The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018405	Enterobacter kobei, complete sequence	4726582	2524548	2555428	4726582	tail,lysis,terminase,holin,capsid	Cronobacter_phage(56.25%)	40	NA	NA
WP_014883981.1|2524548_2525817_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.0	1.4e-227
WP_014883982.1|2525819_2526239_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	1.0e-36
WP_187289093.1|2526460_2526610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014883983.1|2527093_2528305_-	acyltransferase	NA	NA	NA	NA	NA
WP_014883984.1|2528409_2530569_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	59.8	5.5e-38
WP_014883985.1|2530627_2533105_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.4	0.0e+00
WP_051001276.1|2533091_2533508_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	90.6	3.3e-72
WP_014883987.1|2533470_2533941_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.3	1.6e-78
WP_014883988.1|2533940_2534438_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	92.7	7.1e-90
WP_014883989.1|2534437_2536771_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	50.2	1.9e-153
WP_014883990.1|2536809_2537103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014883991.1|2537179_2537920_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	49.6	1.1e-57
WP_014883992.1|2537970_2538726_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	49.0	1.9e-54
WP_014883993.1|2538784_2539168_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	57.5	2.2e-38
WP_014883994.1|2539164_2539533_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	74.6	3.0e-45
WP_014883995.1|2539594_2539882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014883996.1|2539929_2540280_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	3.4e-38
WP_014883997.1|2540279_2540453_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	48.2	5.1e-11
WP_014883998.1|2540452_2540833_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	3.1e-29
WP_014883999.1|2540835_2541201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014884000.1|2541210_2542308_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.7	7.6e-161
WP_014884001.1|2542317_2542752_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	73.6	1.1e-51
WP_014884002.1|2542755_2544144_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	58.3	1.0e-149
WP_131494613.1|2544206_2544515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131494614.1|2544547_2545561_-|capsid	minor capsid protein	capsid	F1C5D8	Cronobacter_phage	68.8	3.8e-114
WP_014884005.1|2545478_2546930_-	hypothetical protein	NA	F1C5D7	Cronobacter_phage	50.1	1.1e-117
WP_014884006.1|2546941_2548414_-	hypothetical protein	NA	G0ZND4	Cronobacter_phage	86.3	3.2e-255
WP_014884007.1|2548400_2548973_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	72.6	3.8e-71
WP_071819750.1|2548996_2549224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884008.1|2549410_2549671_+	hypothetical protein	NA	A0A089FW14	Salmonella_phage	64.0	6.7e-23
WP_131494615.1|2549840_2550122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014884009.1|2550170_2550695_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	74.0	6.6e-70
WP_014884010.1|2550938_2551400_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	76.5	2.0e-54
WP_014884011.1|2551396_2551891_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	97.0	1.6e-89
WP_014884012.1|2551868_2552093_-|holin	class II holin family protein	holin	M9NZI9	Enterobacteria_phage	97.2	5.2e-32
WP_014884013.1|2552814_2553645_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	79.7	3.0e-125
WP_014884014.1|2553641_2554004_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	80.5	9.9e-49
WP_071819753.1|2554006_2554213_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	75.8	1.5e-25
WP_014884015.1|2554212_2554815_-	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	84.0	6.2e-96
WP_014884016.1|2555203_2555428_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	67.5	6.8e-24
>prophage 2
NC_018405	Enterobacter kobei, complete sequence	4726582	2559511	2575324	4726582	tRNA	Enterobacteria_phage(53.33%)	18	NA	NA
WP_014884021.1|2559511_2560198_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	63.4	5.2e-83
WP_041163055.1|2560194_2561112_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	70.4	1.4e-107
WP_014884023.1|2561196_2561748_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	47.5	4.0e-33
WP_014884024.1|2561750_2561969_-	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	59.2	9.2e-18
WP_014832189.1|2562067_2562457_+	transcriptional regulator	NA	K7PHG0	Enterobacteria_phage	79.2	8.1e-49
WP_014832190.1|2562506_2562923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884025.1|2562971_2563349_+	hypothetical protein	NA	A0A2H4FNB7	Salmonella_phage	53.4	4.8e-14
WP_014884026.1|2563819_2563984_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	85.4	2.4e-18
WP_014884027.1|2564124_2567262_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7P6V4	Enterobacteria_phage	64.4	0.0e+00
WP_014884028.1|2567271_2568357_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	62.8	1.8e-122
WP_014884029.1|2568395_2568638_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	92.3	3.0e-33
WP_014884030.1|2568702_2568915_+	excisionase family protein	NA	A0A0U2RY08	Escherichia_phage	64.8	4.3e-20
