The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016816	Pantoea ananatis LMG 5342, complete genome	4605545	612722	691832	4605545	tRNA,tail,holin,plate	Erwinia_phage(60.61%)	77	NA	NA
WP_013027332.1|612722_613118_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_014604934.1|613120_613426_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_013027330.1|613461_613836_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_013027329.1|614023_614371_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_015699452.1|614367_615042_-	DedA family protein	NA	NA	NA	NA	NA
WP_014594687.1|615354_616131_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_013027326.1|616218_617523_-	MFS transporter	NA	NA	NA	NA	NA
WP_015699453.1|617922_619338_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_015699454.1|619340_620789_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_015699455.1|620791_622282_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_013027322.1|622336_623308_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	36.4	4.4e-35
WP_015699456.1|623568_624549_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_013027320.1|624684_626373_+	chloride channel protein	NA	NA	NA	NA	NA
WP_014604939.1|626369_626873_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_014594681.1|626955_628074_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_015699457.1|628074_630096_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_015699458.1|630258_630966_-	polyphenol oxidase family protein	NA	NA	NA	NA	NA
WP_013027315.1|631074_631884_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_015699459.1|632456_633089_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_013027313.1|633085_634561_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_014604943.1|634822_636247_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.9	2.9e-19
WP_015699460.1|636265_637363_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_022622436.1|637461_637815_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_014604944.1|638179_639757_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.0	6.9e-22
WP_014594673.1|639773_641555_-	GGDEF and EAL domain-containing protein	NA	NA	NA	NA	NA
WP_015699462.1|641895_643359_+	methyl-accepting chemotaxis sensory transducer	NA	NA	NA	NA	NA
WP_014604946.1|643781_644021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015699464.1|644266_646441_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_013027304.1|647060_647303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015699467.1|648039_648348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013027302.1|648617_648857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014604949.1|648998_649268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015699468.1|649410_649686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071822280.1|649771_649969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015699470.1|650098_650356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014594668.1|650670_652599_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_014604954.1|653264_653459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013027297.1|653657_655202_+	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_013027296.1|655657_657136_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	70.3	1.4e-186
WP_044035388.1|657306_658854_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_015699472.1|658846_659320_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_015699473.1|659340_660750_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_014594662.1|660753_661611_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_015699474.1|661817_662402_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	42.2	2.5e-33
WP_014604958.1|662825_663194_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	58.3	9.4e-39
WP_028715824.1|663260_663479_+	DUF2732 family protein	NA	F1BUS3	Erwinia_phage	54.1	1.0e-08
WP_014594660.1|663478_663706_+	TraR/DksA C4-type zinc finger protein	NA	F1BUS2	Erwinia_phage	50.0	1.4e-13
WP_015699477.1|663702_665766_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	70.5	1.7e-262
WP_013027286.1|665973_666198_+	hypothetical protein	NA	F1BUR9	Erwinia_phage	64.6	2.6e-15
WP_014604961.1|666890_667094_+|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	80.6	2.9e-26
WP_014604962.1|667099_667324_+	hypothetical protein	NA	F1BUQ4	Erwinia_phage	82.4	9.8e-31
WP_015699479.1|667307_667817_+	lysozyme	NA	E5G6N1	Salmonella_phage	65.6	6.9e-56
WP_015699480.1|667813_668248_+	hypothetical protein	NA	F1BUQ1	Erwinia_phage	59.0	2.5e-38
WP_015699481.1|668334_668805_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	62.5	2.9e-48
WP_013027279.1|668897_669482_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	79.4	9.9e-83
WP_015699482.1|669478_669829_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	81.9	2.8e-48
WP_014604965.1|669832_670741_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	82.1	9.5e-133
WP_015699483.1|670733_671267_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	79.1	5.5e-80
WP_015699484.1|671336_673160_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	75.4	2.0e-73
WP_014604968.1|673159_673693_+|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	47.8	8.0e-39
