The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016749	Streptococcus macedonicus ACA-DC 198, complete genome	2130034	251707	321865	2130034	transposase,tRNA,integrase	Streptococcus_phage(45.0%)	54	305044:305060	321041:321057
WP_014293891.1|251707_253054_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	35.5	7.9e-51
WP_009853359.1|253046_253451_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_014293892.1|253513_254263_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_014293893.1|254312_254825_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_014293894.1|254992_255853_+	DegV family protein	NA	NA	NA	NA	NA
WP_014293895.1|255983_256940_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_003063191.1|257141_257588_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_014293896.1|257610_258003_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_014293898.1|258781_259477_+	hypothetical protein	NA	A0A2H4YF91	Aeromonas_phage	32.0	1.8e-06
WP_014293899.1|259480_263875_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A1V0SEE0	Indivirus	21.8	2.1e-23
WP_014293900.1|264037_267796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014293901.1|267811_269263_+	putative DNA binding domain-containing protein	NA	A0A1B3AYT3	Gordonia_phage	35.9	3.5e-68
WP_014293902.1|269454_270318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145971683.1|270477_271621_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.1	2.8e-28
WP_039670415.1|272315_272762_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002294571.1|273373_273580_+	copper chaperone TcrZ	NA	NA	NA	NA	NA
WP_014293906.1|273718_275830_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	29.9	8.0e-58
WP_014293907.1|276536_277151_+	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_014293908.1|277162_277501_+	Cd(II)/Zn(II)-sensing metalloregulatory transcriptional regulator CadX	NA	E4ZFI8	Streptococcus_phage	33.3	6.5e-10
WP_014293909.1|277710_278031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014293910.1|283911_284397_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_009853366.1|284536_284803_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_014293911.1|284814_286152_+	PFL family protein	NA	NA	NA	NA	NA
WP_014293912.1|286376_287081_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_014293913.1|287064_287838_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_014293914.1|287834_288416_+	glucosaminidase domain-containing protein	NA	S5M633	Brevibacillus_phage	31.5	1.3e-13
WP_014293915.1|288549_289584_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_014293916.1|289625_290165_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_014293917.1|290247_292077_+	molecular chaperone DnaK	NA	G5CSH3	Megavirus	49.5	1.7e-133
WP_014293918.1|292379_293534_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	28.9	1.7e-17
WP_014293919.1|293652_294402_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_014293920.1|294391_295159_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_014293921.1|295145_295613_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_014293922.1|295641_296205_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_014293923.1|296247_297090_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_014293924.1|297337_298621_+	trigger factor	NA	NA	NA	NA	NA
WP_014293925.1|298812_299385_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_014293926.1|299657_301262_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	46.6	3.7e-140
WP_014293927.1|301379_302315_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014293928.1|302516_303773_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	55.5	2.0e-125
WP_014293929.1|304083_304965_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
305044:305060	attL	CCCATTAATACTTTGAT	NA	NA	NA	NA
WP_048816333.1|305173_305467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014293930.1|305799_307494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014293931.1|307625_309089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014293932.1|309088_310195_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	40.9	3.1e-53
WP_014293933.1|310815_312165_-|integrase	site-specific integrase	integrase	A0A1S5S9U4	Streptococcus_phage	28.1	5.0e-29
WP_014293934.1|312164_312413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014293935.1|312507_313188_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.2e-110
WP_014293936.1|313620_314400_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003134160.1|314490_316395_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.5	9.4e-90
WP_014293938.1|317402_318083_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	100.0	4.0e-128
WP_003726380.1|318425_318785_+	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	48.2	5.4e-23
WP_001291323.1|318781_320899_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	62.7	3.1e-235
WP_014293935.1|321184_321865_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.2e-110
321041:321057	attR	CCCATTAATACTTTGAT	NA	NA	NA	NA
>prophage 2
NC_016749	Streptococcus macedonicus ACA-DC 198, complete genome	2130034	909331	986542	2130034	transposase,integrase	Streptococcus_phage(16.67%)	62	912966:912981	992695:992710
WP_014294462.1|909331_910588_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.4	2.7e-170
WP_014294464.1|911651_911981_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_009854101.1|912166_912808_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014294465.1|912819_913449_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	8.3e-27
912966:912981	attL	ACTTGAAAAAATTGAT	NA	NA	NA	NA
