The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_011993	Escherichia coli LF82, complete genome	4773108	871916	882276	4773108	protease	Vibrio_phage(33.33%)	6	NA	NA
WP_000188129.1|871916_873863_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|873935_874160_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|874482_874803_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|874833_877110_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|878062_879046_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101563.1|879042_882276_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.1	2.2e-83
>prophage 2
NC_011993	Escherichia coli LF82, complete genome	4773108	987572	1036707	4773108	integrase,terminase,protease,head,lysis,holin,portal	Enterobacteria_phage(43.1%)	72	992367:992383	1044168:1044184
WP_000003644.1|987572_988160_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063964.1|988156_988555_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004917.1|988551_989409_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263563.1|989542_991087_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460796.1|991098_992235_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|992247_992340_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
992367:992383	attL	AGCGTCGCATCAGGCAA	NA	NA	NA	NA
WP_001528879.1|992419_993730_+	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000087763.1|993717_993930_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|994215_994428_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|994438_994627_+	cold-shock protein	NA	NA	NA	NA	NA
WP_012896763.1|994601_994832_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|994821_994995_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818456.1|995043_996117_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054735.1|996199_998932_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	7.0e-38
WP_000533675.1|999026_1000100_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	95.5	3.3e-193
WP_014640122.1|1000077_1000296_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	1.4e-34
WP_001281200.1|1000401_1000746_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_000545737.1|1000773_1000941_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_000286784.1|1001095_1001374_-	DUF4752 family protein	NA	K7PHN1	Enterobacterial_phage	98.9	2.1e-46
WP_000210405.1|1001373_1002177_-	DUF551 domain-containing protein	NA	Q9G078	Enterobacteria_phage	95.0	3.5e-46
WP_000036159.1|1002178_1002730_-	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	92.7	5.5e-59
WP_000812187.1|1002726_1003242_-	hypothetical protein	NA	A0A220NRQ7	Escherichia_phage	51.1	2.3e-35
WP_001214456.1|1003238_1003403_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_000753555.1|1003419_1003734_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_000041322.1|1003745_1004228_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	99.4	8.4e-80
WP_000065836.1|1004211_1005123_-	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	99.3	8.3e-169
WP_000604110.1|1005119_1005428_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
WP_001183771.1|1005512_1005683_-	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000392423.1|1005922_1006372_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	89.3	8.7e-71
WP_000394299.1|1006430_1006682_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_015912482.1|1006690_1006990_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	98.0	5.0e-30
WP_000856966.1|1007392_1008043_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	99.5	2.4e-122
WP_000276886.1|1008123_1008309_+	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000251073.1|1008417_1008711_+	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_001244624.1|1008733_1009006_+	hypothetical protein	NA	G9L679	Escherichia_phage	98.9	1.4e-42
WP_000431327.1|1009068_1009956_+	replication protein	NA	A5VW95	Enterobacteria_phage	98.6	1.7e-142
WP_001248390.1|1009952_1011329_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.3	1.4e-252
WP_000344549.1|1011622_1011931_+	hypothetical protein	NA	Q716C8	Shigella_phage	97.1	1.4e-51
WP_000814609.1|1012130_1012541_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	4.7e-71
WP_001254220.1|1012537_1012714_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_000924602.1|1012716_1013118_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	97.0	3.0e-70
WP_021514114.1|1013077_1013287_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.0e-30
WP_001003987.1|1013279_1014002_+	phage antirepressor KilAC domain-containing protein	NA	K7P7L0	Enterobacteria_phage	99.2	1.6e-130
WP_000002227.1|1014001_1014292_+	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	95.8	7.9e-49
WP_001008199.1|1014288_1014651_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994513.1|1014647_1014836_+	protein ninH	NA	K7PH29	Enterobacteria_phage	98.4	1.9e-27
WP_001235461.1|1014832_1015456_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|1015889_1016213_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229407.1|1016196_1016673_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	8.3e-88
WP_015912484.1|1016669_1017107_+|lysis	lysis protein	lysis	I6RSJ6	Salmonella_phage	97.9	8.5e-71
WP_001139682.1|1017094_1017247_+	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_001016386.1|1017449_1017968_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	3.2e-93
WP_137472494.1|1018239_1018425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807785.1|1018564_1018807_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_000091988.1|1018808_1018988_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	98.3	1.1e-24
WP_000190002.1|1019011_1019434_+	hypothetical protein	NA	Q716H4	Shigella_phage	99.3	3.6e-74
WP_000200771.1|1019430_1020843_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	7.5e-278
WP_000852338.1|1020845_1022972_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.4	0.0e+00
WP_000426737.1|1022985_1023870_+	hypothetical protein	NA	Q9AYZ8	Salmonella_phage	100.0	2.1e-145
WP_001133474.1|1023881_1025153_+|head	head protein	head	Q9AYZ7	Salmonella_phage	99.1	1.1e-238
WP_000375639.1|1025195_1025381_+	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_000246748.1|1025355_1025838_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	99.4	8.4e-88
WP_001122387.1|1025846_1027265_+	packaged DNA stabilization protein gp10	NA	A0A2D1GM00	Escherichia_phage	100.0	1.7e-277
WP_000785557.1|1027264_1028218_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	85.2	1.4e-94
WP_000614040.1|1028217_1028673_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	1.5e-86
WP_000964882.1|1028675_1029368_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000246921.1|1029377_1030766_+	phage DNA ejection protein	NA	A0A220NR03	Salmonella_phage	64.9	4.1e-151
WP_001029835.1|1030765_1032763_+	hypothetical protein	NA	Q716G2	Shigella_phage	96.4	0.0e+00