WP_014594650.1|674170_675340_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	89.7	3.3e-202
WP_013027271.1|675352_675865_+|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	85.3	3.3e-82
WP_013027270.1|675919_676216_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	72.2	6.0e-28
WP_013027268.1|676248_676371_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	61.5	7.4e-09
WP_015699486.1|676363_678430_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	46.4	5.7e-08
WP_013027266.1|678436_678940_+|tail	phage tail protein	tail	F1BUT6	Erwinia_phage	73.8	9.8e-55
WP_015699487.1|678941_680099_+	cytochrome c1	NA	A0A0M5M5V5	Salmonella_phage	43.2	2.8e-81
WP_014604972.1|680172_680394_+	ogr/Delta-like zinc finger family protein	NA	F1BUT0	Erwinia_phage	68.1	8.2e-22
WP_015699488.1|680771_681302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148275574.1|681499_681631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041455820.1|682381_683164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041455821.1|683174_683951_+	FAD-dependent thymidylate synthase	NA	A0A0K0N765	Gordonia_phage	36.1	1.6e-27
WP_015699492.1|685592_686108_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_013027259.1|686178_688023_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_014594644.1|688462_690208_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.3	8.1e-72
WP_001144069.1|690324_690540_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_013027257.1|690818_691832_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	5.0e-106
>prophage 2
NC_016816	Pantoea ananatis LMG 5342, complete genome	4605545	1974553	2018681	4605545	capsid,plate,terminase,holin,integrase,tail,lysis	Salmonella_phage(32.5%)	57	1974430:1974458	2018874:2018902
1974430:1974458	attL	ATGTGGCGGTGAGAGGGGGATTCGAACCC	NA	NA	NA	NA
WP_015700096.1|1974553_1975732_-|integrase	tyrosine-type recombinase/integrase	integrase	I6PDJ1	Cronobacter_phage	66.2	7.2e-149
WP_015700097.1|1975892_1977971_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	50.0	6.4e-201
WP_015700098.1|1977967_1978840_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	52.3	6.4e-86
WP_041455871.1|1979317_1979626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015700099.1|1979867_1980404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015700100.1|1980744_1981536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015700101.1|1981700_1982396_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	41.5	3.9e-25
WP_015700102.1|1982395_1983061_-	ATP-binding protein	NA	G9L667	Escherichia_phage	59.9	2.9e-70
WP_015700103.1|1983062_1983731_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	35.7	2.2e-22
WP_041455872.1|1983699_1983909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015700104.1|1984030_1984435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015700105.1|1984564_1984741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080587426.1|1985503_1986187_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNG6	Salmonella_phage	44.4	3.0e-14
WP_041455873.1|1986225_1986462_+	helix-turn-helix domain-containing protein	NA	A0A2D1GLN0	Escherichia_phage	66.7	6.9e-19
WP_041455874.1|1986474_1986777_+	hypothetical protein	NA	I6PCV6	Cronobacter_phage	47.8	9.5e-13
WP_015700107.1|1986769_1986955_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_155270046.1|1987010_1987163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015700108.1|1987155_1988220_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	43.3	6.3e-59
WP_015700109.1|1988212_1989625_+	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	55.1	1.7e-128
WP_041456118.1|1989624_1989981_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	69.6	1.2e-43
WP_041455875.1|1990019_1990871_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	50.5	1.8e-69
WP_041455876.1|1991852_1992098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015700112.1|1992481_1992838_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_167320547.1|1992843_1993326_+	glycoside hydrolase family protein	NA	A0A1W6JP42	Morganella_phage	57.1	1.3e-43
WP_015700114.1|1993322_1993823_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	52.7	5.4e-29
WP_015700115.1|1993827_1994085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015700116.1|1994135_1994309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015700118.1|1994747_1995383_+	hypothetical protein	NA	F1C5D5	Cronobacter_phage	66.8	3.7e-83
WP_015700119.1|1995413_1995887_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	73.7	2.2e-48
WP_041455877.1|1995983_1996598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015700120.1|1996645_1996870_-	YegP family protein	NA	NA	NA	NA	NA
WP_015700121.1|1996971_1998582_+|terminase	phage terminase large subunit	terminase	A0A0M5M1R6	Salmonella_phage	88.2	2.3e-291
WP_015700122.1|1998592_2000065_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	78.6	1.1e-226
WP_167320545.1|2000024_2000690_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	69.6	8.1e-73
WP_015700124.1|2000725_2001949_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	66.6	1.3e-140
WP_015700125.1|2001960_2002458_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	73.9	4.1e-61
WP_015700126.1|2002467_2003409_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	81.8	2.9e-153
