.3	1.0e-26
>prophage 2
NZ_CP015506	Bacillus oceanisediminis 2691 chromosome, complete genome	5461741	1518433	1555695	5461741	tail,integrase,terminase,head,portal,protease,holin,capsid	Bacillus_phage(42.31%)	47	1518294:1518336	1561505:1561547
1518294:1518336	attL	TTGACAGGGTAGAGGTCGCTGGTTCGAACCCAGTCGGAATCAT	NA	NA	NA	NA
WP_019381509.1|1518433_1519633_-|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	52.7	2.6e-109
WP_019381510.1|1519737_1520019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019381511.1|1520023_1522024_-	DEAD/DEAH box helicase family protein	NA	U6E9C9	Streptococcus_phage	27.2	1.0e-17
WP_019381512.1|1522272_1522713_-	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	49.6	8.4e-34
WP_019381513.1|1522718_1523147_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	45.0	1.8e-25
WP_019381514.1|1523340_1523568_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_026041684.1|1523621_1523810_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019381516.1|1523810_1524512_+	ORF6N domain-containing protein	NA	A0A0S2SXM6	Bacillus_phage	38.8	1.9e-43
WP_009330644.1|1524655_1524919_+	helix-turn-helix transcriptional regulator	NA	S5MNZ7	Brevibacillus_phage	59.0	6.5e-18
WP_019381519.1|1525310_1525514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_180321097.1|1525654_1526566_+	YqaJ viral recombinase family protein	NA	Q9T173	Listeria_phage	63.1	6.5e-105
WP_019381521.1|1526565_1527495_+	recombinase RecT	NA	A0A0B5CTU3	Listeria_phage	68.4	1.1e-88
WP_019381522.1|1527654_1528680_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_019381525.1|1529602_1529854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381527.1|1530251_1531739_+	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_019381528.1|1531944_1532523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381529.1|1532546_1533230_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_019381530.1|1533353_1533512_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_019381531.1|1533684_1533867_+	DUF3954 domain-containing protein	NA	A0A2P1JTX5	Anoxybacillus_phage	59.3	3.3e-13
WP_019381532.1|1533874_1534048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019381533.1|1534211_1534679_+	hypothetical protein	NA	A0A290FZR5	Caldibacillus_phage	49.7	6.4e-32
WP_019381534.1|1534810_1535002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381535.1|1535075_1535306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381536.1|1535355_1536168_+|terminase	terminase small subunit	terminase	Q5YA77	Bacillus_phage	67.2	5.2e-82
WP_019381537.1|1536167_1537370_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	75.0	3.2e-184
WP_019381538.1|1537379_1538756_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	57.4	5.1e-146
WP_019381539.1|1538752_1539766_+	hypothetical protein	NA	A0A1Q1PVS0	Bacillus_phage	42.9	1.2e-59
WP_157888575.1|1539816_1539960_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_157888576.1|1540066_1540717_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	50.3	4.1e-45
WP_051005557.1|1540748_1541708_+|capsid	phage major capsid protein	capsid	M9NTC2	Staphylococcus_phage	55.0	5.2e-89
WP_019381543.1|1541725_1542031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381544.1|1542041_1542383_+|head,tail	phage head-tail connector protein	head,tail	Q4ZC67	Staphylococcus_virus	38.6	9.7e-14
WP_019381545.1|1542369_1542696_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_019381546.1|1542688_1543108_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	56.6	1.0e-36
WP_019381547.1|1543109_1543514_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	38.8	2.4e-19
WP_099049169.1|1543526_1543784_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_099049170.1|1543794_1544052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381548.1|1544114_1544567_+	hypothetical protein	NA	O48453	Bacillus_phage	29.8	5.6e-09
WP_019381549.1|1544677_1544908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381550.1|1544911_1547617_+	hypothetical protein	NA	W8EBC4	Geobacillus_phage	46.8	9.9e-77
WP_019381551.1|1547618_1549043_+|tail	phage tail family protein	tail	A0A142F1N1	Bacillus_phage	34.8	4.4e-68
WP_019381552.1|1549039_1552885_+|tail	phage tail protein	tail	A0A142F1N2	Bacillus_phage	52.0	3.8e-106
WP_019381553.1|1552905_1553298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381554.1|1553399_1553546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051005558.1|1553629_1553866_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.0	1.6e-20
WP_019381556.1|1553867_1554134_+|holin	phage holin	holin	A0A142F1N6	Bacillus_phage	55.2	8.3e-21
WP_019381559.1|1555005_1555695_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	48.1	2.5e-56
