The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	18718	57938	4777154	transposase,protease	uncultured_Mediterranean_phage(14.29%)	42	NA	NA
WP_005331315.1|18718_20062_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_005331316.1|20142_21399_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_041204876.1|21417_21675_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_005331319.1|21674_21947_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_005331320.1|21943_22579_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_005331321.1|22581_23082_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_041204877.1|23089_23869_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_005331323.1|23868_24669_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.5e-20
WP_041204878.1|24875_25871_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.9	6.5e-42
WP_005331333.1|25870_26425_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	61.2	1.7e-39
WP_005331338.1|26421_26982_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_041204879.1|26968_27487_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010675872.1|27499_28225_+	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	6.0e-21
WP_041204880.1|28290_29730_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_005305957.1|29750_30038_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_005331355.1|30040_30487_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_041204881.1|30527_31394_+	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	33.3	1.1e-10
WP_005331359.1|31414_31687_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_041204883.1|32855_33977_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IT49	uncultured_Mediterranean_phage	24.9	1.8e-19
WP_041204884.1|34066_35428_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.5	1.4e-23
WP_005331369.1|35509_35890_-	YhcB family protein	NA	NA	NA	NA	NA
WP_041204885.1|36029_37124_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_005336289.1|37390_37819_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_005331372.1|37833_38226_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_025328515.1|38526_39117_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_005331374.1|39119_40337_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_041204887.1|40333_41068_+	cytochrome c1	NA	NA	NA	NA	NA
WP_025328513.1|41155_41785_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_025328512.1|41802_42210_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	48.5	1.7e-28
WP_005331387.1|42256_42835_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_005331389.1|42839_43430_-	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	29.1	7.3e-09
WP_081805612.1|43439_43835_-	YraN family protein	NA	NA	NA	NA	NA
WP_081805613.1|43752_45663_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_041204888.1|45742_46576_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.8	1.6e-49
WP_041204889.1|47196_48777_+	DUF3258 domain-containing protein	NA	NA	NA	NA	NA
WP_012564931.1|48780_49728_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_049832137.1|49956_51042_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_019706001.1|51396_52344_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_041204891.1|53037_54174_-|transposase	ISAs1-like element ISAeme1 family transposase	transposase	NA	NA	NA	NA
WP_148304680.1|54594_55449_-	hypothetical protein	NA	A0A0N9SHY1	Staphylococcus_phage	36.1	5.6e-18
WP_005329258.1|55660_56290_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.0	3.5e-09
WP_041204896.1|56906_57938_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	87385	147008	4777154	transposase,protease	Rhizobium_phage(12.5%)	48	NA	NA
WP_041204891.1|87385_88522_-|transposase	ISAs1-like element ISAeme1 family transposase	transposase	NA	NA	NA	NA
WP_005329217.1|88966_89830_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_041204907.1|89833_90304_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_041206797.1|90440_91013_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A076YN96	Rhizobium_phage	32.6	2.2e-10
WP_005329211.1|91289_92054_+	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_005329209.1|92122_94783_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_041204909.1|94948_96835_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_025328438.1|96988_98416_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.3e-43
WP_005329200.1|98544_99501_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	34.8	8.5e-15
WP_005329198.1|99497_99812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005329196.1|100231_100444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005329194.1|100589_102500_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.8	4.3e-18
WP_041204910.1|102779_105077_+	patatin-like phospholipase domain-containing protein	NA	A0A1V0SFX9	Hokovirus	27.5	7.8e-06
WP_041206798.1|105305_107903_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_005329188.1|108146_109721_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_041204911.1|109727_110639_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.9	7.6e-13
WP_005329170.1|110715_111333_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005329169.1|111450_112857_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_041204913.1|112928_114056_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_041204915.1|114130_115528_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_041206799.1|115544_116030_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_005329164.1|116135_116645_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_005329162.1|116644_117016_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_041204917.1|117187_117850_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_041204919.1|118553_119573_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011191341.1|121476_122751_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_025328417.1|122852_123452_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_041204923.1|124407_125550_+|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_041204925.1|125586_127038_+	histidine acid phosphatase	NA	A0A218MNG5	uncultured_virus	32.0	3.4e-31
WP_049832139.1|127100_127967_-	EamA family transporter	NA	NA	NA	NA	NA
WP_005330581.1|128073_128490_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_041204928.1|128501_129629_-|transposase	ISAs1-like element ISKpn9 family transposase	transposase	NA	NA	NA	NA
WP_081805618.1|129951_130563_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_041204932.1|130562_132227_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_005323487.1|132309_133740_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_005323489.1|133927_134875_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	26.8	8.1e-18
WP_005323502.1|135012_135963_+	AEC family transporter	NA	NA	NA	NA	NA
WP_041204934.1|135967_137263_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_041204936.1|137526_137832_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_005323508.1|137871_139197_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_005323509.1|139250_140636_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_005323512.1|140709_141021_+	PTS N,N'-diacetylchitobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_005323514.1|141032_141962_+	ROK family protein	NA	NA	NA	NA	NA
WP_005323515.1|142186_143326_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_041204938.1|143458_144421_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_041204941.1|144483_144678_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_005323518.1|144807_145848_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_010676219.1|145910_147008_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	310457	320692	4777154	tRNA,transposase	Lactobacillus_phage(14.29%)	8	NA	NA
WP_041205045.1|310457_311522_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	36.2	4.9e-11
WP_099993964.1|311681_312698_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_005331913.1|313798_314782_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.7	4.9e-34
WP_005331910.1|314869_315883_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	3.1e-108
WP_005309452.1|316062_316278_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005331908.1|316293_316737_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	2.0e-27
WP_005331907.1|316825_318613_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.4	4.0e-74
WP_081805626.1|318826_320692_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 4
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	366752	421969	4777154	tRNA,transposase	Bacillus_phage(25.0%)	46	NA	NA
WP_041206812.1|366752_367655_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_005329052.1|367767_368217_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004576012.1|368270_369689_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_005327571.1|369880_370618_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_005327573.1|370614_371160_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_041205066.1|371396_373844_+	ATP-dependent helicase HrpB	NA	M1PGM1	Moumouvirus	28.4	1.9e-26
WP_005327576.1|374108_376430_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_005327577.1|376472_376883_+	VOC family protein	NA	NA	NA	NA	NA
WP_005327579.1|376953_377274_-	multidrug transporter	NA	NA	NA	NA	NA
WP_041205067.1|377261_377654_-	multidrug transporter	NA	NA	NA	NA	NA
WP_041205069.1|377812_378694_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041205070.1|378748_379264_-	DUF2937 family protein	NA	NA	NA	NA	NA
WP_005327588.1|379473_380190_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_005327590.1|380436_381342_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_162472483.1|381397_381535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327593.1|381573_382398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005327596.1|382608_383895_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_041205071.1|384117_385512_+	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_041205072.1|385599_386292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025328177.1|386381_386732_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	49.5	6.7e-26
WP_010674210.1|392799_394413_-|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
WP_005327991.1|394545_395178_+	LysE family translocator	NA	NA	NA	NA	NA
WP_005309538.1|395266_395563_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_041205073.1|395588_396554_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005327981.1|396894_398253_+	TolC family protein	NA	NA	NA	NA	NA
WP_041206813.1|398353_399331_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005327974.1|399330_400467_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005327972.1|400463_401669_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005327970.1|401747_402383_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041205075.1|402509_403364_-	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	28.4	6.2e-09
WP_041206814.1|403430_404105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005327964.1|404418_405390_+	response regulator	NA	NA	NA	NA	NA
WP_041205076.1|405462_406860_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	38.8	1.4e-79
WP_041205077.1|407073_407985_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.9	2.0e-61
WP_005327958.1|408079_408400_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_005327957.1|408565_409321_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_005327955.1|409412_409709_-	YciI family protein	NA	NA	NA	NA	NA
WP_005327953.1|409732_410284_-	septation protein A	NA	NA	NA	NA	NA
WP_005327951.1|410418_411951_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_041205078.1|412182_412818_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_005327944.1|412936_414598_+	putative transporter	NA	NA	NA	NA	NA
WP_004576012.1|416347_417766_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_012564931.1|418007_418955_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_099993964.1|419175_420192_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_049832144.1|420263_420710_+	hypothetical protein	NA	A0A0U1W0F5	Pseudomonas_phage	42.2	1.0e-31
WP_041204891.1|420832_421969_+|transposase	ISAs1-like element ISAeme1 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	434641	493883	4777154	tRNA,transposase	Tupanvirus(28.57%)	41	NA	NA
WP_041204928.1|434641_435769_-|transposase	ISAs1-like element ISKpn9 family transposase	transposase	NA	NA	NA	NA
WP_041205087.1|436576_437770_+	multidrug efflux MFS transporter MdtH	NA	NA	NA	NA	NA
WP_148304728.1|437972_444458_-	VCBS domain-containing protein	NA	NA	NA	NA	NA
WP_004576012.1|444349_445768_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_041205088.1|446490_446853_-	DUF2061 domain-containing protein	NA	NA	NA	NA	NA
WP_005325909.1|447034_447241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005325910.1|447322_448177_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_005325916.1|448170_448632_-	DUF2390 domain-containing protein	NA	NA	NA	NA	NA
WP_005325918.1|448624_450535_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	32.8	2.1e-73
WP_005325920.1|450687_451098_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_041204896.1|451446_452478_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_099993964.1|452647_453664_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_041205091.1|453775_454843_+	porin	NA	Q1MVN1	Enterobacteria_phage	33.7	6.3e-43
WP_041204923.1|455338_456481_+|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_041205093.1|457508_458117_-	arylesterase	NA	NA	NA	NA	NA
WP_005325231.1|458174_458885_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.9e-32
WP_005325230.1|458881_461323_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_005325229.1|461387_462293_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_041205096.1|462554_464105_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005325227.1|464232_465414_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005325226.1|465615_466683_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_041205099.1|466960_467674_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005325222.1|467717_468050_+	YggL family protein	NA	NA	NA	NA	NA
WP_005325214.1|468149_469070_+	glutaminase B	NA	NA	NA	NA	NA
WP_041205101.1|469099_470392_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_041205103.1|470594_470804_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_005325210.1|470847_474411_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.8	2.0e-16
WP_005325209.1|474510_475788_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080675078.1|476260_476482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099993964.1|477584_478601_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_041205105.1|478767_479862_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_005326773.1|480166_481207_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_081805630.1|481356_481692_-	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_041205107.1|481788_482760_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_041205109.1|482756_483908_-	galactokinase	NA	NA	NA	NA	NA
WP_041205111.1|483904_484951_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_041205112.1|485002_486016_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.8	1.0e-82
WP_041205116.1|486897_489174_-	immune inhibitor A	NA	NA	NA	NA	NA
WP_041206820.1|489606_489942_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_041205051.1|490033_491371_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_004576012.1|492464_493883_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	818240	884107	4777154	tRNA,transposase,protease	Salmonella_phage(16.67%)	44	NA	NA
WP_005330603.1|818240_819440_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_041205253.1|819488_820826_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005331295.1|820954_823435_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_005331291.1|824019_825276_-	adenylosuccinate synthetase	NA	A0A2R8FF47	Brazilian_cedratvirus	31.1	1.9e-46