WP_000749287.1|1032853_1033339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000821222.1|1033473_1033893_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	97.8	1.5e-72
WP_000532176.1|1033909_1034161_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	91.6	6.6e-36
WP_000129916.1|1034307_1036707_+|head	phage head-binding domain-containing protein	head	A5VW57	Enterobacteria_phage	89.9	3.9e-77
1044168:1044184	attR	AGCGTCGCATCAGGCAA	NA	NA	NA	NA
>prophage 3
NC_011993	Escherichia coli LF82, complete genome	4773108	1169339	1217261	4773108	integrase,terminase,head,tRNA,capsid,lysis,tail,portal	Enterobacteria_phage(57.14%)	66	1163520:1163534	1185843:1185857
1163520:1163534	attL	CGCCCAGCAGGCGAT	NA	NA	NA	NA
WP_001441929.1|1169339_1170446_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1170499_1170961_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248662.1|1170970_1171624_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1171795_1173046_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1173159_1174302_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1174291_1174528_-	excisionase	NA	NA	NA	NA	NA
WP_000488403.1|1174667_1174907_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	93.7	6.7e-38
WP_000763364.1|1174954_1175173_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_001308571.1|1175271_1175553_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_000548537.1|1175563_1175755_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149539.1|1175727_1175910_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	6.3e-28
WP_000186858.1|1175906_1176587_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	4.6e-132
WP_000100847.1|1176583_1177369_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995417.1|1177374_1177671_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	96.9	1.5e-47
WP_000233576.1|1177746_1177953_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000841195.1|1178431_1178938_-	hypothetical protein	NA	U5P455	Shigella_phage	34.0	4.1e-08
WP_000654526.1|1178959_1179982_-	hypothetical protein	NA	U5P4L0	Shigella_phage	52.3	3.3e-97
WP_000712396.1|1180104_1180797_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_000184665.1|1180907_1181135_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182881.1|1181165_1181705_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000147914.1|1181701_1182721_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	2.7e-112
WP_000788877.1|1182717_1183419_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000145918.1|1183415_1183718_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	93.5	1.3e-41
WP_001070442.1|1183785_1184118_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_014640128.1|1184166_1184316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709098.1|1184373_1185900_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	30.8	2.7e-31
1185843:1185857	attR	CGCCCAGCAGGCGAT	NA	NA	NA	NA
WP_000700204.1|1186249_1187293_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072093903.1|1187642_1187744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053004.1|1187740_1188196_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_000224907.1|1188195_1188366_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774475.1|1188358_1188649_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_001099697.1|1188645_1189008_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971095.1|1189004_1189145_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001204794.1|1189230_1189614_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000737271.1|1189802_1190885_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1191474_1191690_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000193273.1|1191694_1192009_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_001168526.1|1192005_1192245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101164.1|1192379_1192913_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	5.8e-98
WP_001228695.1|1193129_1193312_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1193402_1193696_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1194176_1194503_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1194709_1194892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453580.1|1195455_1196001_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027282.1|1195975_1197901_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|1197897_1198104_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001337540.1|1198100_1199702_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
WP_000123325.1|1199682_1201014_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	96.8	3.0e-228
WP_000201478.1|1201023_1201356_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_000118193.1|1201411_1202437_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
WP_000158881.1|1202478_1202874_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.6e-55
WP_000752960.1|1202885_1203239_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000985127.1|1203250_1203829_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	8.6e-79
WP_000683157.1|1203825_1204221_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	1.2e-68
WP_001524522.1|1204228_1204969_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	1.1e-131
WP_000479173.1|1204984_1205407_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	2.2e-68
WP_000459452.1|1205388_1205823_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_000840357.1|1205815_1208377_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.0	0.0e+00
WP_000847379.1|1208373_1208703_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152626.1|1208702_1209401_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_001337536.1|1209405_1210149_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_000090899.1|1210085_1210718_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	95.7	4.2e-95
WP_000515311.1|1210778_1214192_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_001230375.1|1214261_1214861_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_001350275.1|1214925_1216986_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	5.7e-125
WP_000654168.1|1216982_1217261_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
>prophage 4
NC_011993	Escherichia coli LF82, complete genome	4773108	1581091	1638025	4773108	integrase,terminase,protease,lysis,tail,portal	Enterobacteria_phage(47.06%)	69	1586796:1586811	1632027:1632042
WP_000526701.1|1581091_1582552_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	3.9e-43
WP_000347479.1|1582640_1583924_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1584527_1584641_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1584709_1584943_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|1585259_1585850_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000355601.1|1586077_1586371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001353819.1|1586413_1587454_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.3	1.4e-124
