The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017549	Pseudomonas aeruginosa NCGM2.S1 chromosome 1, complete sequence	6764661	1697597	1760495	6764661	integrase,holin,portal,tail,capsid,protease,terminase,lysis,head	Pseudomonas_phage(71.43%)	78	1700493:1700520	1740564:1740591
WP_003085672.1|1697597_1698584_+|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	49.8	2.2e-90
WP_003085674.1|1698569_1700279_-	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
1700493:1700520	attL	TTTGGTGGAGCCGGGGGGATTTGAACCC	NA	NA	NA	NA
WP_014603615.1|1701005_1701449_-	SocA family protein	NA	I6R0L8	Salmonella_phage	56.8	4.3e-46
WP_072018016.1|1701515_1702694_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	95.8	2.1e-209
WP_023103993.1|1702836_1703166_-	hypothetical protein	NA	A0A1W6JT94	Pseudomonas_phage	99.1	1.8e-57
WP_003085679.1|1703158_1703878_-	hypothetical protein	NA	A0A1W6JTE0	Pseudomonas_phage	94.1	3.4e-125
WP_003085682.1|1703874_1704066_-	hypothetical protein	NA	A0A0A0YQ21	Pseudomonas_phage	100.0	9.2e-30
WP_003085685.1|1704184_1705000_-	hypothetical protein	NA	A0A0A0YUE9	Pseudomonas_phage	87.7	5.7e-60
WP_003085687.1|1704996_1705332_-	hypothetical protein	NA	A0A1W6JTA6	Pseudomonas_phage	99.1	1.2e-53
WP_003085689.1|1705334_1705565_-	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	89.5	2.9e-30
WP_003085692.1|1705606_1706443_-	prohibitin family protein	NA	A0A0A0YRT7	Pseudomonas_phage	100.0	1.0e-128
WP_003085694.1|1706439_1706694_-	hypothetical protein	NA	A0A0A0YUF2	Pseudomonas_phage	100.0	3.8e-39
WP_014603617.1|1706793_1707027_-	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	98.7	1.5e-37
WP_003085698.1|1707029_1707416_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	95.8	8.3e-54
WP_107236447.1|1707606_1707684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012613694.1|1707736_1708096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019396631.1|1708092_1708386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014603618.1|1708498_1709290_-	helix-turn-helix transcriptional regulator	NA	A0A2K8HKD5	Pseudomonas_phage	81.2	2.5e-76
WP_023465045.1|1709378_1709717_+	hypothetical protein	NA	A0A1W6JTD1	Pseudomonas_phage	49.4	7.9e-08
WP_003085704.1|1709713_1710106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023103992.1|1710411_1710762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085707.1|1710836_1711037_+	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	76.9	2.5e-17
WP_003085709.1|1711033_1711342_+	hypothetical protein	NA	A0A0A0YWH5	Pseudomonas_phage	93.1	1.1e-45
WP_023103745.1|1711338_1711617_+	hypothetical protein	NA	A0A0A0YR77	Pseudomonas_phage	79.3	7.1e-31
WP_003085714.1|1711609_1711843_+	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	96.1	6.4e-33
WP_023086959.1|1712462_1713302_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	96.1	7.9e-150
WP_003085722.1|1713477_1714098_+	ATP-binding protein	NA	A0A1W6JTD8	Pseudomonas_phage	99.5	2.9e-109
WP_003085724.1|1714094_1715492_+	AAA family ATPase	NA	A0A1W6JTB3	Pseudomonas_phage	99.8	1.5e-265
WP_003085726.1|1715488_1715773_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	96.6	4.5e-41
WP_003085729.1|1715769_1716327_+	hypothetical protein	NA	A0A0A0YRV6	Pseudomonas_phage	97.1	1.2e-74
WP_003085732.1|1716855_1717386_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	37.3	1.2e-26
WP_004353177.1|1717471_1717804_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	96.4	1.9e-54
WP_003085737.1|1717800_1718412_+	glycoside hydrolase family 19 protein	NA	A0A1B0Z086	Pseudomonas_phage	91.1	4.0e-103
WP_003085739.1|1718425_1718656_+	hypothetical protein	NA	A0A2C9CY14	Yersinia_phage	60.6	4.1e-16
WP_003085741.1|1718662_1719136_+|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	89.1	3.3e-68
WP_023103989.1|1719135_1719465_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	53.7	5.1e-28
WP_003085748.1|1719879_1720371_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	37.0	3.2e-10
WP_022580266.1|1720374_1722054_+|terminase	terminase large subunit	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	65.8	2.8e-194
WP_023103987.1|1722056_1723274_+|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	73.2	1.5e-170
WP_003085756.1|1723257_1723902_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	75.7	3.5e-89
WP_003085757.1|1723898_1725113_+|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	67.3	4.1e-155
WP_003085760.1|1725164_1725368_+	hypothetical protein	NA	A0A2H4JG33	uncultured_Caudovirales_phage	50.0	1.8e-07
WP_003085762.1|1725367_1725691_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	65.6	9.1e-30
WP_022580265.1|1725690_1726017_+|head,tail	head-tail adaptor protein	head,tail	A0A2D1GNG1	Pseudomonas_phage	57.3	2.8e-18
WP_014603624.1|1726058_1726217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023103986.1|1726220_1726793_+	hypothetical protein	NA	A0A2D1GNN2	Pseudomonas_phage	48.9	1.3e-39
WP_003085767.1|1726785_1727172_+	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	63.8	4.9e-38
WP_003085769.1|1727204_1727705_+	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	79.3	2.8e-70
WP_003085771.1|1727749_1728094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085773.1|1728090_1728318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085775.1|1728358_1731616_+|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	35.9	4.0e-80
WP_003085778.1|1731615_1731954_+|tail	phage tail protein	tail	A0A1B0VMG7	Pseudomonas_phage	49.1	1.1e-28
WP_014603625.1|1731950_1732697_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	77.5	5.1e-116
WP_003085782.1|1732699_1733458_+	C40 family peptidase	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	75.7	2.1e-117
WP_015649319.1|1733504_1733747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015649318.1|1733743_1734160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022580264.1|1734208_1734781_+|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	63.6	1.3e-58
WP_014603627.1|1734837_1738290_+	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	83.0	0.0e+00
WP_031632464.1|1739649_1740375_+	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	58.9	1.2e-56
WP_003085791.1|1740979_1741858_-	hypothetical protein	NA	NA	NA	NA	NA
1740564:1740591	attR	TTTGGTGGAGCCGGGGGGATTTGAACCC	NA	NA	NA	NA
WP_003085795.1|1741945_1742629_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085798.1|1742737_1743679_+	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	33.3	4.4e-08