1561505:1561547	attR	TTGACAGGGTAGAGGTCGCTGGTTCGAACCCAGTCGGAATCAT	NA	NA	NA	NA
>prophage 3
NZ_CP015506	Bacillus oceanisediminis 2691 chromosome, complete genome	5461741	2013665	2098543	5461741	tail,integrase,terminase,portal,protease,capsid,tRNA,holin,head	Bacillus_phage(30.56%)	100	2015442:2015455	2100150:2100163
WP_162272002.1|2013665_2015972_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2015442:2015455	attL	ATCATTTTTACAGG	NA	NA	NA	NA
WP_019381814.1|2015907_2017119_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_099049171.1|2017445_2017775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009330654.1|2018151_2020755_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	25.4	1.3e-41
WP_009330653.1|2020770_2022693_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.5	2.4e-69
WP_009330587.1|2022886_2023894_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_019381817.1|2024169_2025132_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_009330585.1|2025159_2025393_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_009330584.1|2025807_2026758_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	42.0	1.9e-54
WP_009330583.1|2026836_2027070_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_019381819.1|2027396_2028347_+	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	32.9	4.3e-35
WP_019381820.1|2028458_2028803_+	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_019381821.1|2028805_2029963_+	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_019381822.1|2030037_2031123_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_009330577.1|2031191_2031887_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009330576.1|2032044_2033109_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_019381823.1|2033513_2034509_+	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_019381824.1|2034528_2035101_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_019381825.1|2035120_2036401_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_009330572.1|2036418_2037036_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_019381826.1|2037274_2038531_+	GTPase HflX	NA	NA	NA	NA	NA
WP_019381827.1|2038544_2039816_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_175502153.1|2040031_2040412_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009330568.1|2040517_2041852_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	23.9	7.4e-09
WP_019381829.1|2042325_2042556_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	70.7	2.6e-26
WP_009330567.1|2042672_2043164_+	LptF/LptG family permease	NA	NA	NA	NA	NA
WP_019381830.1|2043160_2043628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009330566.1|2044465_2044750_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_009330565.1|2045035_2045659_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	1.1e-15
WP_009330564.1|2045814_2046147_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009330563.1|2046156_2046804_+	recombinase family protein	NA	NA	NA	NA	NA
WP_009330562.1|2046947_2047181_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_009330561.1|2047411_2049418_+	transketolase	NA	NA	NA	NA	NA
WP_009330560.1|2049693_2050131_+	sporulation inhibitor of replication protein SirA	NA	NA	NA	NA	NA
WP_009330559.1|2050217_2050433_+	YneF family protein	NA	NA	NA	NA	NA
WP_019381832.1|2050627_2051551_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	27.0	2.6e-13
WP_157888579.1|2051519_2051618_-	chemotaxis protein CheC	NA	NA	NA	NA	NA
WP_019381834.1|2052416_2052638_-	helix-turn-helix transcriptional regulator	NA	S5MNP8	Brevibacillus_phage	35.5	4.1e-05
WP_019381835.1|2052800_2053046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381836.1|2053167_2053410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381837.1|2053437_2053695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381838.1|2053708_2054026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381839.1|2054258_2054702_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_019381841.1|2055369_2056452_+	hypothetical protein	NA	A0A0H3V0V6	Geobacillus_virus	37.9	1.1e-53
WP_019381842.1|2056760_2059502_+	hypothetical protein	NA	O64076	Bacillus_phage	40.2	1.4e-163
WP_019381843.1|2059877_2060573_+	hypothetical protein	NA	A0A2I7RL47	Vibrio_phage	30.5	3.1e-06
WP_019381844.1|2060655_2061660_+	DNA cytosine methyltransferase	NA	D2IZY5	Enterococcus_phage	59.6	2.3e-103