WP_005331284.1|825445_826354_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041205255.1|826647_828027_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_005331282.1|828221_829364_-	PatB family C-S lyase	NA	NA	NA	NA	NA
WP_005331280.1|829527_830700_+	MFS transporter	NA	NA	NA	NA	NA
WP_005331279.1|830769_831654_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005331278.1|831741_832497_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_041205257.1|832718_833726_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.4	7.8e-19
WP_005331270.1|833969_835307_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_041205259.1|835667_838289_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	34.3	6.0e-87
WP_162852227.1|838404_838575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205261.1|838595_838952_-	MGMT family protein	NA	NA	NA	NA	NA
WP_005331260.1|839029_840583_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	43.9	5.4e-35
WP_005331253.1|840783_842649_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_041205271.1|842844_843717_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_041205273.1|843709_845425_-	glycoside hydrolase family 9 protein	NA	NA	NA	NA	NA
WP_041205274.1|845527_846520_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	7.2e-17
WP_005331243.1|846531_847554_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	8.5e-13
WP_005331241.1|847550_848465_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005331240.1|848466_849450_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_041205282.1|849567_851250_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005331236.1|852234_852444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205288.1|852589_853057_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041206848.1|853219_854545_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_081805644.1|855083_856181_-|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_011191341.1|856461_857736_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_041205297.1|859581_860856_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_011191341.1|861754_863029_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_012564931.1|864201_865149_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_005327117.1|866093_867107_-|transposase	IS21-like element ISAeme17 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.8	6.5e-74
WP_001162010.1|867721_868279_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
WP_005327104.1|868409_869897_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003056106.1|869883_870357_-	cytochrome c	NA	NA	NA	NA	NA
WP_041205303.1|870385_871096_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
WP_004393995.1|871097_872303_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023266980.1|872299_873451_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|873447_874056_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019706001.1|876174_877122_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_005323562.1|878811_879729_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	2.6e-101
WP_041205297.1|881775_883050_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_081805647.1|883159_884107_+|transposase	IS481-like element ISAeme21 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	900314	971396	4777154	tRNA,transposase	Bacillus_thuringiensis_phage(12.5%)	58	NA	NA
WP_041205051.1|900314_901652_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005331469.1|901696_902281_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	43.6	2.5e-41
WP_005331467.1|902569_902914_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_041205332.1|902979_904191_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005331463.1|904401_906387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205334.1|906383_906707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205337.1|906870_907509_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_005331459.1|907508_908420_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004576012.1|908424_909843_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_005328858.1|910242_910506_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_005328857.1|910567_911410_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_005328856.1|911402_912155_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_161507826.1|912199_912607_+	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_041205339.1|912694_913159_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005328853.1|913351_914647_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.1	3.7e-13
WP_005328852.1|914808_915366_+	DUF3332 domain-containing protein	NA	NA	NA	NA	NA
WP_041205341.1|915453_916827_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_005328849.1|917064_917817_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_005328848.1|917813_918428_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_005328846.1|918697_920407_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_041205344.1|920788_922027_+	uracil-xanthine permease	NA	NA	NA	NA	NA
WP_041205346.1|922177_922918_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_005328842.1|923168_923735_+	lipoprotein	NA	NA	NA	NA	NA
WP_041205347.1|923807_924818_-	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_005328840.1|924931_925690_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041205348.1|925939_926122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021141311.1|926871_928008_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_049832153.1|929752_931198_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	1.2e-17
WP_004576012.1|931152_932571_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_005328697.1|932792_933770_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005328698.1|933800_935408_+	glycosyl hydrolase family 3	NA	NA	NA	NA	NA
WP_041205349.1|935534_937706_+	sugar-binding protein	NA	NA	NA	NA	NA
WP_005328700.1|937802_938411_-	LysE family translocator	NA	NA	NA	NA	NA
WP_005328701.1|938534_941852_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_041205351.1|942001_943414_-	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_005328704.1|943792_944923_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005328706.1|945079_946450_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.3	8.2e-112
WP_041205352.1|946625_947237_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_005328710.1|947260_948367_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005328711.1|948524_948992_-	NUDIX hydrolase	NA	A0A023W5N2	Serratia_phage	62.2	8.6e-05
WP_041205353.1|948988_949921_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_005328714.1|950056_950824_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005328715.1|950824_951130_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_005328717.1|951342_952749_-	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_005328732.1|953212_955117_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_081805649.1|955614_955986_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012564931.1|956523_957471_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_041206859.1|957791_958046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205354.1|958250_958694_-	CopD family protein	NA	NA	NA	NA	NA
WP_041205355.1|959713_962038_+	Ig-like domain-containing protein	NA	J9Q6D6	Salmonella_phage	27.6	5.1e-05
WP_005328918.1|962235_964122_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_005328920.1|964796_964946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005328921.1|965085_965634_-	YgjV family protein	NA	NA	NA	NA	NA
WP_005328923.1|965822_967022_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_041205357.1|967151_968027_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005328927.1|968222_969476_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.6e-13
WP_005328937.1|969570_969747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205358.1|970067_971396_-|transposase	IS4-like element ISAeme12 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	1013645	1037439	4777154	transposase	Helicobacter_phage(28.57%)	22	NA	NA
WP_081805654.1|1013645_1014062_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.1	4.9e-44
WP_041205370.1|1014083_1015289_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	61.1	1.2e-135
WP_041205372.1|1016483_1016846_-	copper-binding protein	NA	NA	NA	NA	NA
WP_041205373.1|1016892_1020015_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005330267.1|1020088_1021606_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_041205374.1|1021855_1022362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205378.1|1022560_1023367_-	exodeoxyribonuclease III	NA	A0A0N9QXX6	Chrysochromulina_ericina_virus	27.5	5.7e-12
WP_041205379.1|1023592_1024555_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_041205574.1|1024666_1025092_-|transposase	IS200/IS605-like element ISAeme8 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	46.9	4.9e-23
WP_041206863.1|1025149_1026289_+|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	68.7	7.2e-146
WP_005326910.1|1026352_1027999_-	response regulator	NA	NA	NA	NA	NA
WP_041205380.1|1028276_1028702_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	40.0	3.9e-12
WP_005326908.1|1028744_1029785_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_041205381.1|1030086_1030527_+	azurin	NA	NA	NA	NA	NA
WP_041205382.1|1030718_1030922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005326904.1|1030935_1031496_-	HutD family protein	NA	NA	NA	NA	NA
WP_005326903.1|1031760_1032729_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005326902.1|1032831_1033161_+	DUF3634 family protein	NA	NA	NA	NA	NA
WP_005326901.1|1033264_1034173_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005326900.1|1034293_1034737_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_019706001.1|1035194_1036142_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_041205384.1|1036341_1037439_+|transposase	ISAs1-like element ISAeme2 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	1044537	1105465	4777154	tRNA,transposase	Staphylococcus_prophage(30.0%)	45	NA	NA
WP_041205253.1|1044537_1045875_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_041205389.1|1045998_1047102_-	YdcF family protein	NA	NA	NA	NA	NA
WP_005332127.1|1047251_1048145_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081805658.1|1048245_1048734_+	DMT family transporter	NA	NA	NA	NA	NA
WP_041205391.1|1048744_1049173_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005332143.1|1049451_1049694_-	DUF3297 family protein	NA	NA	NA	NA	NA
WP_005332142.1|1049792_1051109_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_049832154.1|1051092_1051389_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041204928.1|1051918_1053046_-|transposase	ISAs1-like element ISKpn9 family transposase	transposase	NA	NA	NA	NA
WP_019706001.1|1053185_1054133_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_148304683.1|1054738_1057411_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_005325277.1|1057429_1058911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005325275.1|1059195_1060566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205393.1|1061070_1062273_-	sugar transporter	NA	NA	NA	NA	NA
WP_005325270.1|1062288_1062939_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	2.0e-07
WP_041205394.1|1062961_1063762_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_041205395.1|1063825_1065601_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_041205396.1|1065625_1066000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011191341.1|1066547_1067822_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_005328138.1|1068819_1069461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005328140.1|1069555_1070398_-	pyruvate formate lyase 1-activating protein	NA	M4MAG2	Vibrio_phage	37.5	9.2e-05
WP_005328143.1|1070473_1073413_-	GGDEF and EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.7	1.9e-09
WP_041205397.1|1073547_1075236_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_148304684.1|1075345_1076362_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.2	7.0e-185
WP_081805660.1|1076461_1077382_+	MFS transporter	NA	NA	NA	NA	NA
WP_041205398.1|1077477_1077906_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_041205399.1|1077955_1079122_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	67.9	7.4e-146
WP_041205400.1|1079233_1080268_-	DUF2955 domain-containing protein	NA	NA	NA	NA	NA
WP_005325891.1|1080276_1081368_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_041205402.1|1081360_1082878_-	TolC family protein	NA	NA	NA	NA	NA
WP_041205404.1|1084013_1084961_+|transposase	IS30-like element ISAeca1 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.7	6.0e-45
WP_081805859.1|1085501_1090439_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_041205406.1|1090449_1092849_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_041206870.1|1092921_1093881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005326435.1|1094056_1095505_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_005326432.1|1095579_1095972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025326511.1|1096073_1096706_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_005326428.1|1097122_1098010_+	flagellin	NA	NA	NA	NA	NA
WP_005326427.1|1098240_1098510_+	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_005326426.1|1098538_1099918_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_041204891.1|1100364_1101501_-|transposase	ISAs1-like element ISAeme1 family transposase	transposase	NA	NA	NA	NA
WP_041205407.1|1101631_1101955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099369027.1|1101959_1102976_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	4.9e-186
WP_041205409.1|1103494_1104442_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.2e-40
WP_012564931.1|1104517_1105465_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
>prophage 11
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	1151480	1203626	4777154	transposase	Escherichia_phage(22.22%)	42	NA	NA
WP_011191341.1|1151480_1152755_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_041205431.1|1152948_1153395_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_005330120.1|1153451_1154711_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_049832155.1|1154913_1155384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005330115.1|1155818_1157162_-	dihydroorotase	NA	NA	NA	NA	NA
WP_041205433.1|1157241_1158117_+	6-carboxytetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.1	1.4e-11
WP_005330109.1|1160462_1160813_+	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_005330108.1|1160812_1162234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205436.1|1162300_1162699_+	YcfL family protein	NA	NA	NA	NA	NA
WP_041205438.1|1162698_1163295_+	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_041205440.1|1163284_1164148_+	phosphotransferase	NA	NA	NA	NA	NA
WP_041205443.1|1164201_1165062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205445.1|1165130_1165628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205447.1|1165815_1166982_+|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	67.9	7.4e-146
WP_041205449.1|1167188_1167593_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	1.1e-29
WP_021141234.1|1167650_1168877_+|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_041205451.1|1168938_1170708_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_171269622.1|1170808_1171723_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.7	1.3e-33
WP_005331588.1|1171802_1172405_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	35.3	7.2e-20
WP_041205454.1|1172615_1173533_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_005331593.1|1175835_1177644_+	M3 family oligoendopeptidase	NA	A0A1X9I5X5	Streptococcus_phage	22.9	1.6e-09
WP_005331594.1|1177853_1178393_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005331597.1|1178467_1179760_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005331601.1|1181016_1181334_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012564931.1|1181883_1182831_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_005327567.1|1183797_1186059_-	LTA synthase family protein	NA	NA	NA	NA	NA