WP_003085801.1|1743812_1744646_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003085802.1|1744770_1745790_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085806.1|1745891_1746533_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003085808.1|1746638_1747352_+	OmpA family protein	NA	NA	NA	NA	NA
WP_003085811.1|1747421_1748336_-	acyltransferase	NA	NA	NA	NA	NA
WP_003085813.1|1748462_1750577_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003085814.1|1750639_1751824_-	acetate kinase	NA	NA	NA	NA	NA
WP_003109430.1|1751823_1752162_-	DUF3565 domain-containing protein	NA	NA	NA	NA	NA
WP_003085816.1|1752130_1752616_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003085818.1|1752821_1753304_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003085819.1|1753456_1754047_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085824.1|1754087_1755200_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003085826.1|1755390_1756350_+	DegV family protein	NA	NA	NA	NA	NA
WP_003085828.1|1756353_1757574_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_009315289.1|1757661_1758285_-	phospholipase C accessory protein PlcR	NA	NA	NA	NA	NA
WP_003085833.1|1758302_1760495_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
>prophage 2
NC_017549	Pseudomonas aeruginosa NCGM2.S1 chromosome 1, complete sequence	6764661	1880812	1905551	6764661	integrase,tRNA,transposase	Escherichia_phage(55.56%)	26	1892285:1892344	1905555:1906375
WP_003086089.1|1880812_1882528_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003086091.1|1882635_1883043_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_001067855.1|1883806_1884511_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|1885900_1886569_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|1886604_1886841_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|1886837_1887200_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|1887217_1888912_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|1888963_1889386_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|1889421_1889697_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|1889710_1890061_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|1890132_1890567_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000027057.1|1890848_1891709_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
1892285:1892344	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|1892347_1893052_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012196455.1|1893547_1893778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|1893984_1894998_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_003159548.1|1895150_1895891_+	subclass B1 metallo-beta-lactamase IMP-1	NA	NA	NA	NA	NA
WP_003159545.1|1896044_1896596_+	aminoglycoside 6'-N-acetyltransferase AAC(6')-Iae	NA	NA	NA	NA	NA
WP_001206316.1|1896670_1897462_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|1897625_1897973_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|1897966_1898806_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|1898933_1899434_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000983249.1|1899609_1900395_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_001324342.1|1900381_1901905_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000287615.1|1902027_1903572_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_000344784.1|1903622_1904483_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_001067855.1|1904846_1905551_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
1905555:1906375	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCTCTTCGAGTTCAGCACCGTACAGGGAGGCGCTGAGGTTATCGGTGATTGCGTAGCGGCCCCCAATGAAATCGGCGCTCTTGGCGGTCTCGCCTGCATAGGTTGCGTAGAGTTCGCCGCGCGACTTGGTGGTGGTGCCCTGCTTGCCTTCGGTGAAGTGGCCCGCTTCGAGATCGAGCCCTTCGAGTTCGCTGCTCTGCAGTTGGAAGCCGGTCGCGGTCTGCGGGAACAGGCGGCTGCCGCCGGCGGCGAAGACCGGAGCGGTCGGCTGCATCTCGCCCCACTTCAACATGGTCTTGGAGATGCGTACCTTCACGGCGCCACCGGCGCGGCTGTAGTCGTCACGGGGCGTGCCGTCGTTCATCACCGGCAGGTTGCCGGTACCGCTCTTGTCCGAGGTGCCGTCGAGCTTCAGACCGAGGTAGCCGAAGGCATCGACGCCGAAGCCCACGGTGCCTTGGGTGAAGCCGGATTCATAGGTGGTGAGGAAGCCTTGGGTCCAGTCGACGCGGTCCCCGCTGCCGCTCTTGCCGTCACGGTTGAAATAGTAGTTGCGGAGCAGCAGGTCGAGGCTGCTGTCTTCGATGAACCCCTTCGCTTCGGCCTGATCGCTGACGAATGCGTCGGCCACGGCGAACTGAGTGCTACCTGCGGAAACCGCCAGTGCAATGGCGCTCCACTTCATCACTTTCATTGTGATTGCTCCTTTGGTTTTGAAATTATCTCTGCCATCACAGTGCCGCAGTGACGGCTAGTTCTTCTT	NA	NA	NA	NA
>prophage 3
NC_017549	Pseudomonas aeruginosa NCGM2.S1 chromosome 1, complete sequence	6764661	3078017	3128824	6764661	integrase,head,terminase	Pseudomonas_phage(87.1%)	69	3078565:3078580	3114210:3114225
WP_003111315.1|3078017_3079607_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	5.9e-61
3078565:3078580	attL	ACGCGCTCGCCGGCCT	NA	NA	NA	NA
WP_034033105.1|3079637_3080855_-|integrase	site-specific integrase	integrase	A0A0U4B0G7	Pseudomonas_phage	99.0	6.6e-230
WP_014603736.1|3081104_3081485_-	hypothetical protein	NA	A0A0S2SY48	Pseudomonas_phage	49.0	1.0e-24
WP_123822976.1|3081481_3081685_-	hypothetical protein	NA	D4FUM8	Pseudomonas_phage	100.0	6.5e-34
WP_049821773.1|3081685_3081988_-	hypothetical protein	NA	A0A0A1IVN6	Pseudomonas_phage	61.0	3.5e-23
WP_014603738.1|3081990_3082476_-	dual specificity protein phosphatase family protein	NA	A0A127KNP4	Pseudomonas_phage	98.8	1.3e-88
WP_014603739.1|3082460_3082607_-	hypothetical protein	NA	Q9MC62	Pseudomonas_phage	91.7	6.8e-17
WP_041025732.1|3082760_3083084_-	hypothetical protein	NA	A0A1B0Z2L6	Pseudomonas_phage	87.9	4.8e-47
WP_014603741.1|3083128_3083332_-	hypothetical protein	NA	A0A125RNQ4	Pseudomonas_phage	97.0	8.0e-32
WP_014603742.1|3083328_3083970_-	hypothetical protein	NA	A0A2H5BQE7	Pseudomonas_phage	100.0	5.5e-18
WP_003140732.1|3085726_3085933_-	hypothetical protein	NA	H2BDF2	Pseudomonas_virus	84.1	1.3e-26
WP_003097969.1|3086145_3086484_-	hypothetical protein	NA	A0A125RNR1	Pseudomonas_phage	100.0	2.7e-56
WP_003097967.1|3086480_3087107_-	YqaJ viral recombinase family protein	NA	A0A125RNR2	Pseudomonas_phage	100.0	6.4e-120
WP_014603745.1|3087110_3087731_-	ERF family protein	NA	A0A125RNR3	Pseudomonas_phage	100.0	1.8e-106
WP_014603746.1|3087871_3088936_-	hypothetical protein	NA	Q9MC69	Pseudomonas_phage	94.9	5.6e-84
WP_023098766.1|3089115_3089253_-	hypothetical protein	NA	A0A0S2SY24	Pseudomonas_phage	97.7	1.9e-16
WP_171950530.1|3089249_3090011_-	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	60.3	2.3e-63
WP_034063451.1|3090123_3090513_-	hypothetical protein	NA	A0A125RNR7	Pseudomonas_phage	99.2	1.1e-69
WP_041025733.1|3090509_3091025_-	hypothetical protein	NA	Q9MC57	Pseudomonas_phage	54.4	2.2e-46
WP_003088379.1|3091021_3091387_-	hypothetical protein	NA	A0A125RNR9	Pseudomonas_phage	95.0	2.2e-64
