The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_HG941718	Escherichia coli O25b:H4-ST131 strain EC958	5109767	931924	1041719	5109767	plate,head,tRNA,transposase,holin,terminase,tail,capsid,protease,portal,integrase	Enterobacteria_phage(41.67%)	131	1027314:1027329	1046638:1046653
WP_000520781.1|931924_932245_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|932275_934552_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|935236_935455_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|935739_936444_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|936485_938207_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|938207_939974_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|940096_941062_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|941605_942100_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|942234_946341_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|946499_947111_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|947121_948465_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|948555_949848_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000078916.1|950153_950294_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|950485_950746_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|950786_951896_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|952053_953238_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|953237_953750_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|953805_954180_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|954188_954344_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_046025179.1|954330_957138_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	89.8	0.0e+00
WP_000979945.1|957150_957639_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|957667_958267_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_023363133.1|958494_959280_+	hypothetical protein	NA	Q858V4	Yersinia_virus	76.6	1.1e-108
WP_001554335.1|959281_959809_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_000972134.1|959837_960371_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_021538277.1|960373_962359_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
WP_000071703.1|962361_962892_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|962884_963781_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_001067543.1|963784_964114_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	8.4e-55
WP_001295912.1|964131_964698_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	6.6e-100
WP_000356366.1|964709_965345_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|965337_965805_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|965828_967706_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|967844_968240_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|968236_968629_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|968625_968949_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|968951_969152_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|969151_969646_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|969747_970548_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|970593_971646_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|971669_972506_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|972660_974412_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|974411_975458_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|975472_975997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|976720_977218_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|977257_978100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|978183_978498_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|978502_979462_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|979538_982361_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|982367_982733_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_023142408.1|982729_983347_-	ash family protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000104290.1|983358_983658_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|983654_983921_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|983917_984121_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|984144_984555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|984648_984762_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|984758_985001_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|985012_985291_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|985301_985652_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|985789_985981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|985987_986410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|986414_986936_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|987040_987382_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|987451_988444_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|988743_991188_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|991198_991816_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|991817_992681_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|992716_993343_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|993656_994805_+	MFS transporter	NA	NA	NA	NA	NA
WP_000111043.1|994901_995642_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|995833_998116_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|998170_999028_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|999433_1001194_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|1001323_1002016_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|1002214_1003303_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|1003373_1004657_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|1004912_1005485_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_064767240.1|1005544_1005985_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_023142129.1|1005995_1006457_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_000072165.1|1006463_1007078_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_000527461.1|1007077_1008409_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	4.8e-40
WP_000138756.1|1008411_1008990_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|1008982_1010086_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|1010076_1010424_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|1010478_1011075_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|1011071_1012226_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000478224.1|1012213_1012426_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|1012425_1013310_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|1013309_1016261_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|1016336_1016495_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|1016418_1016754_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|1016851_1017133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162832341.1|1017135_1017660_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000729834.1|1017656_1019084_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000666499.1|1019073_1019325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|1019324_1019789_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|1019788_1020235_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|1020236_1020575_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|1020584_1021538_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|1021552_1022668_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|1022882_1023341_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|1023343_1024165_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|1024145_1025642_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_169542415.1|1025641_1027183_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.3e-185
WP_000124060.1|1027233_1027779_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
1027314:1027329	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|1027778_1028090_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|1028089_1028416_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|1028412_1029063_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|1029046_1029787_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|1029789_1030140_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|1030270_1030999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295927.1|1030974_1031376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069610.1|1031377_1031596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|1031786_1032551_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|1032667_1033024_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|1033117_1033306_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|1033358_1033667_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|1033677_1034598_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|1034597_1034915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|1034930_1036700_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|1036710_1037877_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|1037879_1038149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|1038176_1038707_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|1038995_1039268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|1039277_1039574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|1039588_1039804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|1039800_1040484_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|1040480_1040711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|1040700_1040907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|1040908_1041358_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|1041329_1041719_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
1046638:1046653	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 2
NZ_HG941718	Escherichia coli O25b:H4-ST131 strain EC958	5109767	1253045	1298754	5109767	head,lysis,tRNA,holin,terminase,tail,capsid,portal,integrase	Enterobacteria_phage(56.0%)	58	1251363:1251377	1279957:1279971