WP_014294466.1|913472_914315_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014294467.1|914384_915602_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_014294468.1|915717_916671_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.6	5.4e-38
WP_014294469.1|916860_918189_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_014294472.1|920781_921405_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.9	1.1e-31
WP_014294474.1|922091_923210_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_014294475.1|923216_924056_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_014294476.1|924102_924783_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	34.9	6.2e-12
WP_014294477.1|924919_925567_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_014294478.1|925712_926060_-	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_014294479.1|926049_927177_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	29.2	2.3e-35
WP_014294480.1|927184_928156_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.0	3.5e-40
WP_014294481.1|928241_928811_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_039670822.1|928943_929609_+	GTP pyrophosphokinase family protein	NA	F8K9M7	Nitrososphaera_phage	32.6	2.6e-10
WP_014294483.1|929583_930420_+	NAD kinase	NA	NA	NA	NA	NA
WP_014294484.1|930416_931307_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_014294485.1|931323_932322_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_014294486.1|932389_933145_+	SDR family oxidoreductase	NA	F2NZ12	Diadromus_pulchellus_ascovirus	28.6	2.9e-10
WP_014294487.1|933174_933573_-	sodium transporter	NA	NA	NA	NA	NA
WP_014294488.1|934710_935145_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_142348653.1|935216_935402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142378756.1|935531_935849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014294490.1|940045_941029_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	74.3	1.9e-139
WP_014294295.1|941120_942377_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	5.8e-173
WP_014294492.1|943398_943980_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_039670824.1|943981_945262_+	purine permease	NA	Q9KX94	Enterobacteria_phage	28.4	3.0e-31
WP_014294494.1|945310_946249_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_014294495.1|946380_946566_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_014294496.1|946670_946880_-	hypothetical protein	NA	Q7Y4M2	Streptococcus_phage	73.9	1.2e-22
WP_012961935.1|947349_947931_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	53.2	1.2e-48
WP_014294497.1|947969_949049_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_014294498.1|949048_949879_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_014294499.1|949871_950471_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	31.1	1.8e-18
WP_014294500.1|950574_951825_+	serine hydroxymethyltransferase	NA	A0A219YB23	Aeromonas_phage	53.0	1.5e-99
WP_014294501.1|951869_952847_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_014294502.1|952846_953449_+	lysozyme family protein	NA	M4W8D4	Bacillus_phage	47.0	4.5e-22
WP_014294503.1|953488_955213_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	2.4e-44
WP_014294504.1|955214_956951_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	4.7e-56
WP_014294505.1|957089_958544_-	alpha-amylase	NA	NA	NA	NA	NA
WP_014294508.1|959358_959967_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	40.5	1.0e-34
WP_014294509.1|960334_961897_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.3	5.4e-19
WP_014294510.1|962121_964155_+	type III restriction-modification system methylation subunit	NA	B3RH19	Escherichia_phage	43.2	5.5e-88
WP_014294511.1|964156_966943_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_158309478.1|966935_967721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014294295.1|967852_969109_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	73.6	5.8e-173
WP_014294513.1|969351_969672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_181878411.1|969668_970742_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_014294515.1|970743_971331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014294516.1|971458_972070_+	replication protein	NA	NA	NA	NA	NA
WP_014294517.1|972062_972269_+	DUF3173 family protein	NA	NA	NA	NA	NA
WP_014294518.1|972270_973503_+|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	27.8	7.8e-21
WP_014294521.1|975965_977291_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_014294522.1|977823_979419_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	47.3	3.0e-113
WP_014294523.1|979420_980005_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	30.1	1.4e-12
WP_014294524.1|980011_982957_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.7	6.0e-19
WP_014294525.1|983001_983937_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	49.2	6.4e-84
WP_081498575.1|983990_985676_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	23.5	3.5e-11
WP_014294527.1|985843_986542_+	GntR family transcriptional regulator	NA	A0A2H5BLU5	Streptomyces_phage	36.7	2.0e-05
992695:992710	attR	ACTTGAAAAAATTGAT	NA	NA	NA	NA
>prophage 3
NC_016749	Streptococcus macedonicus ACA-DC 198, complete genome	2130034	1071779	1151795	2130034	transposase,protease,integrase	Streptococcus_phage(16.67%)	60	1121994:1122011	1141509:1141526
WP_014293928.1|1071779_1073036_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	55.5	2.0e-125
WP_014294613.1|1073096_1073588_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_014294614.1|1073812_1074583_-	cyclase family protein	NA	NA	NA	NA	NA
WP_014294615.1|1074779_1076060_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_014294618.1|1077972_1080288_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.8	9.2e-132