1586796:1586811	attL	GCATGACATGCACCAT	NA	NA	NA	NA
WP_000654143.1|1587463_1587745_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_000290533.1|1587744_1590117_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_000515688.1|1590177_1593591_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_015912502.1|1593651_1594299_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	2.5e-111
WP_015912503.1|1594196_1594940_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	9.2e-150
WP_001152401.1|1594944_1595643_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	6.6e-134
WP_000447253.1|1595652_1595982_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000372041.1|1595981_1599047_-|tail	phage tail tape measure protein	tail	K7PKI9	Enterobacteria_phage	98.3	0.0e+00
WP_001161009.1|1599018_1599348_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001298500.1|1599356_1599743_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_000211128.1|1599803_1600547_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001079410.1|1600557_1600959_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
WP_000677120.1|1600955_1601546_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
WP_001283153.1|1601557_1601833_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097045.1|1601825_1602149_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001360054.1|1602235_1604263_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_072134767.1|1604207_1605788_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.1e-289
WP_001072975.1|1605715_1605928_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507031.1|1605924_1608024_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.6	0.0e+00
WP_000421825.1|1608032_1608572_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001031431.1|1609132_1609339_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035577.1|1609639_1610050_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019606.1|1610201_1610375_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1610546_1610702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|1610781_1610847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1610849_1611038_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1611048_1611261_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1611624_1612122_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1612118_1612652_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|1612648_1612960_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1612964_1613180_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066485.1|1613933_1614149_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_001047127.1|1614824_1615577_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
WP_001265193.1|1615590_1616640_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	1.3e-112
WP_015912508.1|1616641_1616920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000062344.1|1617026_1618172_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	30.1	2.8e-41
WP_001180546.1|1618168_1618783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1618949_1619105_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001557860.1|1619206_1619314_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000492056.1|1619906_1621241_+	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	33.0	1.0e-05
WP_001151215.1|1621478_1621901_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	2.2e-63
WP_001262356.1|1621941_1623012_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.4e-63
WP_000693850.1|1623083_1623509_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|1623505_1623760_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|1623839_1624259_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_042093010.1|1624556_1624712_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.5e-06
WP_001171942.1|1624871_1625090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001362604.1|1625093_1625258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1625657_1625846_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|1625842_1626034_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048352.1|1626127_1628599_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|1628671_1628923_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876981.1|1628957_1630238_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_077630870.1|1630239_1630368_-	transporter	NA	NA	NA	NA	NA
WP_000836084.1|1630425_1631445_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
WP_001298659.1|1631456_1632671_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
1632027:1632042	attR	ATGGTGCATGTCATGC	NA	NA	NA	NA
WP_000598292.1|1632876_1633203_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705201.1|1633337_1633679_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|1633713_1634274_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001350228.1|1634276_1634987_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778146.1|1635094_1635400_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041662.1|1635598_1638025_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.0e-213
>prophage 5
NC_011993	Escherichia coli LF82, complete genome	4773108	2227063	2236508	4773108		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292758.1|2227063_2228200_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	2.5e-162
WP_014640174.1|2228196_2230200_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|2230324_2230786_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2230826_2231297_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2231343_2232063_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2232059_2233745_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240405.1|2233966_2234698_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_001216963.1|2234757_2234865_+	protein YohO	NA	NA	NA	NA	NA
WP_000783125.1|2234845_2235577_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569385.1|2235581_2236508_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 6
NC_011993	Escherichia coli LF82, complete genome	4773108	2689718	2769189	4773108	integrase,terminase,head,tRNA,capsid,lysis,tail,portal,plate	Salmonella_phage(72.55%)	86	2735941:2735986	2769309:2769354
WP_001350302.1|2689718_2690456_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2690587_2691922_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001298616.1|2691954_2692836_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|2692938_2693526_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2693581_2693965_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|2694269_2694959_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997383.1|2695006_2696044_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2696250_2696670_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_014640192.1|2696738_2697437_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082990.1|2697468_2700129_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2700242_2701598_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|2701643_2701967_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001350300.1|2701963_2703262_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_001317994.1|2711743_2714317_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	1.5e-127