1251363:1251377	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295972.1|1253045_1254152_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1254205_1254667_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|1254676_1255330_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1255501_1256752_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1256865_1258008_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1257997_1258234_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1258373_1258613_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1258596_1258923_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1258922_1259144_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|1259242_1259524_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|1259534_1259726_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1259698_1259881_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1259877_1260558_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1260554_1261340_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|1261345_1261642_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|1261717_1261924_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|1262519_1263209_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|1263313_1263544_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|1263613_1264153_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000147894.1|1264149_1265169_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
WP_000788794.1|1265165_1265867_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|1266116_1270382_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|1270418_1271462_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|1271811_1271913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|1271909_1272365_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|1272364_1272535_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|1272527_1272818_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|1272814_1273177_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|1273173_1273314_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|1273310_1274000_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|1274321_1274627_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|1274613_1275090_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|1275306_1275489_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1275579_1275873_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1276353_1276680_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1276886_1277069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|1277632_1278178_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|1278152_1280078_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
1279957:1279971	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|1280074_1280281_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|1280277_1281879_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|1281859_1283179_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|1283188_1283521_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|1283576_1284602_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|1284643_1285042_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|1285053_1285407_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000985120.1|1285418_1285997_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000683150.1|1285993_1286389_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|1286396_1287137_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|1287152_1287575_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|1287556_1287991_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|1287983_1290545_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|1290541_1290871_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|1290870_1291569_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|1291573_1292317_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|1292253_1292856_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|1292916_1296399_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|1296457_1298479_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|1298475_1298754_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 3
NZ_HG941718	Escherichia coli O25b:H4-ST131 strain EC958	5109767	1436716	1506430	5109767	head,transposase,holin,terminase,tail,capsid,protease,portal,integrase	Stx2-converting_phage(25.0%)	78	1432890:1432904	1438800:1438814
1432890:1432904	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|1436716_1437847_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1437824_1438073_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|1438137_1440609_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
1438800:1438814	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|1440701_1440893_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|1440889_1441078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|1441643_1441862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1442021_1442177_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|1442449_1443166_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|1443215_1443431_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|1443427_1443853_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|1443875_1444838_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|1444844_1445591_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|1445612_1446383_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|1446398_1446824_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|1446998_1447664_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|1447844_1448057_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|1448224_1448497_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|1448498_1449554_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|1449554_1449935_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|1449931_1450753_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|1450979_1451177_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|1451328_1452378_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|1453179_1453311_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|1453591_1453927_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|1454187_1456041_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|1456191_1456407_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|1456411_1456756_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|1456721_1456994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|1457099_1457633_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|1458187_1458274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1458495_1458681_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|1458766_1458982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|1459180_1459381_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|1459422_1459788_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|1460078_1460642_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|1460638_1462300_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|1462363_1464301_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|1464345_1464567_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|1464512_1467098_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|1467094_1467421_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1467430_1467781_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1467777_1468224_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1468220_1468565_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|1468631_1469348_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|1469362_1469737_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1469832_1470042_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212991.1|1470089_1473332_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_000807937.1|1473324_1473666_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|1473665_1474364_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|1474374_1475118_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|1475063_1475696_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|1476038_1479512_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001298859.1|1480152_1481694_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1481708_1482455_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_071550361.1|1482916_1485823_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
WP_001164137.1|1485838_1486366_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|1486396_1486930_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_022645053.1|1486931_1487717_-	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_001421220.1|1487944_1488127_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|1488325_1488994_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1489050_1489320_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|1489434_1489605_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001348267.1|1489731_1490289_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|1490285_1490561_-	ash family protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|1490936_1491743_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1491742_1492936_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000763535.1|1494308_1495904_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|1495903_1497466_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1497557_1497602_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|1497739_1498621_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1498617_1499238_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|1499265_1501161_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1501373_1502249_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000622024.1|1502418_1503441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|1503450_1503759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|1503815_1504406_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|1504402_1505161_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|1505380_1506430_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