WP_126583779.1|3091800_3092112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023125081.1|3092146_3092407_-	hypothetical protein	NA	B5WZX2	Pseudomonas_phage	36.1	1.9e-06
WP_003088383.1|3092433_3092784_-	hypothetical protein	NA	A0A1W6DWS2	Sphingobium_phage	44.0	3.5e-19
WP_031640142.1|3093159_3093357_-	hypothetical protein	NA	A0A0S2SYA6	Pseudomonas_phage	83.1	1.3e-26
WP_003088385.1|3093429_3093699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003088387.1|3093948_3094155_-	hypothetical protein	NA	A0A0U4IJ22	Pseudomonas_phage	94.1	2.5e-33
WP_173399890.1|3094165_3094468_-	hypothetical protein	NA	A0A0U4B0I0	Pseudomonas_phage	92.0	2.9e-46
WP_020750346.1|3094841_3095495_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_033991089.1|3095608_3096049_-	type II toxin-antitoxin system YafO family toxin	NA	A0A0S2SYH1	Pseudomonas_phage	97.9	7.7e-80
WP_033991091.1|3096057_3096600_-	hypothetical protein	NA	A0A0S2SYL8	Pseudomonas_phage	97.8	6.6e-89
WP_033867552.1|3097003_3097918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033991093.1|3097995_3098469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049821776.1|3098563_3099052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024007928.1|3099099_3099768_-	helix-turn-helix transcriptional regulator	NA	A0A125RNS6	Pseudomonas_phage	99.1	2.7e-124
WP_015980312.1|3099855_3100077_+	helix-turn-helix domain-containing protein	NA	A0A125RNS7	Pseudomonas_phage	100.0	5.8e-36
WP_141401729.1|3100389_3100602_+	hypothetical protein	NA	A0A0S2SYE2	Pseudomonas_phage	92.7	1.9e-20
WP_014603753.1|3100768_3101686_+	YdaU family protein	NA	Q8W642	Enterobacteria_phage	58.0	2.7e-18
WP_014603754.1|3101682_3103512_+	toprim domain-containing protein	NA	A0A0U4B0G9	Pseudomonas_phage	94.3	0.0e+00
WP_014603755.1|3103627_3103843_+	hypothetical protein	NA	A0A125RNK4	Pseudomonas_phage	93.0	2.2e-32
WP_014603756.1|3103835_3104252_+	recombination protein NinB	NA	B5WZY4	Pseudomonas_phage	100.0	1.7e-76
WP_031688190.1|3104248_3104584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034005849.1|3104580_3104850_+	hypothetical protein	NA	B5WZY5	Pseudomonas_phage	92.0	1.1e-41
WP_153562489.1|3104846_3105005_+	hypothetical protein	NA	A0A0S2SYG6	Pseudomonas_phage	63.5	1.6e-11
WP_033894961.1|3105001_3105235_+	hypothetical protein	NA	A0A0S2SYK5	Pseudomonas_phage	97.4	5.2e-35
WP_014603757.1|3105231_3105876_+	recombination protein NinG	NA	A0A0S2SY91	Pseudomonas_phage	94.4	4.3e-111
WP_024007940.1|3105872_3106445_+	hypothetical protein	NA	H2BDI9	Pseudomonas_virus	36.9	2.9e-26
WP_023434898.1|3107217_3107550_+	peptidase M48	NA	A0A125RNL3	Pseudomonas_phage	100.0	2.6e-56
WP_014603758.1|3107552_3107825_+	hypothetical protein	NA	A0A125RNL4	Pseudomonas_phage	97.8	3.1e-39
WP_044719990.1|3107815_3108400_+|terminase	terminase small subunit	terminase	A0A2P9HY59	Yersinia_phage	67.0	1.8e-60
WP_014603760.1|3108389_3109853_+	hypothetical protein	NA	G0ZND4	Cronobacter_phage	83.5	1.5e-241
WP_014603761.1|3109852_3110050_+	hypothetical protein	NA	H2BD77	Pseudomonas_phage	100.0	2.3e-28
WP_034005440.1|3110052_3111423_+	DUF1073 domain-containing protein	NA	A0A125RNL9	Pseudomonas_phage	98.2	1.0e-263
WP_173399893.1|3111385_3112309_+|head	phage head morphogenesis protein	head	H2BD79	Pseudomonas_phage	98.7	8.4e-169
WP_014603764.1|3112312_3113590_+	hypothetical protein	NA	H2BD80	Pseudomonas_phage	99.1	2.4e-214
WP_014603765.1|3113593_3114043_+	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	98.7	6.2e-77
WP_014603766.1|3114058_3115153_+	hypothetical protein	NA	J7I0Q9	Pseudomonas_phage	98.6	7.0e-207
3114210:3114225	attR	ACGCGCTCGCCGGCCT	NA	NA	NA	NA
WP_014603768.1|3115438_3115840_+	hypothetical protein	NA	J7HX89	Pseudomonas_phage	98.5	7.8e-71
WP_041025734.1|3115836_3116157_+	hypothetical protein	NA	J7I4I8	Pseudomonas_phage	97.2	1.5e-56
WP_023124723.1|3116158_3116563_+	hypothetical protein	NA	J7I0Q5	Pseudomonas_phage	99.3	2.1e-68
WP_014603770.1|3116559_3116934_+	hypothetical protein	NA	J7I407	Pseudomonas_phage	98.4	8.3e-67
WP_014603771.1|3116948_3117944_+	Ig-like domain-containing protein	NA	J7HX84	Pseudomonas_phage	94.3	2.9e-159
WP_014603772.1|3117940_3118558_+	hypothetical protein	NA	A0A125RNN1	Pseudomonas_phage	98.5	1.3e-112
WP_014603773.1|3118557_3121569_+	tape measure protein	NA	H2BD91	Pseudomonas_phage	98.5	0.0e+00
WP_016852774.1|3121565_3122033_+	hypothetical protein	NA	H2BD92	Pseudomonas_phage	99.4	1.4e-92
WP_014603775.1|3122016_3122508_+	DUF1833 family protein	NA	J7I404	Pseudomonas_phage	96.3	2.3e-88
WP_014603776.1|3122512_3122920_+	hypothetical protein	NA	J7HX80	Pseudomonas_phage	98.5	3.4e-74
WP_014603777.1|3122891_3125615_+	hypothetical protein	NA	H2BD95	Pseudomonas_phage	84.3	0.0e+00
WP_014603779.1|3127829_3128459_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	96.2	3.8e-112
WP_033989743.1|3128455_3128824_+	hypothetical protein	NA	J7HXL1	Pseudomonas_phage	100.0	4.2e-55
>prophage 4
NC_017549	Pseudomonas aeruginosa NCGM2.S1 chromosome 1, complete sequence	6764661	3611103	3650369	6764661	plate,tail	Enterobacteria_phage(33.33%)	32	NA	NA
WP_003089486.1|3611103_3612435_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_003089492.1|3612494_3612971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089493.1|3613178_3613724_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003089494.1|3613746_3615231_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003089495.1|3615304_3615802_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003089496.1|3615814_3616240_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003089497.1|3616223_3618017_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003089501.1|3617980_3618997_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_014603835.1|3618998_3621548_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	5.5e-77
WP_003089506.1|3621621_3622155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098657.1|3622193_3623261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089509.1|3623297_3625304_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.3	2.2e-41
WP_003089510.1|3625314_3625851_+	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_003089513.1|3625873_3626269_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003089515.1|3626545_3627187_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003089517.1|3627387_3628593_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003089519.1|3629009_3631325_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003089521.1|3631321_3631792_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003089523.1|3632057_3632300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089526.1|3632594_3632837_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003089528.1|3632903_3634055_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003114511.1|3634151_3635072_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003139299.1|3635617_3637906_-	acylase	NA	NA	NA	NA	NA