WP_014884031.1|2568916_2570155_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	70.5	3.5e-170
WP_014884032.1|2570204_2571140_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	4.0e-142
WP_014884033.1|2571182_2572556_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.6	6.2e-51
WP_000025608.1|2572583_2572766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014884034.1|2573041_2574025_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_023338360.1|2574181_2575324_-	methyl-accepting chemotaxis sensory transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	1.7e-09
>prophage 3
NC_018405	Enterobacter kobei, complete sequence	4726582	2641515	2700837	4726582	integrase,tail,lysis,protease,terminase,holin,portal,capsid,plate,head	Erwinia_phage(25.0%)	69	2669157:2669173	2700920:2700936
WP_014884092.1|2641515_2642562_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.7	2.8e-19
WP_014884093.1|2642813_2643575_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.0	1.8e-07
WP_014884094.1|2643571_2644162_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_014884095.1|2644197_2645076_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_003856793.1|2645172_2645793_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_173674977.1|2645789_2646683_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_106993556.1|2646810_2646855_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_014884097.1|2646951_2648514_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_014884098.1|2648513_2650109_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.3	7.2e-51
WP_014884099.1|2650112_2651471_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.6	3.3e-36
WP_014884100.1|2651481_2652675_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_014884101.1|2652674_2653484_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_014884102.1|2653750_2655007_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014884103.1|2655162_2655375_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.6	8.4e-24
WP_032629007.1|2655866_2656472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884106.1|2656535_2657195_-	DsbA family protein	NA	NA	NA	NA	NA
WP_014884107.1|2657324_2657804_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014884108.1|2657944_2658766_+	alpha/beta hydrolase	NA	A0A1D8EW21	Mycobacterium_phage	25.3	3.7e-11
WP_014884109.1|2658842_2659610_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023337386.1|2659866_2660886_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023337388.1|2662002_2662551_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014884112.1|2662728_2663940_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_014884113.1|2663936_2664170_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_014884114.1|2664295_2664634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884115.1|2664680_2665313_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_014884116.1|2665594_2665999_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_014884117.1|2666024_2666768_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_014884118.1|2666825_2667365_+	septation protein A	NA	NA	NA	NA	NA
WP_008502796.1|2667469_2667865_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_014884119.1|2667901_2668630_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_014884120.1|2668852_2669149_+	YciI family protein	NA	NA	NA	NA	NA
2669157:2669173	attL	AAGGCTCCCTCAGGAGC	NA	NA	NA	NA
WP_187289094.1|2669181_2669319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884121.1|2669549_2670248_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_014884122.1|2670695_2670917_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.9	3.5e-25
WP_014884123.1|2670993_2672163_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	75.4	2.5e-162
WP_014884124.1|2672159_2672624_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	71.4	1.1e-60
WP_014884125.1|2672636_2675084_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	76.4	4.8e-304
WP_000763321.1|2675073_2675196_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	5.0e-13
WP_014884126.1|2675228_2675537_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	73.6	1.4e-27
WP_014884127.1|2675597_2676116_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.2	3.8e-78
WP_014884128.1|2676128_2677322_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.6	2.0e-186
WP_014884129.1|2677444_2677849_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	44.8	3.8e-25
WP_014884130.1|2677860_2679912_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	78.1	1.6e-87
WP_014884131.1|2679923_2680454_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.9	2.0e-90
WP_014884132.1|2680446_2681355_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	81.1	1.6e-135
WP_014884133.1|2681360_2681711_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	70.7	1.2e-38
WP_014884134.1|2681707_2682349_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	83.1	2.3e-96
WP_014884135.1|2682660_2683683_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_014884136.1|2683860_2684316_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.7	1.4e-47
WP_014884137.1|2684308_2684776_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	72.3	1.7e-61
WP_080021207.1|2684738_2684984_-|holin	holin	holin	S4TNY4	Salmonella_phage	79.0	3.4e-29
