The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017043	Rickettsia montanensis str. OSU 85-930, complete genome	1279798	104987	167221	1279798	integrase,head,transposase,capsid	Agrobacterium_phage(25.0%)	60	111306:111342	170267:170303
WP_156794982.1|104987_105158_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_156794984.1|105158_105461_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_014409224.1|106037_106376_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_014409225.1|106365_106767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014409230.1|108264_108531_+	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_041404087.1|108512_108803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014409233.1|108966_109296_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_083837055.1|109359_109920_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.7	1.5e-16
WP_014409234.1|110065_111304_+	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
111306:111342	attL	TCGTCATTGCGAGCAGCCATAGGCTGCGTGGCAATCT	NA	NA	NA	NA
WP_014409235.1|111425_112511_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_014409236.1|112518_114282_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.3	1.5e-62
WP_014409237.1|114338_115661_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014409238.1|116040_117417_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_014409239.1|117542_118451_+	signal peptide peptidase SppA	NA	A0A0N9S104	Escherichia_phage	32.8	3.4e-21
WP_014409240.1|118453_118696_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_014409241.1|118753_118933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014409242.1|119050_119254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014409243.1|119346_119538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014409244.1|119540_120287_+	YaaA family protein	NA	NA	NA	NA	NA
WP_008579904.1|123111_124278_+|integrase	site-specific integrase	integrase	A0A0M3LQN1	Mannheimia_phage	27.1	5.0e-17
WP_008579905.1|124317_126102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008579908.1|126509_126818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008579909.1|126817_127369_+	conjugative transfer protein	NA	NA	NA	NA	NA
WP_011477114.1|127368_127824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008579911.1|127783_128116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008579912.1|128141_129560_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_008579913.1|129559_129814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012152046.1|129797_132329_+	TraC family protein	NA	NA	NA	NA	NA
WP_008579926.1|133180_134869_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011477107.1|135380_136448_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	34.5	1.3e-27
WP_011477106.1|136492_140644_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_008579929.1|141170_141464_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_008579930.1|141679_142327_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_014409246.1|143300_146252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008579933.1|146624_147371_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_008579934.1|147481_148432_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011477104.1|148825_149638_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	32.0	2.2e-32
WP_008579937.1|149639_151349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014409249.1|152096_152297_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014409250.1|152420_153080_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_014409251.1|153362_155069_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_014409252.1|155224_155830_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.0	7.2e-60
WP_156794985.1|156658_156832_-	streptomycin kinase	NA	NA	NA	NA	NA
WP_041404145.1|156867_157293_-	phosphotransferase	NA	NA	NA	NA	NA
WP_083837057.1|157490_157676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083837058.1|157663_158038_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014409255.1|158142_158349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014409256.1|158556_159585_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_156794954.1|159597_159909_-	acetyltransferase	NA	NA	NA	NA	NA
WP_156794986.1|160469_160730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156794987.1|161320_161605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014409261.1|161579_161825_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_014409262.1|162300_163047_-	NTP transferase domain-containing protein	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	36.3	5.6e-30
WP_014409263.1|163043_163805_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_083837060.1|163874_164012_+	palindromic element RPE5 domain-containing protein	NA	NA	NA	NA	NA
WP_008579439.1|164008_164134_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_014409264.1|164718_165195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014409265.1|165296_166139_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_014409266.1|166143_166626_+	DUF2532 domain-containing protein	NA	NA	NA	NA	NA
WP_014409267.1|166705_167221_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
170267:170303	attR	AGATTGCCACGCAGCCTATGGCTGCTCGCAATGACGA	NA	NA	NA	NA