WP_015700127.1|2003453_2003789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015700128.1|2003790_2004198_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	77.8	8.8e-54
WP_015700129.1|2004194_2004824_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	40.6	5.4e-26
WP_015700130.1|2004810_2005200_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	76.0	1.3e-51
WP_015700131.1|2005189_2005738_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	57.2	1.4e-54
WP_015700132.1|2005741_2006887_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	68.8	7.7e-148
WP_015700133.1|2006899_2007340_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	86.3	2.3e-68
WP_015700134.1|2007342_2007774_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	72.4	3.8e-47
WP_015700135.1|2007803_2007962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015700136.1|2007951_2009928_+	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	71.7	2.7e-281
WP_015700137.1|2009927_2010545_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	62.4	1.9e-55
WP_015700138.1|2010541_2010844_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	52.0	1.6e-23
WP_015700141.1|2011871_2012222_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	43.5	9.9e-22
WP_015700142.1|2012432_2013485_+	hypothetical protein	NA	U5P4L0	Shigella_phage	48.1	1.5e-89
WP_041455879.1|2013501_2014002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015700143.1|2014069_2014726_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	55.2	8.3e-70
WP_015700144.1|2014722_2015076_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	85.5	1.4e-52
WP_015700145.1|2015075_2016275_+|plate	baseplate J/gp47 family protein	plate	A0A2H4J5T1	uncultured_Caudovirales_phage	72.9	4.6e-159
WP_015700146.1|2016271_2016964_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	75.7	7.6e-90
WP_015700148.1|2018162_2018681_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	44.3	1.3e-30
2018874:2018902	attR	ATGTGGCGGTGAGAGGGGGATTCGAACCC	NA	NA	NA	NA
>prophage 3
NC_016816	Pantoea ananatis LMG 5342, complete genome	4605545	2054417	2118697	4605545	portal,protease,holin,integrase,tRNA,tail	Erwinia_phage(18.75%)	58	2051169:2051184	2081569:2081584
2051169:2051184	attL	ACCAGAACGGCGCGCA	NA	NA	NA	NA
WP_014605672.1|2054417_2056196_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	26.4	2.1e-11
WP_013026082.1|2056195_2056627_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_013026080.1|2056866_2057610_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013026079.1|2057646_2058174_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	27.2	8.5e-09
WP_013026078.1|2058270_2058885_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_013026077.1|2058893_2059898_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.4	2.1e-08
WP_015700166.1|2059898_2060684_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_014593885.1|2060680_2061436_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	3.3e-14
WP_013026074.1|2061513_2062461_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_013026073.1|2062475_2063807_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	37.2	4.8e-16
WP_041455881.1|2063952_2064894_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_014593881.1|2064923_2066156_-	MFS transporter	NA	NA	NA	NA	NA
WP_013026070.1|2066241_2067684_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_014593880.1|2067978_2068842_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013026068.1|2069212_2070688_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.8	1.6e-76
WP_015700167.1|2070874_2071513_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_015700168.1|2071567_2072746_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_015700169.1|2072916_2073561_+	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_015700170.1|2073676_2075749_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_015700171.1|2075732_2076404_-	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_019105100.1|2076403_2076634_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	67.7	8.2e-17
WP_013026061.1|2076784_2077159_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_015700172.1|2077163_2078039_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_014593872.1|2078066_2078414_+	YebY family protein	NA	NA	NA	NA	NA
WP_141120393.1|2078943_2079132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080587427.1|2079177_2079396_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	76.6	2.5e-23
WP_022623257.1|2079834_2080407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022623256.1|2080440_2080803_-|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	73.6	2.5e-44
WP_015700175.1|2080982_2082005_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	77.3	4.2e-153
2081569:2081584	attR	ACCAGAACGGCGCGCA	NA	NA	NA	NA
WP_015700176.1|2082055_2083171_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_052310185.1|2083280_2084210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015700178.1|2084680_2085082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022623254.1|2086113_2086665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014605683.1|2086916_2088461_-	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_013026057.1|2088950_2089655_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015700180.1|2089934_2091557_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_015700181.1|2091553_2092876_+	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_029568844.1|2093145_2093619_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_015700182.1|2093657_2095202_-	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_014605687.1|2095752_2095947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014605688.1|2095985_2097119_-	acyltransferase	NA	Q6QI96	Burkholderia_phage	32.3	1.2e-36