NZ_HG941718	Escherichia coli O25b:H4-ST131 strain EC958	5109767	1997599	2085845	5109767	plate,tRNA,transposase,holin,terminase,tail,capsid,portal,integrase	Escherichia_phage(22.73%)	103	2043296:2043355	2085907:2086031
WP_099156422.1|1997599_1998948_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
WP_000568520.1|1999057_2000068_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2000076_2000688_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|2000826_2000892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024911.1|2000962_2001565_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2001566_2002088_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2002122_2002863_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|2002891_2003344_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|2003336_2005109_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|2005418_2005985_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|2005981_2006800_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2006852_2007248_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2007288_2008032_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|2008028_2009000_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|2009035_2011465_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|2011489_2012590_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|2012977_2013724_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|2013737_2014304_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2014519_2016253_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|2016305_2016698_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|2016697_2018776_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|2018768_2019917_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|2020105_2020750_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2020760_2021150_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2021164_2022214_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|2022216_2023077_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|2023367_2025029_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|2025173_2025677_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|2025697_2027662_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|2027666_2028593_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|2028589_2029477_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2029603_2030182_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2030184_2030535_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|2031314_2031743_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|2031749_2033174_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|2033148_2033949_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|2034115_2035102_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|2035116_2036631_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|2036700_2037690_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2038484_2038988_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2039065_2039317_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2039431_2039518_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|2039781_2040105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2040276_2040774_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2040811_2041051_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|2041241_2042453_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2042503_2043169_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2043296:2043355	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|2043640_2044060_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|2045274_2045499_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_001531768.1|2045660_2046050_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|2046085_2047726_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|2047834_2048116_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|2048128_2048641_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_000117510.1|2048658_2050161_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|2050157_2050547_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|2050546_2051731_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|2051723_2052350_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|2052352_2053273_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|2053269_2053611_-	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|2053613_2054516_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|2054496_2055033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2055029_2055710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|2055741_2056122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|2056118_2056538_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|2056572_2057607_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|2057665_2057995_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|2057994_2059302_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|2059301_2060876_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|2060872_2061106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|2061105_2062968_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|2062954_2063521_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|2063889_2064135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|2064194_2064389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|2064396_2064876_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|2064875_2065148_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|2065147_2065531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|2065643_2066315_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|2066314_2066608_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|2066604_2067201_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|2067278_2067458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2067609_2068251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|2068494_2068728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2069126_2069615_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|2069624_2070230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|2070692_2071391_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|2072578_2073502_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|2073676_2074465_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|2075146_2075371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2075367_2075679_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|2075675_2075912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|2075913_2076324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|2076362_2077778_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|2077767_2078523_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|2078519_2078744_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|2078783_2079260_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|2079318_2079549_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|2079647_2080061_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|2081071_2081392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|2081422_2083639_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|2083635_2084205_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|2084204_2084387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|2084596_2084860_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|2084828_2085845_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
2085907:2086031	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 5
NZ_HG941718	Escherichia coli O25b:H4-ST131 strain EC958	5109767	2104089	2182222	5109767	head,transposase,holin,terminase,tail,capsid,protease,portal,integrase	Escherichia_phage(41.07%)	96	2138865:2138880	2205224:2205239
WP_001347174.1|2104089_2104614_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_000879824.1|2104770_2105568_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001310919.1|2105577_2106129_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2106297_2106630_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2106973_2107288_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994425.1|2107502_2109161_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2109153_2110149_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282677.1|2110141_2110828_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213308.1|2110827_2112201_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2112219_2112663_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620069.1|2112659_2113787_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|2113891_2114356_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2114360_2115365_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282103.1|2115361_2115775_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001313947.1|2115777_2116143_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253318.1|2116142_2116880_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2116889_2117159_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983988.1|2117167_2117953_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103992.1|2118242_2118866_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867217.1|2118909_2119098_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2119260_2119488_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491527.1|2119783_2120599_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001531784.1|2120595_2122290_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2122460_2122643_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2122721_2123639_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|2123811_2124732_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|2124720_2125191_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157265.1|2125171_2126590_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001296176.1|2126656_2127352_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001330593.1|2127391_2127757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824383.1|2128322_2129438_+	porin	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