WP_003089540.1|3638028_3639360_-	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_003089542.1|3639476_3639956_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003089544.1|3640116_3641112_+	FecR family protein	NA	NA	NA	NA	NA
WP_003089547.1|3641211_3642387_+	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_014603836.1|3642386_3644378_+	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	39.3	6.9e-35
WP_073660165.1|3644383_3645808_+	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_020750878.1|3645856_3647503_-	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_003089553.1|3647716_3649063_+|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_003089554.1|3649085_3650369_+|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
>prophage 5
NC_017549	Pseudomonas aeruginosa NCGM2.S1 chromosome 1, complete sequence	6764661	3954588	3961482	6764661	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003090386.1|3954588_3955257_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_003090387.1|3955367_3955763_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090389.1|3955759_3956119_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090391.1|3956118_3956424_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090393.1|3956420_3956756_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090395.1|3956752_3957736_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	73.7	2.1e-141
WP_003090397.1|3957823_3958798_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003108773.1|3958802_3960200_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003090402.1|3960201_3961482_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	2.4e-97
>prophage 6
NC_017549	Pseudomonas aeruginosa NCGM2.S1 chromosome 1, complete sequence	6764661	4150733	4231660	6764661	integrase,portal,plate,tail,capsid,protease,lysis,terminase,tRNA,head	uncultured_Caudovirales_phage(33.33%)	100	4159739:4159756	4230079:4230096
WP_014603870.1|4150733_4151204_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_003160516.1|4151255_4151642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090812.1|4151828_4152272_-	PACE efflux transporter	NA	NA	NA	NA	NA
WP_003090813.1|4152374_4153262_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003090814.1|4153472_4153787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090815.1|4154151_4155432_+	OprD family porin	NA	NA	NA	NA	NA
WP_019485079.1|4155543_4155960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090818.1|4156002_4156347_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003090820.1|4156458_4156668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090821.1|4156938_4157127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090822.1|4157141_4157351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090823.1|4157681_4158377_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_073660286.1|4158424_4159324_-	Dyp-type peroxidase	NA	A0A0M5KAH8	Mollivirus	28.9	4.5e-18
WP_003090825.1|4159665_4160247_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
4159739:4159756	attL	TCCAGGACCTTGTCGCGC	NA	NA	NA	NA
WP_003090826.1|4160334_4161303_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003090827.1|4161308_4161791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090829.1|4161941_4162352_-	NUDIX domain-containing protein	NA	A0A1L7N0J3	Ralstonia_phage	42.5	2.3e-22
WP_003090830.1|4162373_4163153_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003099145.1|4163254_4163494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090832.1|4163864_4164698_+	acid phosphatase	NA	NA	NA	NA	NA
WP_003090833.1|4164731_4164956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090834.1|4165116_4165287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073660287.1|4165306_4165828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003138819.1|4166026_4166614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090838.1|4166618_4167056_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_003090841.1|4167507_4168791_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003090842.1|4168841_4169798_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	56.0	1.4e-73
WP_011666615.1|4169879_4170758_-	PA2778 family cysteine peptidase	NA	NA	NA	NA	NA
WP_003090843.1|4170841_4171240_-	PA2779 family protein	NA	NA	NA	NA	NA
WP_003115217.1|4171644_4171989_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_107236445.1|4172003_4172651_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_014603872.1|4173542_4175366_+	carbohydrate binding domain-containing protein	NA	NA	NA	NA	NA
WP_003090849.1|4175536_4176094_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_003090850.1|4176102_4176321_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003090851.1|4176435_4176903_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003090852.1|4176969_4178208_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003090853.1|4178229_4179825_-	type IV pili methyl-accepting chemotaxis transducer N-terminal domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.0e-32
WP_003090854.1|4180068_4181148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003138785.1|4181582_4182068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090858.1|4182168_4182459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090859.1|4182552_4183149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090863.1|4183229_4184264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003116580.1|4184530_4185187_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003090864.1|4185291_4186506_+	MFS transporter	NA	NA	NA	NA	NA
WP_003104048.1|4186533_4187127_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_014603873.1|4188013_4188529_+	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	95.9	6.2e-97
WP_014603874.1|4188824_4189514_+	SOS response-associated peptidase	NA	A0A2K8I970	Pseudomonas_phage	90.4	5.7e-122
WP_014603875.1|4189495_4189759_-	hypothetical protein	NA	A0A0S2SYE1	Pseudomonas_phage	93.1	1.1e-41
WP_041025739.1|4190450_4190948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173399891.1|4191275_4191830_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_041025741.1|4191826_4192456_-	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	86.1	2.0e-97