WP_015700183.1|2097300_2098047_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	3.2e-09
WP_015700184.1|2098084_2099002_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	33.3	6.0e-10
WP_041455882.1|2099084_2099498_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013026047.1|2099532_2099862_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_013026045.1|2100594_2102277_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.6	7.8e-56
WP_013026044.1|2102300_2103773_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014593862.1|2103790_2104384_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_014593861.1|2104640_2106671_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	26.1	3.4e-21
WP_015700189.1|2106802_2108170_+	MFS transporter	NA	NA	NA	NA	NA
WP_013026040.1|2108266_2108485_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_041455883.1|2108632_2110060_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_015700191.1|2110137_2112777_-	PqiB family protein	NA	NA	NA	NA	NA
WP_013026037.1|2112745_2113990_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_013026036.1|2114201_2114702_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_015700192.1|2114798_2115500_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_014605697.1|2115519_2117565_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.0	4.4e-85
WP_013026033.1|2117815_2118697_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
NC_016816	Pantoea ananatis LMG 5342, complete genome	4605545	2610462	2624195	4605545	tRNA	Pandoravirus(11.11%)	15	NA	NA
WP_013025587.1|2610462_2611509_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	47.9	3.0e-82
WP_015700421.1|2611510_2612947_-	YdiU family protein	NA	NA	NA	NA	NA
WP_015700422.1|2613037_2613772_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_014605964.1|2614062_2614521_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	38.4	5.5e-12
WP_029568724.1|2614587_2615337_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	NA	NA	NA	NA
WP_013025582.1|2615337_2615883_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	40.7	1.8e-14
WP_013025581.1|2615916_2616906_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	1.5e-14
WP_006118960.1|2617005_2617308_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	5.6e-13
WP_015700424.1|2617312_2619700_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	30.9	4.6e-09
WP_013025578.1|2619714_2620698_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.1	1.4e-33
WP_106120997.1|2620846_2620891_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_006118956.1|2621012_2621369_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004157374.1|2621413_2621611_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_026020952.1|2621711_2622263_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.8	4.9e-15
WP_014593593.1|2622266_2624195_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	3.1e-125
>prophage 5
NC_016816	Pantoea ananatis LMG 5342, complete genome	4605545	2936865	2996237	4605545	portal,protease,capsid,terminase,holin,integrase,tail,head	Enterobacteria_phage(31.43%)	65	2970828:2970843	2997384:2997399
WP_015700588.1|2936865_2938128_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	71.8	2.0e-173
WP_015700589.1|2938127_2938367_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	53.8	2.0e-18
WP_015700590.1|2938578_2939886_-|tail	tail fiber domain-containing protein	tail	Q5G8V6	Enterobacteria_phage	32.2	3.0e-31
WP_015700591.1|2939946_2941023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015700592.1|2941015_2944246_-	host specificity protein J	NA	E4WL39	Enterobacteria_phage	60.2	0.0e+00
WP_041455950.1|2944371_2945073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015700593.1|2945077_2945695_-|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	60.7	4.4e-65
WP_015700594.1|2945687_2946407_-	C40 family peptidase	NA	M9NZD8	Enterobacteria_phage	64.3	5.1e-97
WP_015700595.1|2946409_2947147_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	78.0	2.4e-118
WP_041455951.1|2947199_2947541_-|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	57.7	7.9e-32
WP_015700597.1|2947543_2950888_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	55.1	8.0e-302
WP_015700598.1|2951138_2951504_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	55.9	1.5e-28
WP_015700599.1|2951559_2952015_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	75.5	2.2e-61
WP_041456148.1|2952046_2952448_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	73.5	7.8e-47
WP_041455952.1|2952450_2952834_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	54.8	9.2e-37
WP_041455953.1|2952826_2953162_-|head	phage head closure protein	head	Q7Y406	Yersinia_phage	53.2	5.6e-22
WP_015700602.1|2953158_2953485_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	49.1	2.5e-27