WP_000218217.1|2130030_2130882_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826711.1|2130989_2132348_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|2132347_2133019_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|2133151_2133565_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740067.1|2133673_2134678_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240063.1|2134678_2135314_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_099156434.1|2135397_2136746_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001007778.1|2137006_2137657_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000355363.1|2138740_2139028_-	hypothetical protein	NA	NA	NA	NA	NA
2138865:2138880	attL	TGCCCGAACATTTCGA	NA	NA	NA	NA
WP_000235978.1|2139038_2139743_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
WP_000654141.1|2139752_2140034_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001554173.1|2140033_2142412_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	76.1	1.9e-185
WP_000526135.1|2142532_2142991_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001228252.1|2143187_2143787_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_001554175.1|2143854_2147250_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_000741570.1|2147310_2147958_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	6.6e-112
WP_000140743.1|2147855_2148599_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.1e-150
WP_001152448.1|2148604_2149303_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.8	3.8e-129
WP_001330090.1|2149302_2149659_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224009.1|2149636_2152864_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.7	0.0e+00
WP_000978930.1|2152910_2153189_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
WP_000164661.1|2153212_2153584_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000097526.1|2153598_2154303_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	3.7e-116
WP_001206306.1|2154363_2154708_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_000347792.1|2154704_2155151_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	3.9e-63
WP_001147814.1|2155150_2155489_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|2155497_2155815_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766111.1|2155891_2157109_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	4.5e-162
WP_000999828.1|2157123_2157723_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923132.1|2157715_2158942_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.6	1.5e-202
WP_000811487.1|2158931_2159093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140907.1|2159089_2160847_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_001554177.1|2160846_2161329_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	7.4e-84
WP_001135103.1|2161476_2161827_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	4.7e-64
WP_000738421.1|2162352_2162646_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2162736_2162919_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992101.1|2163135_2163669_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_000193269.1|2163732_2164083_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.9e-36
WP_000372595.1|2164087_2164303_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|2164610_2164799_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_023281677.1|2165058_2165394_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000562553.1|2165674_2165806_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_021538919.1|2166701_2167523_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	1.5e-76
WP_000139998.1|2167537_2167900_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001296186.1|2167900_2168959_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	7.5e-89
WP_023141427.1|2168960_2169233_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|2169400_2169556_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000753060.1|2170477_2170654_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_001224667.1|2170646_2170829_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_001296187.1|2170922_2171279_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.9e-58
WP_001151210.1|2171336_2171759_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_000095675.1|2171799_2172762_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693943.1|2172784_2173210_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391951.1|2173193_2173475_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|2173575_2173995_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379575.1|2174260_2174416_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171947.1|2174575_2174794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296188.1|2174797_2174962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2175361_2175550_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070254.1|2175546_2175738_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_023363203.1|2175830_2178302_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000096342.1|2178360_2178564_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533615.1|2178563_2179589_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001311896.1|2179824_2180622_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000060157.1|2180959_2182222_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
2205224:2205239	attR	TGCCCGAACATTTCGA	NA	NA	NA	NA
>prophage 6
NZ_HG941718	Escherichia coli O25b:H4-ST131 strain EC958	5109767	2271302	2277754	5109767	transposase	Acidithiobacillus_phage(16.67%)	9	NA	NA
WP_001298859.1|2271302_2272844_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2272858_2273605_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000846703.1|2274053_2274464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|2274684_2275503_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|2275502_2275748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|2275841_2276315_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|2276330_2276807_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2276869_2277091_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|2277109_2277754_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
>prophage 7
NZ_HG941718	Escherichia coli O25b:H4-ST131 strain EC958	5109767	2308557	2314860	5109767		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|2308557_2309100_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|2309104_2309983_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|2310040_2310940_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|2310939_2312025_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|2312397_2313291_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|2313465_2314860_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 8
NZ_HG941718	Escherichia coli O25b:H4-ST131 strain EC958	5109767	2409813	2419258	5109767		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|2409813_2410950_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|2410946_2412950_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|2413074_2413536_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2413576_2414047_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2414093_2414813_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2414809_2416495_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|2416716_2417448_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|2417507_2417615_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|2417595_2418327_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|2418331_2419258_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 9
NZ_HG941718	Escherichia coli O25b:H4-ST131 strain EC958	5109767	3252267	3314357	5109767	tRNA,lysis,transposase,protease,integrase	Staphylococcus_phage(50.0%)	52	3253476:3253493	3313754:3313771
WP_001296354.1|3252267_3253026_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|3253455_3254376_-	agmatinase	NA	NA	NA	NA	NA
3253476:3253493	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|3254511_3255243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3255388_3257365_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3257373_3257505_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|3257640_3257856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3258159_3259314_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3259749_3261144_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001296359.1|3261220_3261718_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3261812_3262520_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3262599_3263331_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|3263343_3264294_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3264402_3264966_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3264965_3265382_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|3265496_3266477_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3266494_3267199_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3267216_3267783_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277229.1|3267779_3268070_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|3268077_3268671_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|3268663_3269800_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|3270114_3271101_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|3271145_3271649_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|3271648_3272950_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|3273005_3274013_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|3274129_3275176_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3275351_3276071_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|3276091_3276232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|3276254_3276581_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3276580_3277300_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|3277460_3278513_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3278540_3278816_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3278880_3279960_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|3280161_3281418_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839781.1|3281466_3283602_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|3283994_3284702_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|3285080_3286346_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|3286601_3287645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|3289338_3289890_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296368.1|3292393_3292615_+	pap operon regulatory protein PapI	NA	NA	NA	NA	NA