WP_014603877.1|4192567_4192753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014603878.1|4192790_4193843_-	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	70.1	2.2e-133
WP_015649042.1|4193856_4194063_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	62.7	9.6e-17
WP_014603880.1|4194037_4194877_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	54.3	6.0e-81
WP_014603881.1|4194885_4197576_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	30.2	6.9e-46
WP_014603883.1|4197714_4198011_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_014603884.1|4198020_4198530_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	97.6	9.8e-87
WP_014603885.1|4198542_4199703_-|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	97.9	1.1e-215
WP_023127307.1|4199746_4200211_-	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	38.6	4.0e-18
WP_014603887.1|4200207_4202289_-|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	50.3	2.8e-111
WP_014603888.1|4202285_4202816_-|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	56.9	3.4e-50
WP_014603889.1|4202812_4203697_-|plate	baseplate J/gp47 family protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	73.6	7.4e-114
WP_014603890.1|4203693_4204020_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	65.7	2.3e-33
WP_014603891.1|4204029_4204251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014603892.1|4204308_4204866_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	67.0	3.4e-48
WP_014603893.1|4204862_4205399_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.9	3.0e-33
WP_014603894.1|4205391_4206060_-	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	59.3	3.7e-65
WP_015649052.1|4206059_4206374_-	hypothetical protein	NA	A0A2H4J879	uncultured_Caudovirales_phage	45.8	2.1e-18
WP_014603895.1|4206376_4206562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014603896.1|4206563_4207601_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	40.5	1.7e-69
WP_014603897.1|4207616_4207967_-|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	42.2	2.5e-12
WP_014603898.1|4207980_4209201_-	S49 family peptidase	NA	A0A219YAK4	Aeromonas_phage	34.7	7.0e-46
WP_031652606.1|4209203_4210817_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	39.6	5.5e-91
WP_014603900.1|4210819_4211035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049821835.1|4211047_4212934_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	50.0	2.7e-161
WP_023127296.1|4212977_4213502_-|terminase	terminase small subunit	terminase	A0A2D1GMW4	Marinobacter_phage	37.2	1.5e-18
WP_014603903.1|4213616_4213979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019396873.1|4214550_4214922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049243292.1|4214918_4217165_-	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	47.7	8.2e-194
WP_023118639.1|4217128_4217338_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_014603906.1|4217330_4217885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726484.1|4218201_4218456_-	helix-turn-helix domain-containing protein	NA	A0A2H4JA29	uncultured_Caudovirales_phage	45.6	1.5e-06
WP_171894642.1|4218469_4219276_+	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	35.8	2.7e-22
WP_023087724.1|4219558_4219870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014603908.1|4219879_4220173_+	phage antirepressor KilAC domain-containing protein	NA	NA	NA	NA	NA
WP_031673600.1|4220326_4220635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031639816.1|4220631_4220949_+	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_014603910.1|4220999_4221626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014603911.1|4221622_4221862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014603912.1|4221870_4222431_+	Lar family restriction alleviation protein	NA	G4WAD0	Salmonella_phage	44.9	6.3e-10
WP_041025744.1|4222427_4222910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041025745.1|4222906_4224742_+	DNA cytosine methyltransferase	NA	A0A1I9KFW0	Aeromonas_phage	38.2	5.0e-96
WP_014603914.1|4224738_4226109_+	hypothetical protein	NA	H2BD37	Pseudomonas_phage	56.5	1.8e-66
WP_003160559.1|4226399_4226684_+	pyocin activator PrtN family protein	NA	A0A2K8HN48	Pseudomonas_phage	100.0	8.0e-46
WP_031689695.1|4226693_4227800_-|integrase	tyrosine-type recombinase/integrase	integrase	L7TP61	Pseudomonas_virus	98.6	9.6e-212
WP_031635261.1|4227903_4228908_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_003090868.1|4228987_4229911_+	transaldolase	NA	A0A1D8KMI9	Synechococcus_phage	30.0	6.5e-12
WP_003090869.1|4229996_4230479_-	STAS domain-containing protein	NA	NA	NA	NA	NA
4230079:4230096	attR	TCCAGGACCTTGTCGCGC	NA	NA	NA	NA
WP_003090870.1|4230475_4231660_-	SpoIIE family protein phosphatase	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	7.3e-08
>prophage 7
NC_017549	Pseudomonas aeruginosa NCGM2.S1 chromosome 1, complete sequence	6764661	5115844	5124873	6764661		Bacillus_phage(33.33%)	8	NA	NA
WP_003092260.1|5115844_5116885_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
WP_003092262.1|5117018_5117525_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092265.1|5117672_5118680_+	TolB family protein	NA	NA	NA	NA	NA
WP_003122151.1|5118805_5121373_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	2.4e-24
WP_003092272.1|5121439_5121763_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113871.1|5122189_5123194_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092335.1|5123298_5124192_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_073660134.1|5124237_5124873_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.3e-40
>prophage 8
NC_017549	Pseudomonas aeruginosa NCGM2.S1 chromosome 1, complete sequence	6764661	5268678	5306745	6764661	integrase,head,protease,transposase	Pseudomonas_phage(94.0%)	51	5273977:5273993	5277564:5277580
WP_003127781.1|5268678_5269047_-	hypothetical protein	NA	J9SGX4	Pseudomonas_phage	100.0	1.1e-63
WP_003117363.1|5269043_5269592_-	hypothetical protein	NA	J9RWB3	Pseudomonas_phage	100.0	2.1e-98
WP_014603985.1|5269591_5270158_-	regulatory protein GemA	NA	J9SVT5	Pseudomonas_phage	100.0	5.4e-102
WP_003129239.1|5270144_5270612_-	hypothetical protein	NA	J9SH82	Pseudomonas_phage	100.0	6.3e-56
WP_003117360.1|5270613_5270832_-	hypothetical protein	NA	J9STW0	Pseudomonas_phage	100.0	1.1e-31
WP_014603987.1|5270833_5271229_-	hypothetical protein	NA	J9SNQ5	Pseudomonas_phage	100.0	4.2e-69
WP_014603988.1|5271230_5271854_-	DUF3164 family protein	NA	J9STG3	Pseudomonas_phage	99.5	5.9e-110