WP_041205459.1|1186309_1187404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327565.1|1187540_1188893_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_148304685.1|1188957_1189137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206877.1|1189310_1190639_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_005327561.1|1190891_1191524_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_041206878.1|1191790_1192126_-	DUF3802 family protein	NA	NA	NA	NA	NA
WP_005327557.1|1192137_1192674_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005327555.1|1192679_1193051_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_041205463.1|1193159_1193969_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005327551.1|1194007_1194913_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041205465.1|1195048_1196746_+	L-lactate permease	NA	NA	NA	NA	NA
WP_081805666.1|1196758_1197535_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_005327547.1|1197527_1198964_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_041205467.1|1198965_1199610_+	LUD domain-containing protein	NA	NA	NA	NA	NA
WP_041205469.1|1199609_1202402_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_099369027.1|1202609_1203626_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	4.9e-186
>prophage 12
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	1227204	1271364	4777154	integrase,transposase	Staphylococcus_prophage(50.0%)	36	1233490:1233513	1271374:1271397
WP_010674210.1|1227204_1228818_-|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
WP_049832156.1|1229021_1229855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049832157.1|1229851_1231633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205484.1|1231697_1232210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012564931.1|1232525_1233473_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
1233490:1233513	attL	GCACTTCGAAGTTGAATTCGCGCT	NA	NA	NA	NA
WP_005327636.1|1234748_1235975_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	29.2	2.4e-22
WP_005327660.1|1236281_1236728_-	DUF2787 family protein	NA	NA	NA	NA	NA
WP_005327662.1|1236794_1237280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005327664.1|1237299_1237824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019706001.1|1238073_1239021_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_041205486.1|1239465_1239828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148304686.1|1239824_1240067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081805667.1|1240292_1240532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019706001.1|1240785_1241733_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_041205490.1|1242790_1244527_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.3	1.0e-29
WP_148304730.1|1245203_1246145_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099369027.1|1246205_1247222_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	4.9e-186
WP_005330929.1|1247484_1248084_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_005330931.1|1248365_1250279_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.2	1.0e-115
WP_005330936.1|1250532_1251177_+	adenylate kinase	NA	NA	NA	NA	NA
WP_041205492.1|1251291_1252266_+	ferrochelatase	NA	NA	NA	NA	NA
WP_005325024.1|1252330_1252723_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_158319058.1|1252909_1253059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103244595.1|1253121_1254550_+|transposase	IS66-like element ISAeme23 family transposase	transposase	NA	NA	NA	NA
WP_041205499.1|1254565_1255522_+	ferrochelatase	NA	NA	NA	NA	NA
WP_005325024.1|1255586_1255979_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_041205502.1|1256165_1257470_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_010674427.1|1259373_1259736_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_041205505.1|1259907_1260402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205507.1|1260364_1262002_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041205509.1|1262189_1263464_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_041206884.1|1263542_1265543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005326480.1|1265678_1266230_-	lipoprotein	NA	NA	NA	NA	NA
WP_041205511.1|1266552_1267740_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_005326477.1|1267816_1269478_+	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_019706001.1|1270416_1271364_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
1271374:1271397	attR	GCACTTCGAAGTTGAATTCGCGCT	NA	NA	NA	NA
>prophage 13
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	1314251	1408338	4777154	portal,terminase,tail,transposase,protease,integrase	Aeromonas_phage(15.79%)	88	1325382:1325397	1410631:1410646
WP_049832160.1|1314251_1315445_+|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	45.1	1.8e-86
WP_005324058.1|1315603_1316071_-	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	62.7	2.2e-48
WP_005324055.1|1316067_1316682_-	3'-5' exoribonuclease	NA	A0A1U9ZA60	Proteus_phage	27.1	2.7e-14
WP_041205538.1|1316703_1317003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205544.1|1317016_1317433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005324029.1|1317519_1317711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205547.1|1317707_1318166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005324025.1|1318155_1318323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005324021.1|1320166_1320511_-	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	59.1	4.4e-22
WP_081805672.1|1320645_1321230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205550.1|1321434_1322085_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	47.7	1.7e-43
WP_049832161.1|1322172_1322349_+	helix-turn-helix domain-containing protein	NA	H9C161	Pectobacterium_phage	51.0	2.6e-07
WP_049832162.1|1322345_1322867_+	phage regulatory CII family protein	NA	NA	NA	NA	NA
WP_005324016.1|1322944_1323157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049832163.1|1323149_1324070_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	44.3	8.4e-20
WP_005324011.1|1324069_1324738_+	replication P family protein	NA	A0A1I9KFB0	Aeromonas_phage	69.1	2.8e-81
WP_193354202.1|1324724_1325093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148304688.1|1325098_1325374_+	hypothetical protein	NA	NA	NA	NA	NA
1325382:1325397	attL	CCTGATGGTGGTGGTG	NA	NA	NA	NA
WP_102948395.1|1325459_1326161_+	phage antirepressor KilAC domain-containing protein	NA	A0A1I9KFA9	Aeromonas_phage	57.3	1.5e-61
WP_005324004.1|1326157_1326355_+	DUF3283 family protein	NA	NA	NA	NA	NA
WP_148304689.1|1326351_1327344_+	DUF968 domain-containing protein	NA	R9TRM9	Vibrio_phage	34.9	8.2e-29
WP_041205558.1|1327330_1327717_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1J0GV15	Halomonas_phage	45.8	1.5e-18
WP_148304731.1|1327793_1328333_+	antitermination protein	NA	NA	NA	NA	NA
WP_033132437.1|1328526_1328733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205562.1|1328735_1329227_+	lysozyme	NA	A0A193GZ38	Enterobacter_phage	39.3	3.0e-16
WP_042047481.1|1329226_1329766_+	DUF2514 domain-containing protein	NA	A0A2D1GNE2	Pseudomonas_phage	49.3	2.6e-05
WP_081805673.1|1329949_1330429_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	56.1	6.9e-42
WP_049832229.1|1330499_1332347_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	56.9	2.7e-190
WP_005323973.1|1332343_1332553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205568.1|1332549_1334112_+|portal	phage portal protein	portal	A0A0A0YUB7	Pseudomonas_phage	51.0	7.6e-138
WP_005323970.1|1334065_1336129_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	53.4	5.8e-194
WP_041205570.1|1336186_1336501_+	DUF2190 family protein	NA	A0A088C4T4	Shewanella_sp._phage	49.1	4.4e-05
WP_005323966.1|1336500_1336797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005323964.1|1336804_1337413_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	37.6	1.2e-19
WP_005323962.1|1337447_1337615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205572.1|1337647_1338049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005323958.1|1338048_1338525_+|tail	putative major tail protein	tail	M9NYX0	Enterobacteria_phage	45.0	2.4e-26
WP_005323956.1|1338521_1338959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148304690.1|1338976_1339294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049832164.1|1339274_1341401_+	hypothetical protein	NA	A0A2I7S778	Vibrio_phage	32.1	3.8e-31
WP_049832165.1|1341397_1342000_+	hypothetical protein	NA	A0A2I2L6V8	Escherichia_phage	41.8	2.5e-36
WP_005324799.1|1341996_1342581_+	hypothetical protein	NA	S4TND4	Salmonella_phage	51.9	5.3e-44
WP_005324797.1|1342583_1342985_+	hypothetical protein	NA	Q7Y3Z5	Yersinia_phage	52.3	1.5e-34
WP_049832166.1|1342984_1348807_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	40.0	1.2e-10
WP_005325293.1|1348863_1350525_+	hypothetical protein	NA	A0A1I9KFH7	Aeromonas_phage	39.9	6.2e-21
WP_005325297.1|1350521_1350836_+	hypothetical protein	NA	A0A2R4ALX6	Aeromonas_phage	81.6	1.2e-39
WP_041205574.1|1350972_1351398_-|transposase	IS200/IS605-like element ISAeme8 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	46.9	4.9e-23
WP_041206863.1|1351456_1352596_+|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	68.7	7.2e-146
WP_041205576.1|1353038_1353752_-	metallophosphoesterase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	59.5	3.1e-78
WP_041205242.1|1353972_1355310_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005332463.1|1355430_1357986_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_041205579.1|1357996_1358707_+	virulence factor	NA	NA	NA	NA	NA
WP_005332471.1|1359627_1360443_-	carbon-nitrogen hydrolase family protein	NA	M1HZ02	Paramecium_bursaria_Chlorella_virus	26.1	4.4e-12
WP_005332473.1|1360451_1361603_-	methionine aminotransferase	NA	NA	NA	NA	NA
WP_005332475.1|1361717_1362608_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005332477.1|1362714_1364214_-	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_041205582.1|1364227_1364926_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_005332481.1|1364922_1366614_-	ribulokinase	NA	NA	NA	NA	NA
WP_041205585.1|1366975_1367959_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005332486.1|1368031_1369531_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	3.0e-14
WP_004576012.1|1369763_1371182_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_041205587.1|1371421_1372108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005326786.1|1372104_1372566_+	YjiG family protein	NA	NA	NA	NA	NA
WP_041205590.1|1372578_1373745_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_005327996.1|1374908_1376327_-|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_041205593.1|1377410_1378322_+	arabinose operon transcriptional regulator AraC	NA	NA	NA	NA	NA
WP_005328277.1|1378409_1378535_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_005328284.1|1378534_1378801_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_005328287.1|1379056_1379311_+	DinI family protein	NA	NA	NA	NA	NA
WP_042649063.1|1379442_1380264_-	DUF2927 domain-containing protein	NA	NA	NA	NA	NA
WP_005328302.1|1380288_1380792_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005328305.1|1380922_1382566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205597.1|1382827_1384489_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_005328325.1|1384590_1385943_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_139751191.1|1386313_1387624_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	41.6	2.6e-83
WP_019706001.1|1387726_1388674_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_021141278.1|1388991_1390554_+|transposase	IS21-like element ISAs28 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.0	9.6e-125
WP_021141277.1|1390577_1391333_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.4	2.4e-52
WP_041204923.1|1391535_1392678_-|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_041205601.1|1393400_1394351_-|transposase	IS1595-like element ISAeca5 family transposase	transposase	NA	NA	NA	NA
WP_041205297.1|1394475_1395750_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_041205601.1|1396455_1397406_-|transposase	IS1595-like element ISAeca5 family transposase	transposase	NA	NA	NA	NA
WP_021141311.1|1397914_1399051_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_019706001.1|1399668_1400616_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_010676219.1|1401650_1402748_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_021141311.1|1404509_1405646_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_019706001.1|1406077_1407025_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_041205603.1|1407357_1408338_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1410631:1410646	attR	CACCACCACCATCAGG	NA	NA	NA	NA
>prophage 14
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	1438142	1540272	4777154	integrase,transposase	Enterococcus_phage(14.29%)	78	1468583:1468642	1549854:1549870
WP_021141311.1|1438142_1439279_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_005332462.1|1439543_1439843_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_041205613.1|1440420_1442001_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_005332460.1|1442087_1442669_+	thymidine kinase	NA	A0A0F6TIQ8	Escherichia_coli_O157_typing_phage	52.7	1.4e-49
WP_005332459.1|1442735_1444073_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_161507131.1|1444232_1444688_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_005330598.1|1445049_1446834_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_041205614.1|1446830_1447736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139750788.1|1448443_1449463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005330555.1|1449459_1450068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206912.1|1450067_1452827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021140990.1|1452823_1453696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021140991.1|1453851_1454796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005330548.1|1455105_1456929_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_099369133.1|1457221_1457611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005330546.1|1457923_1458508_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_041205615.1|1458504_1461075_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	30.5	4.1e-32
WP_005330541.1|1461183_1462401_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_005329232.1|1463078_1464389_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_005329233.1|1464388_1464643_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010674978.1|1465144_1465393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010674977.1|1465813_1466065_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_041206913.1|1466143_1467502_-	Fic family protein	NA	NA	NA	NA	NA
WP_041205616.1|1467705_1468158_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
1468583:1468642	attL	CCAGGGCCGACGCATGATCATTCTTTGCGCTAGTTGATCAAGTATCGATCAGTTGAGCGG	NA	NA	NA	NA
WP_041204928.1|1468718_1469846_+|transposase	ISAs1-like element ISKpn9 family transposase	transposase	NA	NA	NA	NA
1468583:1468642	attL	CCAGGGCCGACGCATGATCATTCTTTGCGCTAGTTGATCAAGTATCGATCAGTTGAGCGG	NA	NA	NA	NA
WP_148304691.1|1469821_1470361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205618.1|1470353_1472732_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005327392.1|1472716_1476025_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005327394.1|1476227_1477151_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_041205619.1|1477251_1477542_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_041206914.1|1477926_1478187_+	ADP-ribosylglycohydrolase	NA	NA	NA	NA	NA
WP_059169687.1|1478303_1478516_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042011229.1|1478639_1478849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327400.1|1478860_1480099_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	29.5	3.9e-36