WP_001513409.1|3294482_3294596_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001110186.1|3296429_3296690_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|3296731_3297292_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|3297331_3297760_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000074472.1|3298477_3299671_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|3299806_3301531_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|3301531_3302479_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|3302478_3304221_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|3304217_3305495_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|3305576_3307778_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_011076574.1|3308328_3308472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034083.1|3308721_3312609_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|3313205_3314357_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3313754:3313771	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 10
NZ_HG941718	Escherichia coli O25b:H4-ST131 strain EC958	5109767	4880423	4957423	5109767	protease,tRNA,transposase	Enterobacteria_phage(15.79%)	58	NA	NA
WP_001162171.1|4880423_4881776_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232240.1|4881958_4882345_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106238.1|4882389_4882854_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187791.1|4883012_4885151_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001296690.1|4885544_4887200_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001296691.1|4887249_4888671_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|4888789_4889737_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|4889921_4889975_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|4890115_4892812_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|4893017_4893404_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4893476_4893938_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4893950_4894886_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|4894889_4895024_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230273.1|4895304_4895700_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500696.1|4895830_4896544_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256667.1|4896614_4897208_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296694.1|4897352_4897805_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_000012944.1|4899580_4900585_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4900746_4901163_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059398.1|4901208_4901712_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079649.1|4901904_4903101_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416407.1|4903154_4906010_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|4906009_4906453_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4906808_4908320_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|4908586_4909687_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001296697.1|4909686_4910769_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001296698.1|4910929_4912432_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	4.6e-84
WP_001296699.1|4912561_4913581_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_001064798.1|4916874_4917639_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001545174.1|4917878_4918778_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_001044501.1|4918794_4920312_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_000440185.1|4920389_4921403_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_000939276.1|4921663_4922908_+	MFS transporter	NA	NA	NA	NA	NA
WP_000239754.1|4924599_4924836_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.7	9.0e-19
WP_000422741.1|4925173_4925599_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4925595_4925946_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|4925976_4927590_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000107487.1|4927860_4928874_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998348.1|4928885_4930202_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|4930229_4931150_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|4931455_4932238_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000527665.1|4933463_4933571_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145475.1|4933751_4934408_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001296707.1|4934655_4935933_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000608644.1|4937618_4938881_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001310555.1|4939086_4940103_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000976515.1|4940403_4941549_+	class C beta-lactamase CMY-23	NA	NA	NA	NA	NA
WP_085947616.1|4942429_4943586_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000177057.1|4944519_4944777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4945333_4946101_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4946101_4947058_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125187.1|4947054_4948053_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|4948049_4948952_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188262.1|4948996_4951321_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068908.1|4951407_4952361_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|4952357_4952879_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000823243.1|4954440_4955799_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|4956037_4957423_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
>prophage 1
NZ_HG941719	Escherichia coli O25b:H4-ST131 strain EC958 plasmid pEC958, complete sequence	135602	36351	86911	135602	transposase,protease	Escherichia_phage(36.36%)	46	NA	NA
WP_001067855.1|36351_37056_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000608641.1|37299_38562_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|39125_39683_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|39865_40726_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|43486_44191_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000224416.1|44306_44612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080256.1|44620_45259_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_000821856.1|45255_47106_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000864353.1|47132_47390_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_001030371.1|47382_48126_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_000556796.1|48139_48484_+	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_000624194.1|48602_48887_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_000059831.1|48873_49419_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_001309242.1|49348_49696_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_001444237.1|49643_50069_+	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_000944331.1|50055_51429_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001007039.1|51425_54248_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000605870.1|54263_54749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000782451.1|54797_55529_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000199905.1|55731_56469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000009332.1|56519_58718_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000948354.1|58717_63988_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205725.1|64007_64754_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	2.4e-09
WP_000704523.1|64812_65673_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.9e-10
WP_000139321.1|65775_66336_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001309245.1|66464_66677_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233838.1|67698_68160_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001298565.1|68205_68415_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766807.1|68452_69043_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000083830.1|69282_69537_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|69774_69849_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130646.1|69841_70699_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|71637_72291_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|72383_72641_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|72573_72975_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|75379_76084_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000874189.1|76793_77279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267177.1|77303_77789_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|77775_78471_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729220.1|78475_79606_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|79595_80879_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|80881_82261_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|82364_82892_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|82932_84819_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|85165_85981_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_001067855.1|86206_86911_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