WP_014603989.1|5271846_5272047_-	hypothetical protein	NA	J9SVU3	Pseudomonas_phage	98.5	2.3e-31
WP_023123655.1|5272039_5272573_-	hypothetical protein	NA	J9STN6	Pseudomonas_phage	99.4	2.5e-93
WP_041025751.1|5272562_5273243_-	hypothetical protein	NA	J9SNC1	Pseudomonas_phage	98.7	5.8e-127
WP_014603990.1|5273242_5273527_-	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	100.0	3.4e-44
WP_014603991.1|5273523_5273865_-	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	98.2	1.3e-55
WP_014603992.1|5273866_5275033_-	AAA family ATPase	NA	J9SVV1	Pseudomonas_phage	98.7	4.9e-214
5273977:5273993	attL	GCTTGTTTTCCTTGACG	NA	NA	NA	NA
WP_014603993.1|5275032_5276817_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9STP5	Pseudomonas_phage	98.8	0.0e+00
WP_014603994.1|5276820_5277795_-	hypothetical protein	NA	J9RW58	Pseudomonas_phage	97.5	4.0e-153
5277564:5277580	attR	GCTTGTTTTCCTTGACG	NA	NA	NA	NA
WP_003142307.1|5277804_5278119_-	hypothetical protein	NA	J9SUN0	Pseudomonas_phage	98.1	2.9e-49
WP_003142306.1|5278115_5278376_-	hypothetical protein	NA	J9RWD0	Pseudomonas_phage	95.3	1.5e-38
WP_010791820.1|5278368_5278857_-	hypothetical protein	NA	J9SNL8	Pseudomonas_phage	99.4	2.8e-91
WP_015649394.1|5278980_5279205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003142304.1|5279489_5279720_-	DNA-binding protein	NA	J9RW65	Pseudomonas_phage	100.0	2.5e-37
WP_157783244.1|5279904_5280165_+	hypothetical protein	NA	J9SH16	Pseudomonas_phage	82.6	1.8e-12
WP_003094225.1|5280875_5281133_+	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
WP_014603995.1|5281135_5281294_+	hypothetical protein	NA	J9SNF4	Pseudomonas_phage	98.1	1.7e-21
WP_014603996.1|5281290_5281920_+	transglycosylase SLT domain-containing protein	NA	J9SH25	Pseudomonas_phage	99.0	8.4e-120
WP_041025752.1|5282121_5282745_+	hypothetical protein	NA	J9SVX5	Pseudomonas_phage	98.1	2.9e-109
WP_003117315.1|5282744_5283065_+	DUF2730 family protein	NA	J9STR5	Pseudomonas_phage	100.0	5.1e-49
WP_003121465.1|5283061_5283364_+	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	99.0	4.1e-48
WP_003117313.1|5283366_5283915_+	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	99.5	7.6e-77
WP_014603997.1|5283916_5285590_+	hypothetical protein	NA	J9RWF2	Pseudomonas_phage	99.3	0.0e+00
WP_010791816.1|5285583_5287158_+	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	96.4	2.0e-287
WP_014603998.1|5287147_5288386_+	hypothetical protein	NA	J9STS2	Pseudomonas_phage	99.8	3.4e-242
WP_015649417.1|5288387_5288963_+	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	99.0	1.7e-103
WP_014603999.1|5289173_5290283_+|protease	phage protease	protease	J9SH47	Pseudomonas_phage	98.6	8.4e-200
WP_003121593.1|5290288_5290693_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	100.0	1.8e-67
WP_014604000.1|5290707_5291604_+|head	Mu-like prophage major head subunit gpT family protein	head	J9SVY7	Pseudomonas_phage	99.7	3.0e-171
WP_015649419.1|5291616_5292051_+	hypothetical protein	NA	J9STT1	Pseudomonas_phage	99.0	1.1e-49
WP_003121492.1|5292053_5292569_+	DUF1320 domain-containing protein	NA	J9SNI4	Pseudomonas_phage	100.0	3.5e-92
WP_003127511.1|5292565_5293018_+	hypothetical protein	NA	J9SH57	Pseudomonas_phage	100.0	5.5e-81
WP_003127509.1|5293014_5293218_+	hypothetical protein	NA	J9RWG5	Pseudomonas_phage	100.0	1.7e-29
WP_010791812.1|5293224_5293965_+	hypothetical protein	NA	J9SVZ4	Pseudomonas_phage	100.0	1.2e-136
WP_023086241.1|5293967_5294450_+	hypothetical protein	NA	J9STT8	Pseudomonas_phage	100.0	1.3e-83
WP_049967619.1|5294404_5294587_-	hypothetical protein	NA	J9SNJ6	Pseudomonas_phage	100.0	1.2e-26
WP_014604003.1|5294703_5298336_+	tape measure protein	NA	J9SH65	Pseudomonas_phage	95.7	0.0e+00
WP_014604004.1|5298335_5299292_+	hypothetical protein	NA	A0A0A7DK02	Pseudomonas_phage	95.9	1.5e-184
WP_014604005.1|5299293_5300217_+	hypothetical protein	NA	B7SE07	Pseudomonas_virus	93.8	5.4e-176
WP_041025753.1|5300216_5301923_+	hypothetical protein	NA	A0A0S4L0R5	Pseudomonas_phage	96.7	0.0e+00
WP_010791806.1|5301909_5302728_+	phage BR0599 family protein	NA	J9SP65	Pseudomonas_phage	100.0	4.5e-166
WP_003094285.1|5302737_5302968_+	hypothetical protein	NA	Q5ZQW1	Pseudomonas_phage	100.0	1.2e-36
WP_014604008.1|5303181_5305392_+	hypothetical protein	NA	Q5ZQV9	Pseudomonas_phage	97.8	0.0e+00
WP_014604009.1|5306233_5306536_+	hypothetical protein	NA	A0SMR0	Pseudomonas_virus	92.0	1.6e-47
WP_014604010.1|5306532_5306745_+	hypothetical protein	NA	A0SMR1	Pseudomonas_virus	92.8	7.3e-28
>prophage 9
NC_017549	Pseudomonas aeruginosa NCGM2.S1 chromosome 1, complete sequence	6764661	5761861	5830338	6764661	capsid,protease,transposase,terminase,head	Pseudomonas_phage(74.51%)	78	NA	NA
WP_003093554.1|5761861_5762425_+|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	31.5	2.6e-11
WP_003093556.1|5762447_5763248_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_003093558.1|5763279_5763678_-	RidA family protein	NA	NA	NA	NA	NA
WP_003093559.1|5763818_5764742_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003110541.1|5765274_5766663_+|protease	protease IV	protease	NA	NA	NA	NA
WP_003093561.1|5766982_5767264_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003093563.1|5767406_5767808_+	GFA family protein	NA	NA	NA	NA	NA
WP_003093564.1|5767907_5768651_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003093566.1|5768888_5770184_+	OprD family porin	NA	NA	NA	NA	NA
WP_003093568.1|5770226_5771870_-	acetolactate synthase large subunit	NA	NA	NA	NA	NA
WP_003093570.1|5772154_5772874_+	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_003093573.1|5772901_5773540_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_003118992.1|5773543_5774011_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003093577.1|5774036_5775059_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003093580.1|5775365_5776094_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003093583.1|5776187_5777507_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003093585.1|5777643_5778972_+	MFS transporter	NA	NA	NA	NA	NA
WP_003093588.1|5779036_5779948_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014604043.1|5779940_5781431_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003093592.1|5781598_5782804_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_003129339.1|5782808_5783453_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014604044.1|5783455_5785732_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003093598.1|5785977_5787600_+	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	3.0e-36