WP_015700603.1|2953529_2954744_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	83.9	3.1e-187
WP_015700604.1|2954753_2955602_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	K7PH05	Enterobacteria_phage	72.3	4.9e-107
WP_015700605.1|2955613_2956918_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.3	5.8e-216
WP_015700606.1|2956917_2958648_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	76.9	9.6e-275
WP_015700607.1|2958651_2959125_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.4	4.1e-63
WP_041455954.1|2959325_2959676_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	73.9	1.1e-49
WP_052310191.1|2959923_2960262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041455956.1|2960392_2960641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015700610.1|2960821_2961103_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	69.9	1.6e-30
WP_041455958.1|2961102_2961297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015700611.1|2961443_2961878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015700612.1|2961874_2962300_-	lysozyme	NA	A0A0B5KND4	Acinetobacter_phage	60.7	3.2e-38
WP_041455959.1|2962283_2962637_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_015700614.1|2963158_2964241_+	hypothetical protein	NA	U5P4L0	Shigella_phage	64.2	8.1e-123
WP_052310192.1|2964262_2964775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041455961.1|2964790_2965153_-	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	66.1	3.2e-39
WP_015700615.1|2965174_2966188_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	52.4	2.1e-96
WP_015700616.1|2966184_2966979_-	phage regulatory protein/antirepressor Ant	NA	A0A1P8DTE1	Proteus_phage	47.0	2.2e-45
WP_015700617.1|2967293_2968985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080587435.1|2969182_2969344_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	65.2	5.2e-10
WP_015700618.1|2969403_2970312_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_015700619.1|2970655_2971468_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	68.7	1.5e-92
2970828:2970843	attL	GCTTTGGTCAGTTTCT	NA	NA	NA	NA
WP_041455963.1|2971583_2972015_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015700621.1|2972024_2972792_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	48.3	1.1e-57
WP_041455964.1|2972909_2973092_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_041455965.1|2973379_2973916_-	hypothetical protein	NA	R9TRN6	Vibrio_phage	39.6	2.2e-12
WP_071822317.1|2973935_2974151_-	cell division protein	NA	NA	NA	NA	NA
WP_052310197.1|2974247_2974892_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	3.7e-38
WP_041455968.1|2975220_2975379_+	DUF1317 family protein	NA	NA	NA	NA	NA
WP_052310193.1|2975662_2976616_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_071822319.1|2977144_2977372_+	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	44.4	4.6e-12
WP_015700626.1|2977371_2978394_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	62.4	4.2e-121
WP_006118776.1|2978976_2979525_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_013025304.1|2979593_2981426_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_013025303.1|2981418_2982078_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_013025302.1|2982502_2982727_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_014606161.1|2982760_2983372_-	autoinducer synthase	NA	NA	NA	NA	NA
WP_013025300.1|2983494_2984217_-	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_015700631.1|2985137_2985833_-	extensin family protein	NA	NA	NA	NA	NA
WP_013025298.1|2986117_2987509_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_013025297.1|2987551_2988526_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_014593360.1|2988573_2989209_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_015700632.1|2989378_2990293_-	DMT family transporter	NA	NA	NA	NA	NA
WP_013025294.1|2990862_2991462_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_013025293.1|2991482_2991713_+	YccJ family protein	NA	NA	NA	NA	NA
WP_024470944.1|2991768_2993151_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_019106206.1|2993211_2994849_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_014606165.1|2995580_2996237_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.7	4.0e-48
2997384:2997399	attR	GCTTTGGTCAGTTTCT	NA	NA	NA	NA
>prophage 6
NC_016816	Pantoea ananatis LMG 5342, complete genome	4605545	3559186	3568045	4605545		Streptococcus_phage(28.57%)	9	NA	NA
WP_015700885.1|3559186_3560935_-	phage EPS-depolymerase	NA	A0A1S6L3G8	Erwinia_phage	46.9	9.7e-158
WP_013024790.1|3561134_3561425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013024789.1|3561421_3561769_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	45.1	5.6e-17
WP_013024788.1|3561765_3562233_-	hypothetical protein	NA	H9C148	Vibrio_phage	45.3	1.3e-29
WP_013024787.1|3562429_3562708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013024786.1|3563130_3563850_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	35.4	5.5e-43
WP_015700887.1|3564208_3565462_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.6	1.1e-91
WP_014593015.1|3565471_3566575_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	3.4e-60
WP_015700888.1|3566926_3568045_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.5	1.1e-109
>prophage 7