WP_014294620.1|1081011_1081824_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_044563045.1|1081992_1083393_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.7	1.2e-20
WP_014294622.1|1083891_1085220_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_014294624.1|1086352_1087009_-	lipase/acylhydrolase	NA	NA	NA	NA	NA
WP_014294625.1|1087829_1088648_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_014294626.1|1088785_1089322_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_014294628.1|1091213_1092785_-	AarF/ABC1/UbiB kinase family protein	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	31.7	2.1e-34
WP_014294629.1|1092793_1093087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014294630.1|1093538_1094462_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_115266054.1|1094654_1096003_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.6	6.5e-61
WP_014294631.1|1096078_1097980_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_014294634.1|1099066_1100599_-	chloride channel protein	NA	NA	NA	NA	NA
WP_014294635.1|1100752_1101826_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014294636.1|1101818_1102607_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014294637.1|1102603_1103398_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014294638.1|1103381_1104536_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	42.2	8.9e-35
WP_039670864.1|1104563_1105466_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_014294640.1|1105594_1106074_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_014294641.1|1106070_1106433_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014294642.1|1106499_1107300_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.3	1.0e-21
WP_014294643.1|1107337_1107901_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	51.1	7.9e-45
WP_014294644.1|1107937_1109191_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014294645.1|1109803_1110682_-	cysteine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014294646.1|1110715_1111462_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.6	6.8e-36
WP_014294647.1|1111467_1112145_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014294648.1|1112104_1112788_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014294651.1|1114667_1115558_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_014294652.1|1115544_1116411_-	homoserine kinase	NA	NA	NA	NA	NA
WP_014294653.1|1116468_1117755_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_014294654.1|1117977_1118928_+	polysaccharide deacetylase family protein	NA	G3MB53	Bacillus_virus	27.7	2.2e-07
1121994:1122011	attL	CTATTATTTAAGAGTAAC	NA	NA	NA	NA
WP_014294658.1|1122050_1123256_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	31.1	4.5e-29
WP_000860228.1|1123258_1123507_-	DUF3173 family protein	NA	NA	NA	NA	NA
WP_014294659.1|1123776_1124001_-	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	39.3	2.6e-07
WP_014294660.1|1124248_1125145_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_044563235.1|1125232_1126660_-	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.7	9.6e-47
WP_014294662.1|1126741_1128442_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_014294663.1|1128441_1128759_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_007209213.1|1128786_1129767_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_014294664.1|1129769_1130702_-	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_014294665.1|1130713_1131229_-	galactose-6-phosphate isomerase subunit LacB	NA	NA	NA	NA	NA
WP_014294666.1|1131262_1131688_-	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_014294667.1|1131931_1132882_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_014294668.1|1133062_1133824_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.2	4.8e-21
WP_014294671.1|1135198_1135372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014294672.1|1135698_1136880_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	29.3	2.0e-26
WP_014294673.1|1136869_1137130_-	DUF3173 family protein	NA	NA	NA	NA	NA
WP_014294675.1|1137626_1141235_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	23.8	3.8e-07
WP_014294676.1|1141511_1141877_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
1141509:1141526	attR	CTATTATTTAAGAGTAAC	NA	NA	NA	NA
WP_014294677.1|1141956_1142460_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_014294679.1|1143643_1145752_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.2	9.3e-123
WP_044563239.1|1146615_1147242_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_014294682.1|1147326_1148274_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_014294683.1|1148286_1149663_-	amino acid permease	NA	NA	NA	NA	NA
WP_014294684.1|1149961_1150555_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_012962047.1|1150565_1151795_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.7	3.9e-137
>prophage 4
NC_016749	Streptococcus macedonicus ACA-DC 198, complete genome	2130034	1168682	1177213	2130034		Staphylococcus_phage(50.0%)	7	NA	NA
WP_014294703.1|1168682_1169522_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.5	2.0e-52
WP_044563054.1|1169601_1170228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081498580.1|1170190_1170514_-	hypothetical protein	NA	A0A2K5B2C1	Erysipelothrix_phage	51.6	7.0e-14
WP_081498581.1|1170701_1170878_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	64.3	1.4e-08
WP_014294704.1|1171156_1172812_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	49.4	1.1e-123
WP_014294705.1|1172907_1174083_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	27.0	1.4e-22
WP_044563243.1|1174138_1177213_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	21.0	3.3e-12