WP_003093599.1|5787717_5789499_+	acyl-CoA dehydrogenase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003093600.1|5789706_5790573_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003093601.1|5790612_5791653_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003093602.1|5791748_5792804_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003093603.1|5792911_5793766_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003093604.1|5793845_5795012_+	lactonase family protein	NA	NA	NA	NA	NA
WP_010791890.1|5795400_5795625_-	hypothetical protein	NA	A0A0A1IX79	Pseudomonas_phage	100.0	2.5e-34
WP_014604045.1|5795703_5795922_-	hypothetical protein	NA	A0A0S4L0C9	Pseudomonas_phage	88.7	1.1e-26
WP_014604009.1|5795918_5796221_-	hypothetical protein	NA	A0SMR0	Pseudomonas_virus	92.0	1.6e-47
WP_014604046.1|5797062_5799270_-	hypothetical protein	NA	I6PCB1	Pseudomonas_phage	98.5	0.0e+00
WP_004367213.1|5799259_5799478_-	hypothetical protein	NA	I6P9E8	Pseudomonas_phage	100.0	3.4e-36
WP_003126844.1|5799474_5799714_-	hypothetical protein	NA	I6P9F0	Pseudomonas_phage	98.7	4.4e-37
WP_023127434.1|5799722_5800544_-	phage BR0599 family protein	NA	I6PBD5	Pseudomonas_phage	99.2	2.7e-155
WP_023127435.1|5800533_5802237_-	hypothetical protein	NA	Q6TM53	Pseudomonas_phage	95.9	0.0e+00
WP_014604049.1|5802236_5803160_-	hypothetical protein	NA	B7SE07	Pseudomonas_virus	97.1	7.1e-184
WP_014604050.1|5803161_5804118_-	hypothetical protein	NA	A0SMQ2	Pseudomonas_virus	97.2	7.8e-186
WP_014604051.1|5804124_5807829_-	tape measure protein	NA	B7SE05	Pseudomonas_virus	96.8	0.0e+00
WP_014604052.1|5807955_5808453_-	hypothetical protein	NA	A0A1C6ZDR0	Pseudomonas_phage	100.0	1.6e-78
WP_014604053.1|5808456_5809230_-	hypothetical protein	NA	A0A1C6ZDP0	Pseudomonas_phage	93.4	9.0e-132
WP_014604054.1|5809255_5809441_-	hypothetical protein	NA	A0A1C6ZDM1	Pseudomonas_phage	100.0	3.0e-25
WP_014604055.1|5809428_5809902_-	hypothetical protein	NA	A0A0A1IUZ7	Pseudomonas_phage	99.4	8.6e-85
WP_010791902.1|5809898_5810315_-	DUF1320 domain-containing protein	NA	A0A0A1IX76	Pseudomonas_phage	100.0	3.9e-73
WP_003094562.1|5810311_5810479_-	hypothetical protein	NA	L7P7P7	Pseudomonas_phage	100.0	3.1e-21
WP_014604056.1|5810478_5810919_-	hypothetical protein	NA	A0A125RNI2	Pseudomonas_phage	99.3	9.5e-46
WP_003099452.1|5810986_5811901_-|head	Mu-like prophage major head subunit gpT family protein	head	I6PBD3	Pseudomonas_phage	100.0	9.2e-176
WP_014604057.1|5811904_5813002_-|protease	phage protease	protease	A0A125RNI0	Pseudomonas_phage	99.2	1.6e-198
WP_014604058.1|5813204_5813672_-	phage virion morphogenesis protein	NA	B7SDZ4	Pseudomonas_virus	98.1	8.2e-80
WP_014604059.1|5813671_5814946_-|capsid	minor capsid protein	capsid	B7SDZ3	Pseudomonas_virus	98.6	3.9e-241
WP_014604060.1|5814945_5816526_-	DUF935 domain-containing protein	NA	A0A0A1IVG5	Pseudomonas_phage	99.8	6.4e-302
WP_014604061.1|5816535_5818188_-|terminase	phage terminase large subunit	terminase	B7SDZ1	Pseudomonas_virus	99.6	0.0e+00
WP_031759181.1|5818186_5818714_+	hypothetical protein	NA	I6PCA7	Pseudomonas_phage	99.4	2.6e-98
WP_012613783.1|5818719_5819220_-	DUF1804 family protein	NA	A0A1C6ZDN3	Pseudomonas_phage	100.0	2.9e-83
WP_003094538.1|5819228_5819417_-	hypothetical protein	NA	A0A0A1IVG3	Pseudomonas_phage	100.0	1.0e-25
WP_014604063.1|5819527_5819929_-	hypothetical protein	NA	H6V8N0	Pseudomonas_phage	97.7	8.3e-65
WP_014604064.1|5819925_5820168_-	hypothetical protein	NA	A0A0A1IUY9	Pseudomonas_phage	95.0	2.2e-36
WP_014604065.1|5820167_5820584_-	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	98.6	3.9e-73
WP_015649662.1|5820583_5821054_-	hypothetical protein	NA	A7Y8L4	Pseudomonas_virus	100.0	1.8e-82
WP_023127440.1|5820998_5821346_-	hypothetical protein	NA	A0A0A7DJC3	Pseudomonas_phage	100.0	2.5e-57
WP_023127441.1|5821448_5821898_-	hypothetical protein	NA	A0A076FR28	Pseudomonas_phage	99.3	1.8e-79
WP_014604067.1|5821890_5822292_-	regulatory protein GemA	NA	A0A0A1IUY7	Pseudomonas_phage	99.2	3.3e-69
WP_023102203.1|5822288_5822510_-	hypothetical protein	NA	A0A125RNA7	Pseudomonas_phage	100.0	3.9e-40
WP_014604068.1|5822596_5822866_-	hypothetical protein	NA	A0A076FSV2	Pseudomonas_phage	96.6	9.3e-44
WP_014604069.1|5822874_5823324_-	hypothetical protein	NA	A0A125RNA5	Pseudomonas_phage	95.3	3.2e-73
WP_014604070.1|5823323_5823515_-	hypothetical protein	NA	A0A125RNA4	Pseudomonas_phage	98.4	1.9e-27
WP_014604071.1|5823516_5823798_-	hypothetical protein	NA	A0A0U5KRI9	unidentified_phage	98.9	2.3e-45
WP_023127442.1|5823800_5824109_-	hypothetical protein	NA	A0A1C6ZDJ5	Pseudomonas_phage	100.0	1.1e-48
WP_003094490.1|5824110_5824392_-	hypothetical protein	NA	L7P7W6	Pseudomonas_phage	100.0	9.3e-47
WP_014604072.1|5824393_5824597_-	hypothetical protein	NA	I6PBV7	Pseudomonas_phage	94.0	1.0e-26
WP_014604073.1|5824596_5825115_-	host-nuclease inhibitor Gam family protein	NA	L7P7S4	Pseudomonas_phage	99.4	1.1e-90
WP_014604074.1|5825131_5825443_-	hypothetical protein	NA	H6V800	Pseudomonas_virus	100.0	3.1e-51
WP_014604075.1|5825405_5825819_-	hypothetical protein	NA	A0A0A1IWY8	Pseudomonas_phage	99.3	4.7e-71
WP_023127444.1|5825955_5826531_-	hypothetical protein	NA	B7SDX2	Pseudomonas_virus	97.9	3.4e-104
WP_014604077.1|5826602_5827268_-	hypothetical protein	NA	A0A0A1IVF7	Pseudomonas_phage	98.2	2.5e-122
WP_014604078.1|5827264_5828017_-	ATP-binding protein	NA	I6PCA3	Pseudomonas_phage	76.9	1.7e-95
WP_014604079.1|5828037_5830338_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	I6P9C2	Pseudomonas_phage	35.6	1.9e-97
>prophage 10
NC_017549	Pseudomonas aeruginosa NCGM2.S1 chromosome 1, complete sequence	6764661	5920486	6005670	6764661	holin,integrase,plate,tail,tRNA	Pseudomonas_phage(20.59%)	87	5995697:5995713	6009962:6009978
WP_003085275.1|5920486_5921686_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003129241.1|5921970_5923314_+	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	44.1	3.0e-18
WP_003085271.1|5923316_5924408_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_003085254.1|5924461_5924812_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
WP_073660265.1|5924889_5925312_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003085249.1|5925312_5926032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085247.1|5926031_5927066_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003085245.1|5927356_5927779_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_003085244.1|5927795_5928764_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003085240.1|5928885_5929968_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003085237.1|5930028_5930829_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003085227.1|5930868_5932350_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.8	6.7e-67