WP_014884139.1|2684871_2685297_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	69.9	1.1e-43
WP_014884140.1|2685293_2685803_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	86.3	1.4e-80
WP_017382980.1|2685786_2686008_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_014884142.1|2685998_2686202_-|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	80.6	1.5e-25
WP_014884143.1|2686201_2686708_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	73.2	4.0e-64
WP_014884144.1|2686807_2687563_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	71.2	7.8e-72
WP_014884145.1|2687566_2688634_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.3	1.8e-170
WP_014884146.1|2688689_2689544_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	68.7	6.5e-107
WP_014884147.1|2689710_2691480_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.2	4.7e-301
WP_014884148.1|2691481_2692507_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.0	2.7e-168
WP_014884149.1|2694187_2695177_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_041163058.1|2695517_2697791_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	75.9	0.0e+00
WP_014884151.1|2697792_2698056_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	57.0	2.0e-22
WP_014884152.1|2698078_2698297_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	62.1	3.8e-11
WP_014884153.1|2698363_2698864_-	hypothetical protein	NA	M1SV55	Escherichia_phage	75.9	7.4e-71
WP_014884154.1|2699030_2699306_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	85.6	6.8e-42
WP_014884155.1|2699430_2699730_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	74.7	2.9e-38
WP_014884156.1|2699826_2700837_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	76.1	1.2e-147
2700920:2700936	attR	AAGGCTCCCTCAGGAGC	NA	NA	NA	NA
>prophage 4
NC_018405	Enterobacter kobei, complete sequence	4726582	3080635	3088063	4726582		Enterobacteria_phage(50.0%)	7	NA	NA
WP_014884474.1|3080635_3081640_+	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	30.4	1.7e-34
WP_014884475.1|3081691_3082858_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.0	2.0e-111
WP_014884476.1|3083112_3084519_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	4.0e-37
WP_014884477.1|3084654_3085203_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.4	4.1e-54
WP_014884478.1|3085213_3086110_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_014884479.1|3086116_3086983_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	4.1e-109
WP_014884480.1|3086998_3088063_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.8	1.1e-100
>prophage 5
NC_018405	Enterobacter kobei, complete sequence	4726582	3582817	3660989	4726582	integrase,tail,tRNA,lysis,terminase,portal,capsid,plate,head	Salmonella_phage(70.59%)	87	3627319:3627356	3662085:3662122
WP_014884851.1|3582817_3583555_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_014884852.1|3583687_3585016_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	7.1e-44
WP_014884853.1|3585068_3585452_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	72.8	7.3e-34
WP_014884854.1|3585766_3586456_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	1.3e-54
WP_014884855.1|3586496_3587627_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_014884856.1|3587831_3588251_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	7.7e-13
WP_014884857.1|3588320_3589019_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_014884858.1|3589054_3591718_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_041163066.1|3591828_3593184_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_014884860.1|3593229_3593553_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_023331104.1|3593549_3594845_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.8e-44
WP_014884862.1|3600464_3603038_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.3e-128
WP_014884863.1|3603168_3603900_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_014884864.1|3603896_3604877_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_014884865.1|3605008_3605746_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_014884866.1|3606013_3606355_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100249759.1|3606459_3606507_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_014884867.1|3606614_3607775_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_014884868.1|3607771_3608644_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_014884869.1|3608704_3609826_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_014884870.1|3609836_3610907_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	9.0e-90
WP_014884871.1|3611122_3611497_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_023337647.1|3611590_3612187_+	YfiR family protein	NA	NA	NA	NA	NA
WP_014884873.1|3612179_3613400_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.9e-06
WP_014884874.1|3613412_3613898_+	OmpA family protein	NA	NA	NA	NA	NA