WP_069785115.1|1480082_1480973_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_041205620.1|1481104_1482442_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_041205621.1|1482778_1483726_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.4	5.6e-43
WP_041205622.1|1483840_1484983_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_148304692.1|1485118_1485664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205625.1|1487112_1487457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143237846.1|1488080_1489097_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	4.9e-186
1487086:1488137	attR	CCGCTCAACTGATCGATACTTGATCAACTAGCGCAAAGAATGATCATGCGTCGGCCCTGGGAGTTTACAGAATTCATAGTCGCAATGCTCTGAGTAAAGGTGCGCGTTCTGTGCATACTCATCGTTAGTGTTTATCTTAATTTCTTGCATCGTCAGCCAAAAGTCACGATGGTTTCTCGGCTTAAAATAGATTTTTCGTTCAATGACCGAGTAAATAAAGCCTTGGTACAAGTAGACATGGAAGAGTTCATGGGCTGTGTTGTAACCATAAAGCAGGGTACGGTTTACCTTGTTTTTCAGATCGTCTCCTACCACCATTAATTTTGAGTCTTGAATAATACTGTTGATGACGTTTAATTCGGCAGAGTTCATATATCCTCGCTTTAGAGTGGTTTGCACGGCTCAGCACTATCCCAACTCATCAATGTCGGCGTACTCAATCCTGCCATCCTTCGCCGCTACCATGGAGCTATCATCCTCTTTTCCAAAGACGGCCACAACCCTGCCCAGACTACACGGTATAGTCGCTTTTATGAGGCCGACCAGTGGCCATTATGCAGGATCCATGCGGCCCGCAATGTCGCGGCCATCGGCGAGACTAGTGCGCGGGGCAAACAACCCATTAGTGGCTACTCGTCTGGCTGGCCTATGCCGAGTTTCGCACTCGGCATCGCTGGGAGCAGGGGGCCTTGTTGTGCTCTAAACATTACTGTGAGCGGTGCGCCTATTGCTACTATTGGATGACGAGATGTTGTGGCGGTTTATTGCAGGCGACGAGATTGCGTTGCGTGGGTATGTGTTCTGGCGCCAAGTAGTATTACCTCGTCAAAACGAGGTAATTTCCCTAGGGAAGGTGCGAATAAGCGGGGAAATTCTTCTCGGCTGACTCAGTCATTTCATTTCTTCATGTTTGAGCCGATTTTTTACTCCCGTAAATGCCTTGAATCAGCCTATTTAGACCGTTTCTTCGCCATTTAAGGCGTTATTCCCAGTTTTTAGTGAGATCTCTCCCACTGACGTATCATTTGGTCCGCCCGAAACAGGTTGGCCAG	NA	NA	NA	NA
WP_148304693.1|1490276_1490873_+	hypothetical protein	NA	NA	NA	NA	NA
1487086:1488137	attR	CCGCTCAACTGATCGATACTTGATCAACTAGCGCAAAGAATGATCATGCGTCGGCCCTGGGAGTTTACAGAATTCATAGTCGCAATGCTCTGAGTAAAGGTGCGCGTTCTGTGCATACTCATCGTTAGTGTTTATCTTAATTTCTTGCATCGTCAGCCAAAAGTCACGATGGTTTCTCGGCTTAAAATAGATTTTTCGTTCAATGACCGAGTAAATAAAGCCTTGGTACAAGTAGACATGGAAGAGTTCATGGGCTGTGTTGTAACCATAAAGCAGGGTACGGTTTACCTTGTTTTTCAGATCGTCTCCTACCACCATTAATTTTGAGTCTTGAATAATACTGTTGATGACGTTTAATTCGGCAGAGTTCATATATCCTCGCTTTAGAGTGGTTTGCACGGCTCAGCACTATCCCAACTCATCAATGTCGGCGTACTCAATCCTGCCATCCTTCGCCGCTACCATGGAGCTATCATCCTCTTTTCCAAAGACGGCCACAACCCTGCCCAGACTACACGGTATAGTCGCTTTTATGAGGCCGACCAGTGGCCATTATGCAGGATCCATGCGGCCCGCAATGTCGCGGCCATCGGCGAGACTAGTGCGCGGGGCAAACAACCCATTAGTGGCTACTCGTCTGGCTGGCCTATGCCGAGTTTCGCACTCGGCATCGCTGGGAGCAGGGGGCCTTGTTGTGCTCTAAACATTACTGTGAGCGGTGCGCCTATTGCTACTATTGGATGACGAGATGTTGTGGCGGTTTATTGCAGGCGACGAGATTGCGTTGCGTGGGTATGTGTTCTGGCGCCAAGTAGTATTACCTCGTCAAAACGAGGTAATTTCCCTAGGGAAGGTGCGAATAAGCGGGGAAATTCTTCTCGGCTGACTCAGTCATTTCATTTCTTCATGTTTGAGCCGATTTTTTACTCCCGTAAATGCCTTGAATCAGCCTATTTAGACCGTTTCTTCGCCATTTAAGGCGTTATTCCCAGTTTTTAGTGAGATCTCTCCCACTGACGTATCATTTGGTCCGCCCGAAACAGGTTGGCCAG	NA	NA	NA	NA
WP_041205384.1|1491649_1492747_-|transposase	ISAs1-like element ISAeme2 family transposase	transposase	NA	NA	NA	NA
WP_041205628.1|1494315_1495350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205629.1|1495549_1496497_-|transposase	IS30-like element ISAeme18 family transposase	transposase	H7BVY4	unidentified_phage	32.6	1.1e-30
WP_081805681.1|1496536_1496848_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	69.3	1.3e-25
WP_005330391.1|1497099_1498359_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	52.9	2.7e-117
WP_041206919.1|1498339_1498783_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	51.2	1.3e-26
WP_076611394.1|1499333_1500536_-|transposase	ISL3-like element ISAeme19 family transposase	transposase	A9YX10	Burkholderia_phage	53.2	1.0e-102
WP_081805682.1|1500694_1501216_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_005325951.1|1501260_1502322_-|transposase	IS701-like element ISAeme11 family transposase	transposase	NA	NA	NA	NA
WP_081805683.1|1502389_1502707_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	50.0	9.7e-08
WP_148304732.1|1502934_1503351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081805684.1|1503681_1504701_+	DUF4007 family protein	NA	NA	NA	NA	NA
WP_005330373.1|1504702_1508008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049832176.1|1508000_1508921_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0F7L647	uncultured_marine_virus	35.3	3.9e-25
WP_005330377.1|1508973_1511319_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_005330379.1|1511321_1513484_+	DEAD/DEAH box helicase family protein	NA	A0A2H4UTW8	Bodo_saltans_virus	22.7	2.4e-09
WP_041205634.1|1513483_1513714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005330381.1|1513694_1515755_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_041205635.1|1515747_1516203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081805685.1|1516195_1517245_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_005330384.1|1517269_1519294_-	DNA phosphorothioation-associated putative methyltransferase	NA	NA	NA	NA	NA
WP_158319060.1|1519293_1519830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205636.1|1519971_1523172_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005326705.1|1523168_1525559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081805686.1|1525551_1526130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005326701.1|1526373_1527606_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_005326697.1|1528349_1529207_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	32.2	2.3e-27
WP_005326695.1|1529307_1530471_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_041205638.1|1530571_1531600_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_005326691.1|1531997_1532636_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005326689.1|1532737_1533640_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005326687.1|1533699_1534440_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_139750670.1|1534627_1535593_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_041205641.1|1535861_1538006_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_041206923.1|1538098_1538890_+	siderophore ferric iron reductase	NA	NA	NA	NA	NA
WP_041205051.1|1538934_1540272_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
1549854:1549870	attR	GCAGCTCCACCCACTCG	NA	NA	NA	NA
>prophage 15
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	1607845	1657167	4777154	transposase	Bacillus_phage(18.18%)	40	NA	NA
WP_010676219.1|1607845_1608943_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_041206924.1|1609083_1609674_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_049832177.1|1609729_1611106_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	43.6	2.4e-47
WP_005323523.1|1611315_1612839_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_005323524.1|1612999_1613479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005323525.1|1613712_1613910_+	DUF4250 domain-containing protein	NA	NA	NA	NA	NA
WP_005323527.1|1614306_1616781_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	45.6	2.0e-15
WP_005323528.1|1616845_1617400_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_005323530.1|1617701_1619087_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_041205674.1|1619241_1619682_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.4	2.6e-11
WP_005323534.1|1619836_1622635_+	response regulator	NA	A0A1V0SGX0	Hokovirus	34.0	1.3e-66
WP_041205675.1|1622778_1624515_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.4	2.9e-53
WP_005323542.1|1624624_1626376_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	3.7e-48
WP_005323552.1|1626437_1627619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004576012.1|1628180_1629599_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_041204928.1|1629616_1630744_+|transposase	ISAs1-like element ISKpn9 family transposase	transposase	NA	NA	NA	NA
WP_041205678.1|1630719_1631910_+|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	68.1	3.7e-145
WP_005324917.1|1632209_1632683_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_005324920.1|1632755_1632989_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_005324922.1|1633179_1633584_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_005324924.1|1633580_1635365_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_041205680.1|1635457_1635808_-	phasin family protein	NA	NA	NA	NA	NA
WP_005324927.1|1636108_1636672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205682.1|1636750_1637506_+	DUF429 domain-containing protein	NA	NA	NA	NA	NA
WP_041205684.1|1637842_1638718_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_041205686.1|1638756_1639050_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_005324932.1|1639736_1640582_+	deoxyribonuclease IV	NA	A0A1V0SCI4	Indivirus	25.3	6.1e-17
WP_041205689.1|1640656_1641646_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_005324936.1|1641714_1642605_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041205690.1|1642708_1643689_+	TDT family transporter	NA	NA	NA	NA	NA
WP_041205691.1|1643914_1644904_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_041206926.1|1645056_1646052_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_005324946.1|1646236_1647097_+	RIO1 protein	NA	NA	NA	NA	NA
WP_005324950.1|1648620_1649253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005324952.1|1649437_1651867_+	DNA polymerase II	NA	L7TKF2	Halovirus	27.1	6.3e-30
WP_041205696.1|1652614_1653994_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005324956.1|1654145_1654352_-	YaeP family protein	NA	NA	NA	NA	NA
WP_005324958.1|1654488_1655106_+	riboflavin synthase	NA	NA	NA	NA	NA
WP_010674034.1|1655478_1655883_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	6.7e-30
WP_021141234.1|1655940_1657167_+|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
>prophage 16
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	1661708	1729087	4777154	transposase,bacteriocin	Vibrio_phage(16.67%)	54	NA	NA
WP_005323562.1|1661708_1662626_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	2.6e-101
WP_005331648.1|1662707_1662884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005331650.1|1663044_1663233_-	DUF4250 domain-containing protein	NA	NA	NA	NA	NA
WP_005331665.1|1663229_1663700_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005331682.1|1665354_1666230_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_005331684.1|1666231_1666543_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_005331685.1|1666588_1666912_-	YciU family protein	NA	NA	NA	NA	NA
WP_005331687.1|1667199_1667976_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_041205707.1|1667960_1668287_-	YciU family protein	NA	NA	NA	NA	NA
WP_041205708.1|1668465_1668735_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005331693.1|1668737_1669550_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_041205710.1|1669568_1670288_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_041205712.1|1670394_1670673_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_005331699.1|1670672_1671632_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_041204923.1|1671786_1672929_+|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_005325119.1|1673107_1674478_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_041205714.1|1674764_1676147_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_005325124.1|1676313_1676598_-	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_041205716.1|1676868_1678113_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_005325128.1|1678197_1678596_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005325129.1|1678728_1679892_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_041205719.1|1680342_1681647_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_041205722.1|1681718_1682942_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005325136.1|1683056_1684313_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_005325138.1|1684564_1685836_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_005325140.1|1686244_1686988_-	DUF3379 domain-containing protein	NA	NA	NA	NA	NA
WP_041206927.1|1687611_1689132_-	BatD family protein	NA	NA	NA	NA	NA
WP_005325155.1|1690657_1691617_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_041205724.1|1691613_1692177_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_041205726.1|1692161_1693052_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_005325158.1|1693175_1694126_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005325159.1|1694320_1695631_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_041206928.1|1695630_1697778_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_005325161.1|1698053_1698194_+	TIGR02808 family protein	NA	NA	NA	NA	NA
WP_005325163.1|1698384_1698942_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_005325165.1|1698954_1699839_+	AEC family transporter	NA	NA	NA	NA	NA
WP_148304695.1|1700122_1700374_-|bacteriocin	class IIc cyclic bacteriocin	bacteriocin	NA	NA	NA	NA
WP_005325170.1|1701079_1702696_-|transposase	IS66-like element ISAeme5 family transposase	transposase	A0A218MNE7	uncultured_virus	32.8	4.7e-42
WP_041205730.1|1702744_1703110_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005325174.1|1703109_1703412_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_041205731.1|1705424_1706693_-|transposase	IS4-like element ISAeme3 family transposase	transposase	NA	NA	NA	NA
WP_041206933.1|1707149_1708379_-	MFS transporter	NA	NA	NA	NA	NA
WP_005326120.1|1708440_1709211_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.6	2.4e-12
WP_005326119.1|1709203_1710256_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005326118.1|1710353_1711475_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005326114.1|1715408_1715948_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_005326113.1|1716295_1717918_+	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	25.0	2.8e-26
WP_005326112.1|1718127_1718826_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_005326111.1|1718892_1719213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205732.1|1719301_1719937_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	34.2	7.9e-17
WP_041205733.1|1719929_1720703_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_005326105.1|1720879_1724848_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	35.6	1.9e-52
WP_041205734.1|1724844_1726995_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_021141311.1|1727950_1729087_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	1746911	1821096	4777154	tRNA,transposase,protease,integrase	Catovirus(16.67%)	57	1738475:1738491	1819578:1819594
1738475:1738491	attL	CGTGGCCCAGGGGCTCG	NA	NA	NA	NA
WP_041205743.1|1746911_1747856_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_041205744.1|1748033_1748411_+	YbaN family protein	NA	NA	NA	NA	NA
WP_005327012.1|1748543_1749089_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.5	9.1e-30
WP_041205745.1|1749262_1751782_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	39.4	7.9e-44
WP_011706069.1|1751912_1752242_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_005330657.1|1752768_1753395_-	hydrolase	NA	NA	NA	NA	NA
WP_005330651.1|1753559_1754426_-	pirin family protein	NA	NA	NA	NA	NA
WP_005330648.1|1754523_1755414_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005330645.1|1755497_1756820_-	YjiH family protein	NA	NA	NA	NA	NA
WP_041205601.1|1757170_1758121_-|transposase	IS1595-like element ISAeca5 family transposase	transposase	NA	NA	NA	NA
WP_005325086.1|1759568_1759991_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005325088.1|1760168_1764095_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	27.6	1.8e-55
WP_041205747.1|1764193_1765036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205748.1|1765199_1765487_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_041205750.1|1765690_1768861_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.3	3.6e-62