WP_019381845.1|2061721_2061946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019381846.1|2062073_2062460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381848.1|2062795_2062999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381850.1|2063266_2063578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381851.1|2063561_2063960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026041709.1|2064092_2064581_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_019381853.1|2064573_2066268_+	hypothetical protein	NA	A0A075KQB9	Lactobacillus_phage	43.1	3.2e-126
WP_019381854.1|2066283_2066847_+|portal	phage portal protein	portal	A0A075KK59	Lactobacillus_phage	50.6	3.8e-39
WP_019381855.1|2066874_2067525_+|portal	phage portal protein	portal	A0A075KQ80	Lactobacillus_phage	50.7	1.6e-52
WP_019381856.1|2067514_2068129_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J861	uncultured_Caudovirales_phage	69.3	3.7e-64
WP_026041710.1|2068169_2069279_+|capsid	phage major capsid protein	capsid	F7V9A6	Lactobacillus_virus	39.4	1.2e-65
WP_157888529.1|2069327_2069483_+	hypothetical protein	NA	U3PBG9	Lactobacillus_phage	58.0	9.8e-06
WP_019381859.1|2069482_2069773_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A075KKZ5	Lactobacillus_phage	33.7	2.6e-07
WP_019381860.1|2069787_2070108_+|head	phage head closure protein	head	A0A2I7SC03	Paenibacillus_phage	62.5	3.7e-31
WP_019381861.1|2070108_2070474_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_019381862.1|2070470_2070818_+	hypothetical protein	NA	A0A0K2CZA4	Paenibacillus_phage	44.4	3.0e-18
WP_019381863.1|2070819_2071377_+	hypothetical protein	NA	A0A2I7SBZ0	Paenibacillus_phage	38.5	2.4e-30
WP_019381864.1|2071443_2071764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381866.1|2071934_2075138_+|tail	phage tail tape measure protein	tail	Q9ZXE7	Bacillus_phage	46.6	3.1e-101
WP_019381867.1|2075130_2075991_+|tail	phage tail family protein	tail	A0A0K1YA68	Streptomyces_phage	27.2	1.4e-21
WP_019381868.1|2075993_2077208_+	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K1Y896	Streptomyces_phage	31.0	5.0e-28
WP_019381869.1|2077212_2078142_+	hypothetical protein	NA	A0A0K1Y8X4	Streptomyces_phage	42.5	3.5e-21
WP_019381870.1|2078150_2078315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381871.1|2078315_2078450_+	XkdX family protein	NA	NA	NA	NA	NA
WP_019381872.1|2078476_2078830_+	hypothetical protein	NA	F8WQ03	Bacillus_phage	40.8	3.5e-14
WP_019381873.1|2078829_2080326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381875.1|2080741_2081101_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_019381876.1|2081100_2081808_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWM9	uncultured_phage	61.5	6.0e-74
WP_019381877.1|2081865_2082054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381878.1|2082087_2082366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019381879.1|2082465_2082726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019381880.1|2082751_2083003_-	lipoprotein	NA	NA	NA	NA	NA
WP_019381881.1|2083031_2083178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019381882.1|2083200_2083467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019381883.1|2083469_2083916_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_157888580.1|2084006_2084198_-	helix-turn-helix domain-containing protein	NA	A0A0U4IBA0	Bacillus_phage	55.6	4.9e-15
WP_019381886.1|2084653_2085031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381887.1|2085045_2085390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381888.1|2085401_2086631_+	hypothetical protein	NA	W8CYG2	Bacillus_phage	34.4	7.7e-61
WP_019381889.1|2086643_2087351_+	replication-relaxation family protein	NA	A0A1B1P7T2	Bacillus_phage	39.6	2.4e-30
WP_157888581.1|2087480_2087657_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019381891.1|2088019_2088541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381892.1|2088647_2090396_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.8	4.3e-49
WP_019381893.1|2090400_2092194_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.3	3.6e-51
WP_019381894.1|2092233_2092995_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_019381895.1|2093113_2093521_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_009330553.1|2093581_2093752_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_009330552.1|2094098_2094806_+	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_180321088.1|2095061_2095445_+	response regulator	NA	W8CYM9	Bacillus_phage	30.0	3.1e-08
WP_019381897.1|2095597_2096086_+	cytochrome c biogenesis protein CcdC	NA	NA	NA	NA	NA
WP_009330549.1|2096136_2096631_-	DinB family protein	NA	NA	NA	NA	NA
WP_019381898.1|2096777_2097203_-	DUF2621 domain-containing protein	NA	NA	NA	NA	NA
WP_019381899.1|2097589_2098543_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	32.0	3.9e-28
2100150:2100163	attR	CCTGTAAAAATGAT	NA	NA	NA	NA
>prophage 4