>prophage 5
NC_016749	Streptococcus macedonicus ACA-DC 198, complete genome	2130034	1193528	1202741	2130034	tRNA	Bacillus_phage(37.5%)	8	NA	NA
WP_014294723.1|1193528_1194020_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	61.6	2.8e-46
WP_099390341.1|1194032_1194749_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	47.9	6.3e-63
WP_014294725.1|1194738_1195185_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	57.7	3.4e-43
WP_014294726.1|1195177_1195837_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	54.2	1.2e-60
WP_014294727.1|1196081_1197848_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	1.9e-60
WP_014294728.1|1197850_1199590_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	5.1e-42
WP_014294729.1|1199667_1201539_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.1	4.6e-65
WP_014294730.1|1201535_1202741_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	47.5	4.6e-42
>prophage 6
NC_016749	Streptococcus macedonicus ACA-DC 198, complete genome	2130034	1603705	1619272	2130034		Streptococcus_phage(84.62%)	18	NA	NA
WP_014295073.1|1603705_1604536_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.5	2.1e-123
WP_014295076.1|1606164_1606521_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	58.3	4.0e-34
WP_014295077.1|1606533_1607019_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	51.6	4.6e-41
WP_014295078.1|1607077_1607305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014295079.1|1607403_1608582_-	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	81.1	3.9e-179
WP_014295080.1|1608627_1609176_-	hypothetical protein	NA	M1PSC3	Streptococcus_phage	56.7	2.2e-55
WP_014295081.1|1609246_1610338_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	81.5	3.9e-173
WP_014295082.1|1610473_1611112_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_014295083.1|1611242_1611584_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_014295084.1|1611640_1612876_-	ammonium transporter	NA	NA	NA	NA	NA
WP_014295085.1|1613273_1614140_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.8	2.5e-114
WP_014295086.1|1614146_1614467_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.4	5.9e-29
WP_014295087.1|1614459_1615260_-	signal peptidase II	NA	NA	NA	NA	NA
WP_014295088.1|1615256_1616132_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	50.7	1.9e-74
WP_014295089.1|1616142_1616778_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	65.7	1.0e-69
WP_014295090.1|1616964_1617624_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	63.8	3.6e-73
WP_014295091.1|1617797_1618508_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.6e-13
WP_014295092.1|1618507_1619272_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	3.3e-17
>prophage 7
NC_016749	Streptococcus macedonicus ACA-DC 198, complete genome	2130034	1803577	1939859	2130034	transposase,tRNA,bacteriocin,integrase	Bacillus_phage(38.1%)	93	1896840:1896878	1941055:1941093
WP_014295262.1|1803577_1804834_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	55.6	8.6e-124
WP_014295263.1|1805016_1805862_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	31.7	2.1e-25
WP_014295264.1|1805983_1808275_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_014295265.1|1808596_1810249_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	33.5	2.7e-32
WP_014295266.1|1810241_1810919_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.5	2.3e-38
WP_014295267.1|1810915_1811569_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003066483.1|1811565_1812315_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	1.5e-14
WP_014295268.1|1812307_1813186_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_014295269.1|1813188_1814034_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_014295270.1|1814044_1814926_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014295271.1|1815177_1815477_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_014295272.1|1815521_1816226_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014295273.1|1816328_1816916_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_003066496.1|1816988_1817522_-	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_014295274.1|1817743_1818916_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.8	2.9e-17
WP_014295275.1|1819045_1819315_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_014295276.1|1819640_1819967_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_014295277.1|1819956_1820652_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_014295278.1|1820745_1821756_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.4	1.8e-60
WP_014295279.1|1821765_1822206_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_014295280.1|1822189_1822879_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_014295281.1|1823059_1823290_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_014295282.1|1823291_1824974_+	ribonuclease J	NA	NA	NA	NA	NA
WP_014295283.1|1826057_1827497_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_014295284.1|1827498_1832016_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_014295285.1|1832193_1833540_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_009854980.1|1833589_1833961_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014295286.1|1834049_1834586_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_014295287.1|1834815_1836012_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_014295288.1|1836199_1837213_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_014295289.1|1837418_1839497_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	29.1	6.7e-65