WP_004576012.1|1769513_1770932_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_005328331.1|1771387_1772032_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005328332.1|1772025_1773156_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_041205752.1|1773208_1774246_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_005328336.1|1774574_1775219_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_005328337.1|1775632_1776826_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005328340.1|1777039_1778470_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.3	6.5e-19
WP_005328342.1|1778553_1778826_+	acylphosphatase	NA	NA	NA	NA	NA
WP_148304733.1|1778848_1779589_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_041205755.1|1779656_1781690_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	26.1	1.1e-43
WP_005328348.1|1781875_1782958_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_041205758.1|1783066_1783711_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.0	3.0e-32
WP_005328350.1|1783774_1784356_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	39.5	9.1e-28
WP_041205760.1|1784704_1786177_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_005327996.1|1787841_1789260_-|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_041205761.1|1792100_1795283_-	ribonuclease E	NA	NA	NA	NA	NA
WP_041205763.1|1795657_1796641_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_005329555.1|1796640_1797288_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_041205765.1|1797360_1797942_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_041205768.1|1798086_1798740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025326977.1|1799010_1799532_+	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_005300935.1|1799552_1799720_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_041205769.1|1799729_1800749_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_005329561.1|1800755_1801715_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_041205773.1|1801781_1802717_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_005329563.1|1802730_1803465_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.7	5.7e-19
WP_005300909.1|1803622_1803859_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.7e-09
WP_041205775.1|1803941_1805183_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_042648387.1|1805250_1806057_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_005329567.1|1806046_1807048_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_041205780.1|1807047_1807689_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	42.4	8.2e-30
WP_005329570.1|1807673_1808621_+	DNA polymerase III subunit delta'	NA	B2ZY37	Ralstonia_phage	27.5	3.5e-05
WP_005329573.1|1808639_1809419_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_005329575.1|1809745_1810735_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_005329577.1|1810898_1811183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205785.1|1811417_1812848_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_041205787.1|1812976_1815529_-	MCE family protein	NA	NA	NA	NA	NA
WP_041205789.1|1815580_1816189_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_005329583.1|1816166_1816811_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_005329584.1|1817031_1817337_+	YebG family protein	NA	NA	NA	NA	NA
WP_041205791.1|1817617_1818913_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005329587.1|1819119_1821096_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
1819578:1819594	attR	CGTGGCCCAGGGGCTCG	NA	NA	NA	NA
>prophage 18
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	1866345	1877469	4777154	tRNA	Hokovirus(16.67%)	8	NA	NA
WP_041206943.1|1866345_1870272_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	35.6	4.1e-31
WP_005300715.1|1870326_1870623_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	35.6	3.0e-11
WP_005329693.1|1870626_1873014_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.5	1.1e-05
WP_005329694.1|1873026_1874010_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.2	5.3e-36
WP_010674800.1|1874334_1874691_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005315535.1|1874705_1874903_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_041204270.1|1874988_1875537_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.2	1.8e-14
WP_041205812.1|1875540_1877469_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.0	9.7e-127
>prophage 19
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	2091443	2154255	4777154	tRNA,transposase,protease	uncultured_Mediterranean_phage(14.29%)	51	NA	NA
WP_005325367.1|2091443_2092202_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_041206958.1|2092330_2093341_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005325369.1|2093594_2095049_+	PTS cellobiose/arbutin/salicin transporter subunit IIBC	NA	NA	NA	NA	NA
WP_005325370.1|2095082_2096513_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	27.0	7.7e-36
WP_005325371.1|2096603_2098124_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.6	1.8e-88
WP_005325372.1|2098142_2098634_-	CvpA family protein	NA	NA	NA	NA	NA
WP_005325374.1|2098822_2100118_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.7	6.2e-93
WP_167332171.1|2100406_2101744_-	AAA family ATPase	NA	G3MBE0	Bacillus_virus	41.0	1.7e-77
WP_041205890.1|2101896_2102505_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_041205892.1|2102574_2105079_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.6	1.6e-89
WP_005300047.1|2105271_2105763_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_041205894.1|2105913_2107029_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_005325390.1|2107213_2108164_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.2	4.6e-61
WP_041205896.1|2108220_2109462_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.6	2.2e-15
WP_005325399.1|2109563_2110034_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_005325401.1|2110051_2110759_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_041205898.1|2110755_2111472_+	arginyltransferase	NA	NA	NA	NA	NA
WP_106886977.1|2111498_2111759_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005325408.1|2111828_2114081_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	9.2e-169
WP_005325410.1|2114141_2114459_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	2.0e-13
WP_005300025.1|2114687_2114906_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_005325413.1|2115031_2116144_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_041204923.1|2116423_2117566_+|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_005326802.1|2117743_2118058_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_041205901.1|2118138_2118837_-	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_041205902.1|2119147_2120908_+	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_005326809.1|2121289_2122138_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_041206959.1|2122179_2124462_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.7	4.0e-164
WP_005326813.1|2124997_2125453_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_139750789.1|2125795_2126008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205253.1|2126260_2127598_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005326945.1|2127653_2128526_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_005326943.1|2128525_2129692_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005326941.1|2129798_2130986_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_041205906.1|2131078_2133889_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_025326736.1|2134003_2134720_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_025326735.1|2134737_2136504_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_005326929.1|2136505_2136850_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_025326734.1|2136843_2137233_-	succinate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_041205909.1|2137656_2138943_+	citrate synthase	NA	NA	NA	NA	NA
WP_005326919.1|2139038_2139353_+	DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_005326918.1|2139447_2139942_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041205911.1|2140004_2141216_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_162472484.1|2141306_2143331_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_005326913.1|2143397_2144003_-	DUF922 domain-containing protein	NA	NA	NA	NA	NA
WP_158319061.1|2144060_2144210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049832182.1|2144248_2144623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158319062.1|2144677_2145811_+	ATPase	NA	A0A1B0Z1F4	Shewanella_phage	27.9	5.1e-27
WP_004576012.1|2147249_2148668_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_021141277.1|2151913_2152669_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.4	2.4e-52
WP_021141278.1|2152692_2154255_-|transposase	IS21-like element ISAs28 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.0	9.6e-125
>prophage 21
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	2402507	2494102	4777154	tRNA,transposase,integrase	Staphylococcus_prophage(21.05%)	73	2465734:2465793	2491269:2492360
WP_021141311.1|2402507_2403644_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_148304699.1|2403836_2404529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099993964.1|2404538_2405555_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_019706001.1|2405906_2406854_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_021141311.1|2406919_2408056_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_004576012.1|2409873_2411292_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_005330901.1|2411913_2413290_-|tRNA	cysteine--tRNA ligase	tRNA	H2EDD6	Moumouvirus	30.0	1.0e-45
WP_005330899.1|2413493_2413991_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005330897.1|2413980_2414694_+	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
WP_005330895.1|2414690_2415419_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_005330893.1|2415539_2415788_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_041205997.1|2415994_2416618_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_158319064.1|2416958_2417588_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_041206992.1|2417678_2418818_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	68.2	6.1e-145
WP_005323562.1|2419031_2419949_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	2.6e-101
WP_041206994.1|2421459_2422467_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	24.2	3.4e-06
WP_041204928.1|2422808_2423936_+|transposase	ISAs1-like element ISKpn9 family transposase	transposase	NA	NA	NA	NA
WP_005325880.1|2424291_2424852_-	DUF2787 family protein	NA	NA	NA	NA	NA
WP_148304700.1|2424912_2425548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025201450.1|2425670_2425973_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_041205999.1|2425965_2426322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206000.1|2426469_2427675_-|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	29.4	2.2e-12
WP_041206001.1|2428518_2429073_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_041206002.1|2429366_2431220_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_041206003.1|2431331_2431976_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_005331986.1|2432186_2432936_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005331987.1|2432932_2433133_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005331989.1|2433283_2434279_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005331991.1|2434278_2436048_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	4.2e-60
WP_148304701.1|2439804_2441234_-|transposase	IS66-like element ISAeme24 family transposase	transposase	NA	NA	NA	NA
WP_041205080.1|2441742_2442942_-	acetate kinase	NA	NA	NA	NA	NA
WP_041206006.1|2443268_2443739_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_041206007.1|2444039_2445146_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_041206008.1|2445355_2445907_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005327996.1|2446264_2447683_+|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_004576012.1|2449177_2450596_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_049832193.1|2451087_2452764_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_041201465.1|2452779_2453943_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005331310.1|2453972_2456957_-	Hsp70 family protein	NA	E3T5H4	Cafeteria_roenbergensis_virus	24.2	2.7e-19
WP_010676221.1|2457279_2457459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206012.1|2459271_2460834_+|transposase	IS21-like element ISAs28 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.2	3.3e-125
WP_081805714.1|2460857_2461223_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	42.1	1.5e-12
WP_004576012.1|2461287_2462706_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_019706001.1|2463542_2464490_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_041206013.1|2464767_2465169_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_081805717.1|2465240_2465771_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
2465734:2465793	attL	CGTGAATTCAGATAATAAGTGCAATGCCCATGGTGCATAGGAGAGAGGCGGTCAACTACC	NA	NA	NA	NA
WP_012564931.1|2465838_2466786_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_005331303.1|2467133_2467847_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_041206014.1|2467846_2470978_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.1	6.8e-53
WP_041206015.1|2471052_2472117_-	macro domain-containing protein	NA	A0A2I7QNM6	Vibrio_phage	40.5	2.9e-24
WP_005331300.1|2472113_2472767_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_005331298.1|2473033_2473177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206016.1|2474166_2475435_+|transposase	IS4-like element ISAeme4 family transposase	transposase	NA	NA	NA	NA
WP_017411290.1|2475693_2476911_-	tetracycline efflux MFS transporter Tet(E)	NA	NA	NA	NA	NA
WP_017411289.1|2476991_2477624_+	tetracycline resistance transcriptional repressor TetR(E)	NA	NA	NA	NA	NA
WP_158319065.1|2478010_2478136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147273949.1|2478165_2478996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005323888.1|2479158_2479419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206017.1|2479472_2479877_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	55.6	1.4e-30
WP_041206018.1|2479934_2481161_+|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	1.3e-153
WP_041206019.1|2481296_2481548_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_041206020.1|2481531_2481954_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_005324832.1|2482348_2482531_+	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
WP_041206021.1|2482863_2483151_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_041206022.1|2483138_2483432_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_147273935.1|2483584_2483872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081805719.1|2484093_2484612_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_041206016.1|2485350_2486619_+|transposase	IS4-like element ISAeme4 family transposase	transposase	NA	NA	NA	NA
WP_158319066.1|2486953_2487964_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_041206024.1|2487956_2489720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012564931.1|2490275_2491223_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_005332003.1|2491304_2492744_+	hypothetical protein	NA	A0A2H4J185	uncultured_Caudovirales_phage	24.9	4.7e-09
2491269:2492360	attR	GGTAGTTGACCGCCTCTCTCCTATGCACCATGGGCATTGCACTTATTATCTGAATTCACGTTTCGCCTGACATTGCCAACGATCAACTTCAAGCAATTAGCCTTTAAGTTAGCCGCGGAGGGAAAAAAACAGCCCAACCAGTTCTTGGTTATTCCTCAAACACTGGTCGATATCATCTACGGCGAGTCGGTTAATCTCGTCGAGCGGGCATGGCCACACCGCGCAGCACTAGCACAGCTAGAGCGAGATCTGCAGGCTAATTATGCGGCAGGTAGGGCGGTAGTCGACCATAAAATCGCCTTCAAACATTGGACGCCCCAGCACGATGCCAATGGAAAACTGGATACCAACTGGTACTCCTCAGCAATCAGCAAGGCGGCACCAAAAACACAAACTGCCATTGTTATCGCTGCGTTAGGGGATACCGGACTGCTACCAGAGGGGACCGTCCCTTATAATTGGTTCGCCGCATGGCGTAATGAATTGCAGGCGGCTTGTTTTGTCTGCTGCAGCGCGTTCAGTGGCATGCGGATCAGTGAGATTTTTGAGTTACGCCAGGACAGTTTCTGCACCTATACCGTAGGTGGTAAGGTTTTCCATGCCGTCCGGGCAGCCACCCACAAACTAGCGGCAGGTAAAAAACGCGACGAGTGGTTGTGCAGCCCGGTGGTCGAGAAAGCCATCGAAGTTGCGACGGAGCTGTCGGCCAGCCAACGGGAACAACTGCAACAATTGGCCCTGTGCAGCAGCGACCAGGGACATGCCCACACGCTTCGTGCCATGTCTGACTGCCTATGGTTGATCCAGGGAAACCGAAGCCAACCGCCAAGGGTCCAATCCCGAGGCTGTTGGAATAAAAGACTCCAACTATACGCAAAACATCTTGGCGCCATTGTCGATGAAAAAGCCTTGGCCGAATGCCGCCTGCTGAATCCGCGATCCCACGGCACTATTGAAACCAAAATTGAAATCGGTGAGCCATGGCCACTCAGCACACATCAGTTTCGCAGAACTTTCGCCAGCTTTGCAGTGCGCTACCACCTCGCCCATCCAATTGCTCTCAAACAGCAGCTTAAACATCTAGCCTTGCGT	NA	NA	NA	NA