WP_000040160.1|2714446_2715178_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079108.1|2715174_2716155_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197693.1|2716289_2717027_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2717297_2717639_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2717742_2717790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200124.1|2717888_2719049_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225209.1|2719091_2720213_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|2720223_2721294_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001298694.1|2721503_2721869_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|2722015_2722534_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969007.1|2722523_2723750_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|2723765_2724248_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2724324_2724672_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2724713_2725481_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2725511_2726060_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2726078_2726327_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2726463_2727825_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001314062.1|2727991_2728783_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2728803_2730090_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2730144_2730738_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2730860_2731739_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880939.1|2731824_2733486_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2733634_2733976_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2734037_2734328_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2734317_2734794_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2734925_2735408_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
2735941:2735986	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_000391796.1|2736108_2736591_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	4.6e-17
WP_000980502.1|2736617_2736836_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	76.4	2.2e-27
WP_001011792.1|2736904_2738005_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	7.6e-177
WP_000980400.1|2738001_2738487_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_001282809.1|2738483_2741561_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.6	0.0e+00
WP_000763311.1|2741553_2741673_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|2741687_2741990_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|2742044_2742560_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046133.1|2742569_2743742_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.3e-203
WP_000905033.1|2743884_2744451_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_001145385.1|2744481_2744886_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	42.3	4.7e-15
WP_000639074.1|2744894_2745290_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_000782984.1|2745261_2745681_-|tail	tail assembly chaperone	tail	M1SNQ2	Escherichia_phage	64.7	3.8e-36
WP_000104761.1|2745677_2747099_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.7	1.2e-153
WP_001086836.1|2747095_2747701_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000268285.1|2747693_2748602_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_000177580.1|2748588_2748948_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_000993777.1|2748944_2749523_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	4.7e-93
WP_006656620.1|2749786_2750149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829123.1|2750154_2750607_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.5	9.4e-57
WP_001039945.1|2750599_2751031_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_000196196.1|2751126_2751555_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	89.4	1.8e-57
WP_001069910.1|2751551_2752067_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.4	2.1e-89
WP_000171568.1|2752047_2752263_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|2752266_2752470_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673520.1|2752469_2752934_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000059203.1|2753029_2753680_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.9	1.6e-110
WP_000742498.1|2753683_2754742_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216222.1|2754758_2755592_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	7.9e-118
WP_001098411.1|2755734_2757501_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000520352.1|2757500_2758535_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.2	2.8e-173
WP_000245245.1|2758543_2759242_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_000366628.1|2759531_2760143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000516592.1|2760191_2760452_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	62.2	5.8e-19
WP_001217566.1|2760525_2760759_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	92.2	3.7e-33
WP_001154434.1|2760769_2760958_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_000148428.1|2761110_2763525_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.1	0.0e+00
WP_000104179.1|2763521_2764379_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	7.3e-159
WP_000752613.1|2764375_2764603_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244219.1|2764602_2764836_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000956190.1|2765207_2765408_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000460848.1|2765415_2765925_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000102105.1|2765958_2766201_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932273.1|2766322_2766955_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000218402.1|2766957_2767974_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000360326.1|2768526_2769189_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
2769309:2769354	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
>prophage 7
NC_011993	Escherichia coli LF82, complete genome	4773108	2841019	2848159	4773108		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|2841019_2843581_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141292.1|2843686_2844343_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	2.5e-50
WP_001296319.1|2844393_2845161_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847999.1|2845356_2846265_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	3.3e-117
WP_000590417.1|2846261_2847524_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279001.1|2847520_2848159_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