WP_014884875.1|3613900_3615271_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_014884876.1|3615309_3615714_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|3615846_3616194_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_014884877.1|3616237_3617005_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003863136.1|3617036_3617576_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3617591_3617840_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_014884878.1|3617956_3619318_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_014884879.1|3619484_3620276_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_032629440.1|3620294_3621581_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_014884881.1|3621632_3622226_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_008502500.1|3622348_3623227_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_014884882.1|3623312_3624974_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_014884883.1|3625112_3625451_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_014884884.1|3625556_3625844_-	RnfH family protein	NA	NA	NA	NA	NA
WP_023337653.1|3625833_3626310_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_008502505.1|3626427_3626910_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
3627319:3627356	attL	ATGTAGAAATTTCGGACGCGGGTTCAACTCCCGCCAGC	NA	NA	NA	NA
WP_014884885.1|3627478_3627697_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	95.8	2.0e-36
WP_014884886.1|3627765_3628866_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	92.3	8.4e-184
WP_014884887.1|3628862_3629348_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	87.6	3.8e-72
WP_014884888.1|3629347_3632767_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	72.2	0.0e+00
WP_007848878.1|3632759_3632879_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
WP_014884889.1|3632893_3633196_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	3.1e-40
WP_007848874.1|3633250_3633766_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
WP_014884890.1|3633775_3634948_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.6	2.8e-209
WP_014884891.1|3635080_3635479_-|tail	tail fiber assembly protein	tail	N0DPE7	Edwardsiella_phage	58.5	2.4e-11
WP_014884892.1|3635478_3637215_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.3	1.6e-141
WP_014884893.1|3637211_3637817_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	94.0	8.1e-112
WP_014884894.1|3637809_3638718_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	92.4	6.1e-148
WP_014884895.1|3638704_3639064_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	89.8	2.3e-53
WP_014884896.1|3639060_3639639_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.9	8.2e-106
WP_014884897.1|3639707_3640154_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	2.4e-60
WP_014884898.1|3640146_3640578_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	3.5e-69
WP_014884900.1|3640673_3641102_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	85.0	4.0e-57
WP_014884901.1|3641098_3641614_-	lysozyme	NA	E5G6N1	Salmonella_phage	76.5	1.8e-72
WP_014884902.1|3641594_3641810_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
WP_000868184.1|3641813_3642017_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_014884903.1|3642016_3642484_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
WP_006777754.1|3642582_3643236_-|terminase	Small terminase subunit	terminase	E5G6M7	Salmonella_phage	56.1	5.2e-56
WP_014884904.1|3643239_3644388_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	68.8	1.2e-132
WP_014884905.1|3644403_3645231_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	64.6	4.5e-73
WP_017382378.1|3645380_3647144_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	87.7	3.2e-312
WP_014884907.1|3647143_3648193_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	78.7	3.9e-154
WP_014884908.1|3648229_3649093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014884909.1|3649102_3649774_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014884910.1|3649792_3650602_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_014884911.1|3650906_3651494_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	37.2	4.5e-19
WP_080021220.1|3651535_3651934_-	DUF4065 domain-containing protein	NA	Q0H268	Geobacillus_phage	36.0	1.1e-08
WP_014884913.1|3652414_3652648_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	87.0	1.2e-31
WP_014884914.1|3652658_3652847_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.0	3.7e-23
WP_014884915.1|3653006_3653702_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	74.6	5.1e-94
WP_014884916.1|3653853_3656148_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	62.5	5.5e-270
WP_187289095.1|3656144_3656321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014884917.1|3656317_3657163_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	75.1	3.6e-110
WP_014884918.1|3657159_3657474_-	DUF3850 domain-containing protein	NA	R9TML3	Aeromonas_phage	53.5	2.0e-13
WP_014884919.1|3657470_3657698_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	81.3	2.4e-29
WP_014884920.1|3657697_3657931_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	67.5	8.1e-20
WP_014884921.1|3658000_3658201_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	73.8	3.0e-23
WP_014884922.1|3658187_3658415_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	74.7	1.6e-25
WP_014884923.1|3658422_3658932_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	86.4	2.4e-77
WP_014884924.1|3658964_3659207_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_014884925.1|3659326_3659959_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	92.4	4.8e-107
WP_014884926.1|3659960_3660989_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	2.9e-194
3662085:3662122	attR	ATGTAGAAATTTCGGACGCGGGTTCAACTCCCGCCAGC	NA	NA	NA	NA