NZ_CP015506	Bacillus oceanisediminis 2691 chromosome, complete genome	5461741	2112243	2134048	5461741	tail,plate,capsid,portal	uncultured_Caudovirales_phage(27.78%)	31	NA	NA
WP_019381927.1|2112243_2112957_-	recombinase family protein	NA	Q9T193	Listeria_phage	31.2	3.6e-18
WP_019381928.1|2113250_2113517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099049173.1|2113581_2115360_+	hypothetical protein	NA	A0A0N9RZA7	Paenibacillus_phage	60.4	4.3e-206
WP_019381930.1|2115375_2116839_+|portal	phage portal protein	portal	A0A0N7GFE4	Paenibacillus_phage	60.7	7.6e-148
WP_019381931.1|2116838_2117669_+	hypothetical protein	NA	A0A2H4IZM1	uncultured_Caudovirales_phage	51.6	2.2e-75
WP_019381932.1|2117745_2118333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381933.1|2118400_2119207_+|capsid	N4-gp56 family major capsid protein	capsid	K4JU44	Streptococcus_phage	45.5	1.6e-54
WP_019381935.1|2119360_2119744_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	42.5	3.5e-20
WP_019381936.1|2119743_2120064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381937.1|2120063_2120474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026041714.1|2120467_2120929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381939.1|2120947_2121994_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4J187	uncultured_Caudovirales_phage	55.5	1.9e-100
WP_019381940.1|2122013_2122451_+|tail	phage tail tube protein	tail	A0A0N7ACS0	Bacillus_phage	51.4	2.3e-36
WP_019381941.1|2122513_2122918_+	hypothetical protein	NA	A0A2H4J7P7	uncultured_Caudovirales_phage	44.6	4.8e-20
WP_019381942.1|2123094_2124828_+	hypothetical protein	NA	D2J070	Enterococcus_phage	38.8	1.2e-51
WP_019381943.1|2124830_2125487_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N7ACF7	Bacillus_phage	40.9	4.1e-37
WP_026041716.1|2125507_2126485_+	hypothetical protein	NA	A0A2H4IZP4	uncultured_Caudovirales_phage	41.2	1.1e-62
WP_019381945.1|2126498_2126822_+	DUF2577 family protein	NA	NA	NA	NA	NA
WP_019381946.1|2126822_2127239_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	39.6	1.0e-17
WP_019381947.1|2127238_2128300_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	42.6	5.6e-60
WP_019381948.1|2128296_2128884_+	YmfQ family protein	NA	S6BFJ0	Thermus_phage	38.2	8.3e-29
WP_019381949.1|2128883_2129618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381950.1|2129632_2129866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381951.1|2129869_2130010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381952.1|2130077_2130353_+	hypothetical protein	NA	A0A142F1N5	Bacillus_phage	69.0	2.7e-06
WP_019381953.1|2130352_2131120_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0M4S688	Bacillus_phage	55.2	8.2e-45
WP_019381954.1|2131139_2131319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381955.1|2131441_2132068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381956.1|2132105_2132522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019381957.1|2132565_2133111_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_157888583.1|2133247_2134048_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	46.3	2.9e-61
>prophage 5
NZ_CP015506	Bacillus oceanisediminis 2691 chromosome, complete genome	5461741	2313870	2321810	5461741	transposase	Moumouvirus(16.67%)	8	NA	NA
WP_009334810.1|2313870_2314962_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	46.1	2.6e-92
WP_009334809.1|2314954_2315941_+	polysaccharide biosynthesis protein	NA	L7RD47	Acanthamoeba_polyphaga_moumouvirus	29.7	5.9e-19
WP_009334808.1|2315941_2316769_+	SDR family oxidoreductase	NA	A0A2L2DJC0	Acanthamoeba_polyphaga_mimivirus	33.7	3.2e-34
WP_009334807.1|2316765_2317668_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A222YY99	Synechococcus_phage	27.6	8.3e-20
WP_026041754.1|2317873_2318944_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_064328213.1|2319146_2319584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019380289.1|2319561_2320284_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	37.7	2.9e-39
WP_019380290.1|2320301_2321810_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	29.0	9.3e-24
>prophage 6
NZ_CP015506	Bacillus oceanisediminis 2691 chromosome, complete genome	5461741	3855890	3905921	5461741	coat,protease,integrase,transposase	Bacillus_phage(25.0%)	58	3855834:3855847	3867395:3867408
3855834:3855847	attL	GCAAAAAGAAAAAG	NA	NA	NA	NA
WP_167543169.1|3855890_3856208_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	38.5	3.5e-10
WP_167543170.1|3856186_3856555_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_019380396.1|3857181_3857862_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_009332733.1|3858415_3859192_-	sporulation protein YpjB	NA	NA	NA	NA	NA