WP_003085225.1|5932428_5932767_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003085224.1|5932866_5933514_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003085223.1|5933568_5934363_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_003085219.1|5934682_5935105_-	OsmC family protein	NA	NA	NA	NA	NA
WP_003085214.1|5935376_5936021_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_003085205.1|5936082_5936919_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
WP_003085203.1|5936915_5937965_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085194.1|5937966_5938572_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
WP_003118919.1|5938919_5939177_-	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003085190.1|5939173_5939536_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	48.7	6.5e-16
WP_003085188.1|5939532_5940162_-	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	3.2e-87
WP_003085186.1|5940194_5941184_-	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	3.7e-106
WP_003101635.1|5941241_5941448_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003085182.1|5941422_5942295_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_023098436.1|5942304_5944542_-|tail	phage tail length determinator protein	tail	NA	NA	NA	NA
WP_003085178.1|5944711_5945056_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003085175.1|5945070_5945574_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085173.1|5945586_5946747_-|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
WP_003085172.1|5946789_5947230_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_003085168.1|5947238_5949347_-|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	51.1	2.6e-218
WP_003137385.1|5949348_5949882_-|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_003085151.1|5949874_5950762_-	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003085143.1|5950758_5951085_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085141.1|5951237_5951795_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003085139.1|5951791_5952307_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.9	4.1e-32
WP_003137382.1|5952328_5952778_-|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003085135.1|5953140_5953500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085132.1|5953547_5953748_-	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003085129.1|5954205_5954976_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.0	6.1e-72
WP_003085128.1|5955075_5955390_+	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_003085126.1|5955576_5957055_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003085124.1|5957127_5957946_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085122.1|5957945_5958620_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003085119.1|5958743_5959574_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014604087.1|5959679_5960927_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085111.1|5961041_5962088_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|5962143_5963253_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003085106.1|5963486_5964521_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085103.1|5964649_5965282_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023098434.1|5965327_5967721_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085099.1|5967872_5968934_+	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_003085097.1|5968934_5969693_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003085095.1|5969694_5970369_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003085094.1|5970365_5971382_-	phosphotransferase	NA	NA	NA	NA	NA
WP_003085092.1|5971508_5974310_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003109024.1|5974290_5975583_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003085089.1|5975579_5976566_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003085087.1|5976681_5977488_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003085085.1|5977524_5977905_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003085083.1|5977904_5978756_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2R4ALP3	Aeromonas_phage	44.2	2.4e-08
WP_003085081.1|5978799_5979132_+	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003085078.1|5979410_5981333_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003085075.1|5981433_5982705_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085073.1|5982701_5984255_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_003085071.1|5984349_5984856_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003085069.1|5984899_5986132_+	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	1.6e-77
WP_003085067.1|5986104_5986647_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099587.1|5986637_5986991_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003085061.1|5987074_5987644_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003085059.1|5987722_5988748_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085057.1|5988948_5989164_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003085042.1|5989233_5989683_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	5.0e-18
WP_003085039.1|5989765_5991760_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.7	3.8e-73
WP_003085035.1|5991839_5993693_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	1.2e-36
WP_003085029.1|5993799_5997537_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	35.4	4.8e-13
5995697:5995713	attL	CCCAGGGCTTCACCGCC	NA	NA	NA	NA
WP_023103853.1|5997993_5998671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023103852.1|5999181_5999403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085024.1|5999407_5999590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023103851.1|5999591_5999789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085020.1|5999785_6000247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085018.1|6000284_6000992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023103850.1|6001166_6001472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085013.1|6001690_6003751_-	AAA family ATPase	NA	A0A2H4GYD5	Pseudomonas_phage	46.2	1.3e-57
WP_003085011.1|6003904_6004129_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003085009.1|6004350_6005670_-|integrase	integrase family protein	integrase	A0A291LA13	Bordetella_phage	22.5	8.7e-10
6009962:6009978	attR	CCCAGGGCTTCACCGCC	NA	NA	NA	NA