NC_016816	Pantoea ananatis LMG 5342, complete genome	4605545	4107915	4169329	4605545	transposase,protease,integrase	uncultured_Caudovirales_phage(25.0%)	60	4160402:4160416	4169702:4169716
WP_013024314.1|4107915_4108401_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.8	4.1e-26
WP_013024313.1|4108404_4109046_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_006121723.1|4109362_4109755_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_006121722.1|4109770_4110199_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_014595150.1|4110424_4111552_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_006121720.1|4111729_4112131_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_014595149.1|4112240_4113623_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	2.6e-25
WP_013024309.1|4113712_4114774_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	32.2	7.0e-10
WP_015701109.1|4114858_4115836_-	elongation factor P--(R)-beta-lysine ligase	NA	NA	NA	NA	NA
WP_013024307.1|4115970_4116495_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	50.9	3.9e-46
WP_014606758.1|4116535_4116670_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_024472200.1|4116774_4116906_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_013024304.1|4116954_4117521_-	elongation factor P	NA	NA	NA	NA	NA
WP_013024303.1|4117561_4118590_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_014606760.1|4118751_4119102_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_013024301.1|4119294_4120944_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.5	1.9e-187
WP_014606761.1|4120992_4121286_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	38.9	3.9e-11
WP_013024299.1|4121518_4121980_-	FxsA family protein	NA	NA	NA	NA	NA
WP_015701111.1|4122301_4123738_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_013024297.1|4123852_4125154_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_013024296.1|4125211_4125526_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_015701113.1|4125501_4127196_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_015701114.1|4127260_4127839_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014606766.1|4128303_4129269_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033770458.1|4129298_4130852_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_015701116.1|4131002_4131596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015701117.1|4131769_4132759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015701118.1|4132851_4134060_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_014606771.1|4134113_4134668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019106233.1|4135559_4136240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015701119.1|4136753_4137164_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_029569615.1|4137337_4137646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015701120.1|4137838_4138282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701121.1|4138563_4139199_-	peptidase	NA	NA	NA	NA	NA
WP_015701122.1|4139695_4140163_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015701123.1|4140306_4141209_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_015701124.1|4142486_4142930_+	acetyltransferase	NA	NA	NA	NA	NA
WP_014593505.1|4142949_4143534_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015700494.1|4143849_4145025_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_015701125.1|4145728_4147666_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.5	2.7e-12
WP_015701119.1|4148326_4148737_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_015701126.1|4148819_4150058_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013025476.1|4150520_4151054_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015701127.1|4151253_4151856_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	32.1	3.1e-07
WP_014606060.1|4152315_4153968_+	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_014333112.1|4154202_4155096_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_026021001.1|4155125_4155812_-	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_014333110.1|4155855_4156458_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014606784.1|4156763_4157006_+	DNA polymerase III subunit theta	NA	A0A2H4J4A9	uncultured_Caudovirales_phage	77.5	3.8e-28
WP_014606786.1|4158369_4159398_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	61.0	6.3e-117
WP_014606787.1|4159650_4160649_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
4160402:4160416	attL	CCGCCCTGACGCCGG	NA	NA	NA	NA
WP_014606788.1|4160800_4161961_+	TDT family transporter	NA	NA	NA	NA	NA
WP_014606789.1|4161957_4162557_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_014606790.1|4162754_4163663_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_014606791.1|4163659_4164085_+	universal stress protein	NA	NA	NA	NA	NA
WP_014606792.1|4164100_4165390_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	53.2	2.6e-120
WP_019105545.1|4165433_4166141_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_014606794.1|4166137_4166518_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	57.4	2.4e-29
WP_014606795.1|4166684_4167086_-	VOC family protein	NA	NA	NA	NA	NA
WP_014606796.1|4167211_4169329_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4169702:4169716	attR	CCGGCGTCAGGGCGG	NA	NA	NA	NA