WP_009332734.1|3859340_3859937_-	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_009332735.1|3860060_3860828_-	menaquinol-cytochrome c reductase cytochrome b/c subunit	NA	NA	NA	NA	NA
WP_009332736.1|3860871_3861546_-	cytochrome b6	NA	NA	NA	NA	NA
WP_009332737.1|3861549_3862056_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_019380393.1|3862205_3862670_-	YpiF family protein	NA	NA	NA	NA	NA
WP_009332739.1|3862794_3863340_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	52.7	2.0e-45
WP_019380392.1|3863428_3864691_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_019380391.1|3864710_3865616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009332742.1|3865816_3867112_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_009332743.1|3867155_3868262_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
3867395:3867408	attR	CTTTTTCTTTTTGC	NA	NA	NA	NA
WP_019380390.1|3868352_3869453_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_009332745.1|3869539_3869914_-	chorismate mutase	NA	NA	NA	NA	NA
WP_019380389.1|3869978_3871055_-	3-dehydroquinate synthase	NA	A0A0P0C619	Ostreococcus_mediterraneus_virus	25.7	3.6e-22
WP_009332747.1|3871054_3872227_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	37.1	1.5e-45
WP_019380388.1|3872435_3873209_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_019380387.1|3873330_3873777_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.8	1.2e-27
WP_019380386.1|3873944_3874907_-	heptaprenyl diphosphate synthase component II	NA	NA	NA	NA	NA
WP_009332751.1|3874990_3875692_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_019380385.1|3875695_3876505_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_019380384.1|3876785_3877022_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_009332754.1|3877142_3877709_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.3	1.0e-47
WP_009332755.1|3877927_3878200_-	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	80.0	1.6e-30
WP_019380383.1|3878637_3880116_-	stage IV sporulation protein A	NA	NA	NA	NA	NA
WP_019380381.1|3880465_3881179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019380380.1|3881204_3881408_-	DUF2768 domain-containing protein	NA	NA	NA	NA	NA
WP_026041599.1|3881651_3882713_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_009332760.1|3882808_3884119_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_009332761.1|3884356_3884542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009332762.1|3884545_3885433_-	YIEGIA domain-containing protein	NA	NA	NA	NA	NA
WP_009332763.1|3885429_3886038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009332764.1|3886185_3886329_+	YpzI family protein	NA	NA	NA	NA	NA
WP_009332765.1|3886709_3887771_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_009332766.1|3887783_3888923_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_009332767.1|3889280_3889862_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_026041598.1|3889858_3890539_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_009332769.1|3890729_3890912_-	YpfB family protein	NA	NA	NA	NA	NA
WP_009332770.1|3891002_3891662_-	flagellar brake domain-containing protein	NA	NA	NA	NA	NA
WP_009332771.1|3891809_3893159_-	germination protein YpeB	NA	NA	NA	NA	NA
WP_009332772.1|3893173_3894013_-	spore cortex-lytic enzyme	NA	A0A172JHR8	Bacillus_phage	42.5	2.4e-21
WP_009332773.1|3894138_3894828_-|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
WP_019380375.1|3894960_3895929_+	asparaginase	NA	NA	NA	NA	NA
WP_026041597.1|3895960_3896938_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_019380373.1|3897340_3898615_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_009332777.1|3899033_3899615_-	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_009332778.1|3899738_3900644_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009332779.1|3900715_3901486_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_009332780.1|3901514_3901919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019380372.1|3901978_3902611_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_019380371.1|3902757_3902982_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_009332783.1|3902984_3903245_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_009332784.1|3903321_3903891_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_019380370.1|3903948_3904407_-	YpbF family protein	NA	NA	NA	NA	NA
WP_019380369.1|3904499_3905243_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_019380368.1|3905297_3905921_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP015506	Bacillus oceanisediminis 2691 chromosome, complete genome	5461741	4279654	4338652	5461741	tRNA,integrase,protease,coat	Bacillus_phage(37.5%)	54	4275129:4275147	4337612:4337630