WP_011191341.1|2492827_2494102_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	2498880	2553370	4777154	tRNA,transposase	Planktothrix_phage(28.57%)	44	NA	NA
WP_004576012.1|2498880_2500299_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_088813959.1|2500420_2501981_+|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
WP_081805894.1|2501911_2502742_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_005331307.1|2502770_2503289_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_005331306.1|2503282_2503777_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_005331305.1|2503903_2505409_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	46.4	8.5e-86
WP_041205051.1|2505457_2506795_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005329100.1|2507007_2508198_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_005329096.1|2508343_2509285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005329094.1|2509487_2510525_-	porin	NA	NA	NA	NA	NA
WP_005329092.1|2510910_2512983_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.2	2.7e-42
WP_005329090.1|2513127_2513787_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
WP_005329089.1|2513860_2514757_+	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	25.6	1.4e-11
WP_041206030.1|2514916_2516065_-	MFS transporter	NA	NA	NA	NA	NA
WP_041206031.1|2516306_2517257_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_041206032.1|2517583_2518975_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_005329077.1|2518998_2520366_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_041206033.1|2520416_2521100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193354199.1|2521183_2521918_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041206035.1|2522144_2522540_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_005329071.1|2522756_2523347_+	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_005329069.1|2523343_2524864_+	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_041206036.1|2524885_2526220_+	MFS transporter	NA	NA	NA	NA	NA
WP_021141234.1|2527043_2528270_-|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_021141233.1|2528327_2528732_+|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	8.8e-30
WP_005330342.1|2529635_2530424_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005330345.1|2530521_2531481_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_041206038.1|2531570_2532314_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	3.0e-36
WP_041207009.1|2532514_2533354_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_041205358.1|2533473_2534802_+|transposase	IS4-like element ISAeme12 family transposase	transposase	NA	NA	NA	NA
WP_005328837.1|2534854_2536255_-	amino acid permease	NA	NA	NA	NA	NA
WP_041206039.1|2536264_2537164_-	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_005328832.1|2537438_2537981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206040.1|2538001_2539321_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005328827.1|2539513_2540224_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_005328825.1|2540395_2541214_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	3.6e-22
WP_041206041.1|2541321_2542971_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_041206042.1|2542988_2545226_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_103244595.1|2545410_2546839_+|transposase	IS66-like element ISAeme23 family transposase	transposase	NA	NA	NA	NA
WP_081805723.1|2546994_2547534_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_167332172.1|2548141_2548282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005325257.1|2548985_2550593_+	malate synthase A	NA	NA	NA	NA	NA
WP_005325258.1|2550666_2551980_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_041205051.1|2552032_2553370_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	2568829	2633456	4777154	transposase	Helicobacter_phage(25.0%)	59	NA	NA
WP_021141234.1|2568829_2570056_-|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_021141233.1|2570113_2570518_+|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	8.8e-30
WP_041206863.1|2572097_2573237_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	68.7	7.2e-146
WP_041205574.1|2573295_2573721_+|transposase	IS200/IS605-like element ISAeme8 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	46.9	4.9e-23
WP_005329788.1|2573961_2575170_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_041206050.1|2575173_2577171_-	flagellar hook protein FlgK	NA	NA	NA	NA	NA
WP_005329786.1|2577174_2578287_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RU71	Clostridium_phage	35.0	2.9e-14
WP_041206051.1|2578333_2579431_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_041206052.1|2579492_2580164_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_005329779.1|2580190_2580979_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_005329778.1|2580993_2581740_-	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
WP_005329777.1|2581886_2583263_-	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_005329776.1|2583273_2584011_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_005329775.1|2584116_2584536_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_005329774.1|2584535_2584934_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_005329773.1|2584996_2585821_-	protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
WP_025327540.1|2585838_2586750_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.7e-36
WP_081805725.1|2586908_2587592_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_005329758.1|2587686_2588007_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_005329757.1|2588003_2588420_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_005329754.1|2588453_2589008_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_041207011.1|2589018_2590656_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005329750.1|2590955_2591858_+	DMT family transporter	NA	NA	NA	NA	NA
WP_041206053.1|2592039_2592732_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_081805727.1|2592906_2593956_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_021141234.1|2593899_2595126_-|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_021141233.1|2595183_2595588_+|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	8.8e-30
WP_005331455.1|2595879_2596068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005331452.1|2596282_2597176_+	EamA family transporter	NA	NA	NA	NA	NA
WP_041206054.1|2597268_2599119_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005331447.1|2599423_2599816_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_041206055.1|2599910_2600468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025327553.1|2600716_2600965_+	TIGR02647 family protein	NA	NA	NA	NA	NA
WP_041206056.1|2600951_2601248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005320244.1|2601343_2601544_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	59.4	3.0e-15
WP_005331437.1|2601758_2602859_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_005331436.1|2602953_2603940_-	alpha-ketoacid dehydrogenase subunit beta	NA	A0A0K0KW14	Prochlorococcus_phage	28.8	1.8e-07
WP_005331435.1|2604008_2605106_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_041206057.1|2605367_2606384_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_005331430.1|2606656_2606866_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_005331428.1|2607389_2608283_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_005331425.1|2608378_2612221_-	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	28.8	1.3e-45
WP_041206058.1|2612438_2613092_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_148304737.1|2613263_2613698_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_049832195.1|2613893_2615621_-	O-antigen ligase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005331415.1|2615708_2617793_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_162472485.1|2617789_2618479_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_041207014.1|2618541_2619213_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_041206060.1|2619283_2619511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088813959.1|2619883_2621445_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
WP_041206061.1|2622385_2624554_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_041206062.1|2624616_2625045_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_005327441.1|2625280_2626402_-	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_081805901.1|2626689_2627397_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_139700378.1|2627541_2628345_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_158319067.1|2628383_2629109_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_148304704.1|2629188_2629974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099368881.1|2630598_2631615_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_041206064.1|2632418_2633456_-|transposase	IS630-like element ISAeme16 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	2637400	2696424	4777154	transposase	Escherichia_phage(27.78%)	48	NA	NA
WP_041205297.1|2637400_2638675_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_148304705.1|2638642_2638921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005327996.1|2639621_2641040_+|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_005324204.1|2641423_2642311_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	8.1e-28
WP_005324202.1|2642310_2643396_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.3	2.2e-96
WP_041207018.1|2644331_2645006_+	response regulator	NA	W8CYM9	Bacillus_phage	34.6	2.8e-28
WP_041206069.1|2645005_2646388_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_005324195.1|2646734_2647703_-	glucokinase	NA	NA	NA	NA	NA
WP_167332173.1|2648051_2648906_+	transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_005324189.1|2649066_2650506_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_041206070.1|2650574_2651618_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005324186.1|2651633_2654696_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.8	2.5e-68
WP_005324184.1|2654859_2657184_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005324182.1|2657231_2657885_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005324180.1|2658353_2659094_+	phosphatase	NA	NA	NA	NA	NA
WP_099368881.1|2660021_2661038_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_148304706.1|2661104_2661311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206072.1|2661589_2662717_+|transposase	ISAs1-like element ISKpn9 family transposase	transposase	NA	NA	NA	NA
WP_158319068.1|2662706_2663009_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_171268792.1|2663112_2663670_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	35.1	6.0e-21
WP_005328266.1|2663895_2664231_+	addiction module protein	NA	A0A141GEX6	Brucella_phage	46.4	2.0e-11
WP_041206074.1|2664236_2664551_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_041206077.1|2666041_2666797_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	2.6e-59
WP_041206078.1|2666811_2668353_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	2.5e-125
WP_041207020.1|2669003_2670143_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	68.4	6.1e-145
WP_041205574.1|2670200_2670626_+|transposase	IS200/IS605-like element ISAeme8 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	46.9	4.9e-23
WP_041206080.1|2671189_2672605_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_041206081.1|2672597_2675747_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_041206082.1|2675764_2676958_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005323466.1|2677110_2677752_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005323469.1|2677851_2678511_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005323470.1|2678628_2679807_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_005323471.1|2679881_2680745_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_005323472.1|2681000_2681924_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_005323473.1|2682034_2682607_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.3	8.1e-21
WP_171268791.1|2682642_2683524_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_005323475.1|2683516_2684137_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_005323476.1|2684266_2685148_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_005323477.1|2685569_2687207_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_005323478.1|2687199_2687799_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	36.8	1.2e-27
WP_005323479.1|2687808_2688822_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.7	4.4e-54
WP_081805902.1|2688881_2690306_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	42.3	3.7e-38
WP_005323481.1|2690360_2691554_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_005323482.1|2691550_2692357_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_041206084.1|2692556_2693699_-|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
WP_041206863.1|2693875_2695015_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	68.7	7.2e-146
WP_148304709.1|2695048_2695408_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.4	3.2e-15
WP_019706001.1|2695476_2696424_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
>prophage 25
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	2716212	2760378	4777154	transposase,protease	Enterobacteria_phage(20.0%)	37	NA	NA
WP_041207026.1|2716212_2717541_+|transposase	IS4-like element ISAeme13 family transposase	transposase	NA	NA	NA	NA
WP_041206092.1|2717765_2718992_-|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.3	3.8e-153
WP_010674034.1|2719049_2719454_+|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	6.7e-30
WP_005327633.1|2719546_2719927_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_041206093.1|2719923_2720274_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_041206094.1|2720332_2720812_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_041206095.1|2720882_2722316_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005327624.1|2722467_2722710_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_041206096.1|2722790_2723861_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_081805736.1|2724046_2724721_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_021141234.1|2724664_2725891_-|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
WP_005328150.1|2726726_2727533_-	alpha/beta fold hydrolase	NA	A0A2P1CHW5	Mycobacterium_phage	25.7	1.9e-07
WP_005328152.1|2727785_2728601_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_005328154.1|2728709_2729846_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	35.9	4.7e-28
WP_025326477.1|2729915_2730806_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_005328158.1|2730818_2732471_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_005328161.1|2732547_2733729_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_005328162.1|2734146_2735208_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	39.8	7.9e-62
WP_011705556.1|2735281_2735509_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_005328168.1|2735552_2737400_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_005328169.1|2737661_2739812_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_005328171.1|2739811_2741851_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_041206097.1|2741886_2744301_+	proprotein convertase P-domain-containing protein	NA	NA	NA	NA	NA
WP_148304741.1|2744363_2745722_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_005328178.1|2745718_2746276_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_005328180.1|2746463_2746946_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_005328181.1|2747236_2747596_+	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_005328182.1|2747595_2748471_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
