The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017294	Candidatus Arthromitus sp. SFB-mouse-Yit, complete genome	1586397	111269	153639	1586397	portal,terminase,plate,tail,capsid,integrase	Clostridium_phage(55.56%)	53	111154:111198	156444:156488
111154:111198	attL	GTTTTGTCAAACATATCATGTAGAAACTATTGTTAGATTTACTTT	NA	NA	NA	NA
WP_005807580.1|111269_112460_-|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	49.9	2.1e-100
WP_005807578.1|112694_113999_+	AAA family ATPase	NA	V9QJ85	Oenococcus_phage	32.2	9.4e-49
WP_005807576.1|113999_114587_+	hypothetical protein	NA	V9QKG0	Oenococcus_phage	32.7	6.8e-07
WP_005807574.1|115244_115496_-	peptidase S24	NA	A0A1J0MFC5	Staphylococcus_phage	39.0	4.2e-06
WP_005807572.1|115838_116573_+	DUF3644 domain-containing protein	NA	A0A220NQR4	Corynebacterium_phage	35.8	1.1e-17
WP_005807569.1|117315_117822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005807568.1|117858_118473_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	37.6	7.3e-28
WP_005807564.1|118647_118866_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005807562.1|118872_119088_-	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	44.1	3.8e-08
WP_005807560.1|119206_119407_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005807558.1|119461_119680_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005807556.1|119684_119864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807554.1|119949_120216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807552.1|120232_120532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807550.1|120531_121668_+	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	48.2	1.2e-97
WP_005807548.1|121683_122244_+	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	60.6	5.2e-57
WP_005807546.1|122243_124163_+	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	54.6	1.3e-192
WP_005807544.1|124178_126674_+	virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	44.7	5.5e-199
WP_005807543.1|126968_127277_+	VRR-NUC domain-containing protein	NA	A0A1W6JQA8	Corynebacterium_phage	40.4	2.8e-12
WP_005807541.1|127228_128569_+	DEAD/DEAH box helicase	NA	A0A1S7FYY5	Listeria_phage	53.8	4.1e-132
WP_007440107.1|128581_129007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807536.1|128993_129206_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007440106.1|129283_130000_+	SHOCT domain-containing protein	NA	X5JB37	Clostridium_phage	37.5	5.2e-33
WP_005807533.1|130163_130586_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	45.6	5.8e-24
WP_005807531.1|130582_131014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807529.1|131028_132276_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	57.7	3.4e-141
WP_007440341.1|132316_132796_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_007440342.1|132836_133091_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_005807523.1|133186_134575_+|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	42.5	1.4e-106
WP_005807521.1|134567_136151_+|capsid	minor capsid protein	capsid	A0A0A8WIE7	Clostridium_phage	51.9	6.6e-105
WP_005807519.1|136154_136361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007440347.1|136393_136735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807517.1|136820_137498_+	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	29.4	9.3e-08
WP_005807516.1|137694_138294_+	phage scaffolding protein	NA	A0A1Z1LZK8	Bacillus_phage	31.0	3.0e-10
WP_005807514.1|138302_139361_+	hypothetical protein	NA	A0A0A7RTH8	Clostridium_phage	51.5	1.7e-93
WP_005807512.1|139367_139748_+	hypothetical protein	NA	X5JAJ0	Clostridium_phage	39.5	6.3e-14
WP_005807509.1|139723_140098_+	hypothetical protein	NA	X5JAV9	Clostridium_phage	44.7	2.3e-16
WP_005807507.1|140097_140505_+	HK97 gp10 family phage protein	NA	A0A0A7RVN8	Clostridium_phage	33.1	4.7e-15
WP_005807505.1|140501_140930_+	hypothetical protein	NA	A0A0A8WJT3	Clostridium_phage	36.8	1.3e-20
WP_005807504.1|140934_141123_+	hypothetical protein	NA	A0A0A7RTG1	Clostridium_phage	61.5	2.0e-05
WP_005807500.1|141124_142426_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	X5JAJ1	Clostridium_phage	59.0	5.5e-150
WP_005807498.1|142437_142914_+|tail	phage tail tube protein	tail	A0A0A8WJ62	Clostridium_phage	69.1	3.4e-57
WP_005807496.1|142915_143347_+	hypothetical protein	NA	X5JAB6	Clostridium_phage	35.4	2.2e-18
WP_100181642.1|143346_143535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807488.1|146202_146904_+	hypothetical protein	NA	X5J9Z8	Clostridium_phage	47.9	1.0e-33
WP_005807486.1|146906_147866_+	hypothetical protein	NA	H7BVH4	unidentified_phage	61.0	4.2e-115
WP_005807484.1|147858_148179_+	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	39.4	1.2e-13
WP_005807482.1|148175_148583_+	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	48.6	8.8e-30
WP_005807480.1|148582_149653_+|plate	baseplate J/gp47 family protein	plate	X5JAB8	Clostridium_phage	48.1	9.0e-90
WP_005807479.1|149639_150329_+	DUF2313 domain-containing protein	NA	H7BVG1	unidentified_phage	39.2	8.5e-25
WP_005807478.1|150315_151080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007441037.1|151084_151930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005807474.1|151929_153639_+|tail	phage tail protein	tail	A0A0C5AEQ0	Bacteriophage	36.6	4.0e-15
156444:156488	attR	GTTTTGTCAAACATATCATGTAGAAACTATTGTTAGATTTACTTT	NA	NA	NA	NA
>prophage 2
NC_017294	Candidatus Arthromitus sp. SFB-mouse-Yit, complete genome	1586397	408205	415446	1586397	terminase,portal,capsid	Clostridium_phage(50.0%)	11	NA	NA
WP_005806970.1|408205_408628_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	45.6	1.3e-23
WP_005806968.1|408624_409056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005806966.1|409071_409332_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_005806964.1|409345_409648_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_005806962.1|409644_410886_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	57.2	4.9e-140
WP_014518676.1|410944_412156_+|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	43.6	3.1e-94
WP_009068478.1|412233_413118_+|capsid	minor capsid protein	capsid	A0A0A8WIE7	Clostridium_phage	51.7	4.7e-28
WP_005806956.1|413121_413328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007440347.1|413360_413702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005806950.1|413851_414451_+	phage scaffolding protein	NA	S5M9M5	Brevibacillus_phage	31.6	2.5e-12
WP_005806949.1|414459_415446_+	ATP-binding protein	NA	A0A0A7RTH8	Clostridium_phage	44.9	5.8e-35