4275129:4275147	attL	GCCTTCTTCAAAATCAAGC	NA	NA	NA	NA
WP_009333094.1|4279654_4280794_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	1.0e-83
WP_019382917.1|4280885_4281914_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_009333097.1|4281941_4282148_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_019382918.1|4282144_4283146_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.1	3.6e-08
WP_019382919.1|4283199_4283811_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_019382920.1|4283973_4284537_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6D2	Bacillus_phage	43.2	5.9e-32
WP_019382921.1|4284776_4285325_-	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_009333102.1|4285488_4286232_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_033196616.1|4286342_4287335_-	phosphotransferase	NA	NA	NA	NA	NA
WP_064328224.1|4287318_4289328_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_019380311.1|4289749_4290856_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_019380310.1|4291163_4292000_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_019380309.1|4291968_4293552_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_019380308.1|4293693_4294836_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_009333110.1|4294901_4295444_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_019380307.1|4295511_4296390_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_009333112.1|4296521_4296977_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_009333113.1|4297002_4298295_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_009333114.1|4298436_4298988_-	sporulation initiation phosphotransferase B	NA	NA	NA	NA	NA
WP_009333115.1|4299226_4299520_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_009333116.1|4299520_4299859_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_009333117.1|4299872_4300181_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_026041595.1|4300471_4301926_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_009333121.1|4301980_4302847_-	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_009333122.1|4302839_4303616_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_019380305.1|4303753_4304557_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_009333124.1|4304558_4305236_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_019380304.1|4305509_4306025_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_019380303.1|4306021_4306906_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_009333129.1|4307084_4308107_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_009333132.1|4308267_4308957_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_019380302.1|4309008_4309578_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_019380301.1|4309810_4310890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026041594.1|4311084_4311837_-	A24 family peptidase	NA	NA	NA	NA	NA
WP_019380298.1|4312117_4313767_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.6	6.4e-18
WP_019380297.1|4313919_4315227_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_019380296.1|4315299_4317945_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	2.4e-160
WP_009333146.1|4318701_4319760_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_019380293.1|4319869_4321141_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_162272014.1|4321395_4321566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009333149.1|4321645_4322932_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_009333151.1|4322996_4323977_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_019380292.1|4323976_4324759_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_009333155.1|4324755_4325691_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_009333156.1|4326246_4327080_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_009333158.1|4327094_4328444_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_009333160.1|4328672_4329158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175502146.1|4329630_4330353_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	2.1e-29
WP_175502145.1|4330382_4331009_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_019383241.1|4331111_4331897_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009333164.1|4332226_4332808_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_009333165.1|4332804_4335132_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	2.1e-176
WP_009333166.1|4335417_4337085_-|protease	ATP-dependent protease LonB	protease	NA	NA	NA	NA
WP_009333167.1|4337386_4338652_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.2	1.2e-149
4337612:4337630	attR	GCCTTCTTCAAAATCAAGC	NA	NA	NA	NA