WP_005328183.1|2748537_2749677_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_005328184.1|2749795_2750869_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	47.9	6.1e-78
WP_041206098.1|2751199_2752279_-	glycerophosphodiester phosphodiesterase	NA	A0A220BY94	Staphylococcus_phage	26.7	9.3e-10
WP_005328189.1|2752382_2753870_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_005328190.1|2754313_2755072_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.2	2.8e-21
WP_041206099.1|2755172_2756543_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_041206100.1|2756563_2757730_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	68.1	2.5e-146
WP_010676219.1|2758074_2759172_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_041206101.1|2759235_2760378_+|transposase	IS4-like element ISAs18 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	3246413	3297749	4777154	transposase	Staphylococcus_prophage(18.18%)	48	NA	NA
WP_099368881.1|3246413_3247430_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_012564931.1|3247839_3248787_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_041205601.1|3249083_3250034_-|transposase	IS1595-like element ISAeca5 family transposase	transposase	NA	NA	NA	NA
WP_005332567.1|3250086_3252051_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_041206280.1|3252050_3252851_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_081805761.1|3252847_3255619_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.5	1.3e-31
WP_005332563.1|3256084_3256603_-	type VI secretion system effector Hcp1	NA	NA	NA	NA	NA
WP_041206281.1|3256834_3257602_-	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	36.1	2.8e-37
WP_005332561.1|3258177_3259668_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.6	2.5e-215
WP_005332560.1|3260218_3260452_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005332559.1|3260465_3261467_-	permease	NA	NA	NA	NA	NA
WP_041206283.1|3261581_3263018_-	glutathione synthase	NA	NA	NA	NA	NA
WP_005332545.1|3263131_3263647_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005332542.1|3263676_3264108_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.9	2.2e-47
WP_041206284.1|3264104_3265181_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_005332538.1|3265180_3266422_-	organoarsenical effux MFS transporter ArsJ	NA	NA	NA	NA	NA
WP_005332536.1|3266429_3267446_-	ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_005332534.1|3267456_3267972_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_005332532.1|3268029_3268398_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041206285.1|3269002_3269752_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_005332530.1|3269824_3270838_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.0	5.7e-86
WP_005332528.1|3270923_3271931_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041206287.1|3272024_3273674_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_041206289.1|3273921_3274389_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.3	1.6e-19
WP_005332524.1|3274520_3275063_-	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_041206291.1|3275077_3275620_-	chalcone isomerase family protein	NA	NA	NA	NA	NA
WP_005332522.1|3275576_3275795_-	TIGR02450 family Trp-rich protein	NA	NA	NA	NA	NA
WP_005332520.1|3275791_3276271_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_041206292.1|3276273_3277530_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005332515.1|3277639_3278386_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_005332514.1|3278382_3279642_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005332513.1|3279638_3280373_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005332512.1|3280369_3280798_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_005332511.1|3280799_3282224_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0CPD8	Kaumoebavirus	30.9	1.2e-49
WP_041206293.1|3282220_3283108_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	37.8	1.4e-16
WP_005332508.1|3283306_3284251_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_005332506.1|3284424_3285054_-	autotransporter	NA	NA	NA	NA	NA
WP_041206294.1|3285236_3285791_-	DUF3157 family protein	NA	NA	NA	NA	NA
WP_005332502.1|3285886_3286717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005332499.1|3286865_3287465_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_025328009.1|3287790_3288963_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_041206295.1|3289118_3289544_-	LPP20 family lipoprotein	NA	NA	NA	NA	NA
WP_005332494.1|3289564_3290185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005332493.1|3290469_3291624_+	flagellar assembly protein T N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005332492.1|3291877_3292798_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_019706001.1|3293968_3294916_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_010676219.1|3295200_3296298_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011191341.1|3296474_3297749_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	3391559	3460507	4777154	tRNA,transposase,protease	Vibrio_phage(14.29%)	58	NA	NA
WP_005323562.1|3391559_3392477_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	2.6e-101
WP_041206321.1|3393869_3394844_+	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_005329152.1|3394869_3395424_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_025328092.1|3395463_3395868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005329149.1|3395938_3396496_-	heme utilization protein HutZ	NA	NA	NA	NA	NA
WP_005329147.1|3396492_3397005_-	heme utilization cystosolic carrier protein HutX	NA	NA	NA	NA	NA
WP_005329145.1|3397173_3398013_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005329142.1|3398009_3399041_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_041206322.1|3399056_3399857_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	2.3e-13
WP_005329125.1|3400106_3400715_-	YitT family protein	NA	NA	NA	NA	NA
WP_041206324.1|3401018_3402380_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.0	3.3e-81
WP_005329119.1|3402376_3403375_+	NAD-dependent epimerase	NA	A0A1V0SKV4	Klosneuvirus	30.8	5.7e-30
WP_041206327.1|3403458_3405147_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_041206328.1|3405136_3405502_-	lipid-A-disaccharide synthase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005329116.1|3405590_3406331_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	26.5	1.5e-06
WP_041206330.1|3406682_3407528_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	44.1	9.1e-21
WP_005329110.1|3407859_3409527_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	28.0	3.9e-39
WP_005329107.1|3409795_3410131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206332.1|3410392_3411748_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	38.0	7.9e-67
WP_049832204.1|3411793_3413131_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005327208.1|3413256_3414075_-	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_041206335.1|3414094_3414763_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_041206336.1|3414759_3415788_-	phosphotransferase	NA	NA	NA	NA	NA
WP_005327225.1|3415962_3418395_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_005327228.1|3418425_3419718_+	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_041207076.1|3419732_3420728_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_041206338.1|3420717_3421545_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_041206340.1|3421549_3421912_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_005327236.1|3421918_3422740_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2R4ALP3	Aeromonas_phage	42.5	6.2e-06
WP_005327237.1|3422806_3423292_-	2TM domain-containing protein	NA	NA	NA	NA	NA
WP_041206342.1|3423462_3424452_-	luciferase-like monooxygenase	NA	NA	NA	NA	NA
WP_041206344.1|3424683_3427569_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_041206346.1|3427638_3429009_-	YjiH family protein	NA	NA	NA	NA	NA
WP_005327243.1|3429377_3430583_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_005911261.1|3430772_3431030_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_005304210.1|3431047_3431359_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_005327245.1|3431601_3432573_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	23.3	3.3e-06
WP_005327246.1|3432665_3432854_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_041206348.1|3432939_3433824_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_041206349.1|3433827_3434976_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_005327255.1|3435058_3436345_-	GTPase HflX	NA	NA	NA	NA	NA
WP_011704864.1|3436408_3436672_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_081805770.1|3436744_3437677_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_005327259.1|3437758_3439630_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.6	4.6e-57
WP_041206350.1|3439810_3441346_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A059WLJ5	Vibrio_phage	30.4	6.1e-15
WP_041206351.1|3441336_3441810_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_041206352.1|3441827_3443330_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_005327306.1|3443462_3444617_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_005327307.1|3444700_3445444_+	ROK family protein	NA	NA	NA	NA	NA
WP_005327308.1|3445498_3445954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206353.1|3446436_3447480_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	36.9	4.0e-34
WP_005327310.1|3447538_3448192_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005327312.1|3448218_3449019_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_041205253.1|3449136_3450474_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005331636.1|3450559_3451060_+	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
WP_041206354.1|3451217_3453194_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.4	1.5e-13
WP_041206355.1|3453231_3454443_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_004576012.1|3459088_3460507_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	3631368	3710536	4777154	integrase,transposase,tRNA	Klosneuvirus(18.75%)	54	3644864:3644880	3686242:3686258
WP_041207088.1|3631368_3632007_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_005332231.1|3632838_3634176_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_158319069.1|3634259_3635117_+	DUF2950 family protein	NA	NA	NA	NA	NA
WP_005332225.1|3635471_3636185_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_005332223.1|3636262_3637471_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_005332220.1|3637485_3638817_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.3	8.9e-79
WP_005332219.1|3638889_3639663_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_005332215.1|3640053_3640224_-	DUF1427 family protein	NA	R4TMJ4	Halovirus	60.0	6.3e-06
WP_041206433.1|3640347_3641622_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_005332213.1|3641831_3642623_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005332212.1|3642663_3643281_+	type IVa pilus pseudopilin TppF	NA	NA	NA	NA	NA
WP_081805784.1|3643249_3643432_-	DUF5363 family protein	NA	NA	NA	NA	NA
WP_193354205.1|3643514_3644024_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041206437.1|3644146_3645499_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	41.8	1.6e-91
3644864:3644880	attL	GGTCACCAGTACCACCA	NA	NA	NA	NA
WP_005332207.1|3645732_3647160_-	ammonium transporter	NA	NA	NA	NA	NA
WP_041206439.1|3648457_3649747_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_148304713.1|3649743_3651456_-	type I secretion system permease/ATPase	NA	W5SAS9	Pithovirus	28.3	8.9e-15
WP_005332198.1|3651456_3652695_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_041206441.1|3652819_3663502_-	DUF4347 domain-containing protein	NA	NA	NA	NA	NA
WP_158319070.1|3663689_3664010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206442.1|3664148_3664451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005324741.1|3665256_3665430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206444.1|3665729_3666164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011191341.1|3666764_3668039_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_081805785.1|3670115_3672584_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.8	1.3e-70
WP_004576012.1|3672671_3674090_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_041206449.1|3675067_3675313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148304714.1|3675536_3676256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206452.1|3676303_3677323_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	28.6	5.0e-13
WP_005332441.1|3677663_3678182_+	RDD family protein	NA	NA	NA	NA	NA
WP_041206454.1|3678265_3679336_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_005332438.1|3679361_3680474_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_041206455.1|3680646_3682158_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.6	1.4e-48
WP_041206456.1|3682314_3682770_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_005332435.1|3682835_3685688_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.0	1.1e-137
WP_005332434.1|3685931_3687224_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
3686242:3686258	attR	TGGTGGTACTGGTGACC	NA	NA	NA	NA
WP_005332433.1|3687242_3687908_+	DedA family protein	NA	NA	NA	NA	NA
WP_041206457.1|3688044_3688872_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_005315760.1|3690110_3690299_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	5.0e-12
WP_005332431.1|3690392_3691640_-	aspartate kinase	NA	NA	NA	NA	NA
WP_041206458.1|3691656_3694281_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.7	4.0e-75
WP_041205242.1|3694402_3695740_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005324576.1|3696000_3696501_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_005324574.1|3696541_3697603_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	64.4	2.5e-116
WP_041207091.1|3697683_3698175_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.0	2.0e-28
WP_041206459.1|3698420_3698828_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_005324564.1|3699091_3701662_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.0	7.6e-34
WP_041206460.1|3701732_3703331_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.4	1.2e-26
WP_025325616.1|3703340_3703868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041207092.1|3704032_3704512_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005324553.1|3704577_3705159_-	YjaG family protein	NA	NA	NA	NA	NA
WP_005324551.1|3705320_3706265_+	D-2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_041206461.1|3706331_3707669_-	murein DD-endopeptidase MepM	NA	I3PV79	Clostridium_phage	45.5	2.0e-17
WP_019706001.1|3709588_3710536_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
>prophage 29
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	3731487	3776993	4777154	transposase	Bacillus_virus(20.0%)	40	NA	NA
WP_041205051.1|3731487_3732825_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_081805790.1|3733032_3733314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206475.1|3733375_3733750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005330466.1|3733859_3734072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005330464.1|3734361_3734736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099993964.1|3735404_3736421_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_041206480.1|3736720_3739009_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.5	7.3e-89
WP_005327124.1|3739167_3741057_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.4	1.0e-91
WP_005327126.1|3741196_3741592_-	GFA family protein	NA	NA	NA	NA	NA
WP_041206482.1|3741630_3742254_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_041206483.1|3742256_3742844_-	esterase	NA	NA	NA	NA	NA
WP_041206484.1|3742857_3743676_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_041206485.1|3743704_3744151_-	DUF1249 domain-containing protein	NA	NA	NA	NA	NA
WP_025325572.1|3744235_3744877_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	35.6	1.1e-23
WP_041206486.1|3745182_3746508_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_005327142.1|3746607_3748035_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A0K0KVL9	Prochlorococcus_phage	38.4	2.7e-17
WP_041206487.1|3748289_3749213_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.5	3.3e-56
WP_158319071.1|3749399_3749549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099368947.1|3749583_3750670_+|transposase	IS3-like element ISKpn10 family transposase	transposase	NA	NA	NA	NA
WP_005324976.1|3751991_3753971_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_005324974.1|3754098_3754719_-	amino acid transporter	NA	NA	NA	NA	NA
WP_005324972.1|3754983_3755766_-	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	47.8	1.4e-55
WP_041206489.1|3755830_3756457_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041206490.1|3756700_3757600_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_005324966.1|3757686_3759723_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	29.1	3.6e-31
WP_041205051.1|3759843_3761181_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_041206012.1|3761638_3763201_+|transposase	IS21-like element ISAs28 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.2	3.3e-125
WP_021141277.1|3763224_3763980_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.4	2.4e-52
WP_041206491.1|3764588_3766517_+	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_041206492.1|3766554_3767700_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_005332927.1|3767816_3768338_+	mannitol operon repressor	NA	NA	NA	NA	NA
WP_005332928.1|3768470_3770258_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_005332929.1|3770347_3770596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206496.1|3770635_3771154_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_041206497.1|3771163_3772129_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_005332933.1|3772269_3772722_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_005332935.1|3772838_3773108_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_041206498.1|3773156_3773717_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_041206499.1|3774112_3775318_-	nucleoside permease	NA	NA	NA	NA	NA
WP_021141311.1|3775856_3776993_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	3781536	3845212	4777154	transposase	Bacillus_thuringiensis_phage(23.08%)	55	NA	NA
WP_041205051.1|3781536_3782874_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_041207095.1|3783001_3783907_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_041206502.1|3784114_3785446_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_005329415.1|3785479_3787213_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_041206503.1|3787202_3787970_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_005329409.1|3788056_3788917_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_005329406.1|3788916_3789846_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_041206505.1|3789856_3791266_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	35.7	3.3e-07
WP_041206506.1|3791443_3794188_+	collagenase	NA	NA	NA	NA	NA
WP_148304715.1|3794374_3795433_+	YdcF family protein	NA	Q56AS0	Bacillus_thuringiensis_phage	81.2	7.2e-07
WP_005329392.1|3795499_3796114_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	86.6	3.6e-99
WP_041207097.1|3796137_3796563_-	hypothetical protein	NA	Q56AR5	Bacillus_thuringiensis_phage	70.1	2.6e-24
WP_041206507.1|3796841_3797753_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_005329376.1|3797749_3798508_+	lipase chaperone	NA	NA	NA	NA	NA
WP_005329375.1|3798544_3799246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005329373.1|3799275_3799671_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005329371.1|3799721_3801461_-	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_005329369.1|3801561_3801738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206508.1|3801893_3803162_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	26.9	4.6e-16
WP_005329365.1|3803269_3803896_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_041205242.1|3803957_3805295_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005328735.1|3805419_3806595_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_041206510.1|3806788_3807370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005328738.1|3807484_3807922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206512.1|3808122_3808869_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005328742.1|3808911_3809157_-	DUF3624 family protein	NA	NA	NA	NA	NA
WP_041206513.1|3809398_3809857_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005328745.1|3810043_3811492_+	RimK family alpha-L-glutamate ligase	NA	NA	NA	NA	NA
WP_041206514.1|3811538_3813155_-	glycosidase	NA	NA	NA	NA	NA
WP_005328751.1|3813279_3813552_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_041206516.1|3813812_3815777_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_025328549.1|3815955_3816852_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_005328754.1|3817179_3817974_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005328755.1|3818036_3819482_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041206517.1|3819490_3821467_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.4	2.8e-20
WP_041206519.1|3821667_3822279_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_005328758.1|3822373_3823291_-|transposase	IS5-like element ISAeme7 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	56.5	2.6e-93
WP_005328767.1|3823986_3826815_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.4	0.0e+00
WP_139750669.1|3826909_3827548_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005328769.1|3828063_3828639_+	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	57.4	1.8e-52
WP_005328770.1|3828795_3829566_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025328558.1|3830077_3830362_+	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_025328559.1|3830755_3830968_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	77.1	2.4e-23
WP_005328779.1|3831205_3832591_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_041207099.1|3832598_3833321_-	response regulator	NA	W8CYM9	Bacillus_phage	36.7	3.1e-33
WP_005328782.1|3833521_3833878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005328788.1|3836157_3836571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206522.1|3836720_3837722_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_005328794.1|3838125_3838464_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_005328796.1|3838489_3839731_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.5	2.3e-57
WP_193354207.1|3839790_3840690_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005328801.1|3840765_3841164_+	VOC family protein	NA	NA	NA	NA	NA
WP_021141311.1|3841725_3842862_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_049832211.1|3842870_3843653_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099992639.1|3844195_3845212_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 32
NZ_CP007567	Aeromonas media WS chromosome, complete genome	4777154	4624639	4761021	4777154	transposase,protease	Escherichia_phage(26.32%)	108	NA	NA
WP_004576012.1|4624639_4626058_+|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_005332393.1|4626090_4627785_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.5	1.4e-33
WP_005332396.1|4628198_4629623_+	N-acetylglucosamine-binding protein GbpA	NA	NA	NA	NA	NA
WP_041206759.1|4629722_4630253_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_005332399.1|4630342_4631290_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_005332405.1|4631406_4632474_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	1.1e-26
WP_005332418.1|4632548_4633442_-	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_005332419.1|4633438_4634278_-	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_041206760.1|4634557_4635133_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005327754.1|4642283_4643480_+	NnrS family protein	NA	NA	NA	NA	NA
WP_005327753.1|4643483_4644053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005327752.1|4644168_4645320_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_041204874.1|4645467_4646532_+	DUF3103 family protein	NA	NA	NA	NA	NA
WP_025325515.1|4646652_4647123_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005327747.1|4647883_4648831_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_005327739.1|4650240_4651404_+	competence protein CinA	NA	NA	NA	NA	NA
WP_005327731.1|4651411_4651927_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	40.9	4.3e-05
WP_005327730.1|4652367_4653996_+	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_005327726.1|4654110_4654920_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_041206762.1|4655285_4656056_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_005327724.1|4656052_4656457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041205253.1|4656532_4657870_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_005330947.1|4657990_4658701_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_180345053.1|4658747_4659671_-	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	30.6	2.4e-14
WP_005330951.1|4659696_4660377_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_025325502.1|4660532_4661363_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_005330955.1|4661459_4662710_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_025325500.1|4662730_4662937_-	lipoprotein	NA	NA	NA	NA	NA
WP_005330957.1|4663010_4663325_+	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_005330959.1|4663339_4663993_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005330961.1|4664085_4666605_-	class I adenylate cyclase	NA	NA	NA	NA	NA
WP_041207133.1|4666927_4667857_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_041207134.1|4667903_4668638_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005330965.1|4668634_4669711_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_005330966.1|4669721_4670885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206764.1|4671007_4672345_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_041206765.1|4672498_4672750_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_041206766.1|4673018_4674029_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_041206767.1|4674247_4675306_+	porin	NA	NA	NA	NA	NA
WP_005328993.1|4675392_4675872_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005328992.1|4676150_4678193_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_041207136.1|4678258_4678879_+	PepSY-associated TM helix domain-containing protein	NA	NA	NA	NA	NA
WP_005328990.1|4679052_4680090_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_041206768.1|4680061_4680439_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041206769.1|4680560_4680866_+	monooxygenase	NA	NA	NA	NA	NA
WP_193354209.1|4680885_4681473_-	porin family protein	NA	NA	NA	NA	NA
WP_005328986.1|4681716_4682355_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005328985.1|4682429_4683320_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	5.8e-18
WP_005328984.1|4683596_4684178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206771.1|4684572_4684989_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049832220.1|4684988_4685561_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_019706001.1|4685835_4686783_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_099993964.1|4687003_4688020_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_099993964.1|4688202_4689219_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_041205297.1|4689388_4690663_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_081805828.1|4690701_4692162_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011191341.1|4692129_4693404_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_081805829.1|4694219_4695446_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_005331001.1|4695481_4696249_-	thiazole synthase	NA	NA	NA	NA	NA
WP_005331003.1|4696250_4696451_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_005331005.1|4696453_4697233_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_005331007.1|4697222_4698782_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_180344943.1|4698778_4700680_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_005323562.1|4701242_4702160_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	2.6e-101
WP_011191341.1|4702332_4703607_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_148304725.1|4703697_4704972_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_010676219.1|4705005_4706103_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_148304726.1|4706068_4706395_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_041207141.1|4706483_4707914_+|transposase	IS4-like element ISAeme22 family transposase	transposase	NA	NA	NA	NA
WP_005326718.1|4708033_4708504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206773.1|4708589_4709006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005326722.1|4709096_4709765_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.9	1.8e-24
WP_005326724.1|4709794_4711024_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005326726.1|4711165_4712062_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	37.1	8.4e-41
WP_005326727.1|4712299_4715995_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	80.3	1.2e-21
WP_041206775.1|4716197_4717475_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	40.2	3.7e-42
WP_005326732.1|4717924_4718101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010674210.1|4718370_4719984_-|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
WP_099993964.1|4721518_4722535_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_010674210.1|4723074_4724688_+|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
WP_148304727.1|4725625_4726405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081805831.1|4726508_4726694_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_099369027.1|4726749_4727766_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	4.9e-186
WP_049832223.1|4727935_4728643_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	44.9	1.7e-49
WP_041206779.1|4730706_4731228_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005331711.1|4731448_4731712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041205297.1|4732210_4733485_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_005331560.1|4734093_4734783_-	ATPase	NA	NA	NA	NA	NA
WP_005331561.1|4734937_4736254_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	2.4e-36
WP_005331562.1|4736385_4737102_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_041206780.1|4737262_4737466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049832204.1|4737637_4738975_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_041206781.1|4739041_4740490_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_041206782.1|4740603_4741410_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_005328021.1|4741531_4745434_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_005328020.1|4745434_4746904_-	ribonuclease G	NA	NA	NA	NA	NA
WP_005328019.1|4746983_4747571_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005328018.1|4747622_4748108_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_041206783.1|4748107_4748998_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_005328016.1|4749039_4750080_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.2	5.4e-07
WP_041206784.1|4750296_4751412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010676219.1|4751509_4752607_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_041206785.1|4753992_4754307_-	MSHA biogenesis protein MshK	NA	NA	NA	NA	NA
WP_041207152.1|4754299_4754947_-	MSHA biogenesis protein MshJ	NA	NA	NA	NA	NA
WP_041206786.1|4755689_4756553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005323609.1|4756622_4757570_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_041206788.1|4757629_4759549_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_099993964.1|4760004_4761021_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