WP_014295290.1|1839695_1840166_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003066537.1|1840186_1840600_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_014295291.1|1840886_1841699_-	pur operon repressor	NA	A0A1X9I6E2	Streptococcus_phage	29.6	1.5e-07
WP_014295292.1|1841855_1842794_-	3'-5' exoribonuclease YhaM family protein	NA	NA	NA	NA	NA
WP_014295293.1|1842783_1844058_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_014295294.1|1844059_1844689_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_014295295.1|1844685_1845345_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_014295296.1|1845351_1846224_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_014295297.1|1846665_1846923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014295298.1|1847052_1847367_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_014295300.1|1847940_1848252_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_014295301.1|1848263_1848413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014295304.1|1848943_1849084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014295305.1|1849101_1850409_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_014295306.1|1850416_1851148_-	response regulator transcription factor	NA	A0A1V0E029	Clostridioides_phage	25.0	5.7e-19
WP_009855002.1|1851164_1851491_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145971690.1|1851650_1852762_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	40.7	1.4e-48
WP_014295309.1|1853572_1854742_-	MFS transporter	NA	NA	NA	NA	NA
WP_014295310.1|1854734_1855790_-	ThiF family adenylyltransferase	NA	A0A1V0SIK8	Klosneuvirus	29.1	4.5e-09
WP_006531876.1|1857706_1857895_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_039671240.1|1857914_1858148_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014295314.1|1859188_1859500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014295315.1|1859587_1859818_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014295316.1|1862214_1863609_+|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_014295317.1|1863742_1864615_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_044563128.1|1864684_1865209_-	DUF1697 domain-containing protein	NA	NA	NA	NA	NA
WP_081498591.1|1865205_1865796_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_014295320.1|1865767_1866538_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_014295323.1|1868275_1870072_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.7	3.3e-76
WP_014295324.1|1870695_1871634_-	class C sortase	NA	NA	NA	NA	NA
WP_014295325.1|1871778_1873215_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_014295326.1|1873305_1878318_-	InlB B-repeat-containing protein	NA	NA	NA	NA	NA
WP_014295327.1|1878358_1878952_-	signal peptidase I	NA	NA	NA	NA	NA
WP_014295328.1|1878938_1879196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014295331.1|1880915_1882187_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_014295332.1|1882208_1883831_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_014295333.1|1883987_1884869_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158309480.1|1884977_1885133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014295334.1|1885249_1886524_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_014295335.1|1886516_1886756_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_014295336.1|1886786_1888049_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	NA	NA	NA	NA
WP_014295337.1|1888045_1889584_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	27.9	2.3e-38
WP_014295338.1|1889598_1889721_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_014295339.1|1889972_1890224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014295340.1|1890294_1890504_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	61.5	2.3e-13
WP_014295341.1|1890620_1891244_-	V-type ATP synthase subunit D	NA	NA	NA	NA	NA
WP_014295342.1|1891277_1892672_-	V-type ATP synthase subunit B	NA	NA	NA	NA	NA
WP_002885866.1|1894355_1894490_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_006531843.1|1894917_1896270_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_014295344.1|1896421_1896835_-	Fic family protein	NA	NA	NA	NA	NA
1896840:1896878	attL	TGACCTAGTCAAGCATTTTTGTAACACTAGTGTATAAAA	NA	NA	NA	NA
WP_145971691.1|1896882_1898045_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.1	2.8e-28
WP_099390966.1|1898321_1898504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158309481.1|1898528_1898915_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1P8CWQ3	Bacillus_phage	43.7	5.1e-19
WP_006531837.1|1899064_1901182_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	27.3	1.2e-53
WP_002294571.1|1901321_1901528_-	copper chaperone TcrZ	NA	NA	NA	NA	NA
WP_039671262.1|1904080_1904536_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_145971692.1|1905673_1906785_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	8.0e-49
WP_006531827.1|1907418_1907784_-	MobC family plasmid mobilization relaxosome protein	NA	NA	NA	NA	NA
WP_014295351.1|1910880_1912449_-	AarF/ABC1/UbiB kinase family protein	NA	E5ES62	Bathycoccus_sp._RCC1105_virus	29.3	3.3e-40
WP_006531821.1|1912458_1912704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014295355.1|1914480_1938363_-	YSIRK signal domain/LPXTG anchor domain surface protein	NA	NA	NA	NA	NA
WP_093529230.1|1938714_1939859_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.1	1.6e-28
1941055:1941093	attR	TTTTATACACTAGTGTTACAAAAATGCTTGACTAGGTCA	NA	NA	NA	NA
>prophage 8
NC_016749	Streptococcus macedonicus ACA-DC 198, complete genome	2130034	2098278	2106421	2130034		Staphylococcus_phage(16.67%)	9	NA	NA
WP_014295489.1|2098278_2098935_-	transglycosylase SLT domain-containing protein	NA	Q4Z8Z7	Staphylococcus_phage	70.9	9.9e-23
WP_014295490.1|2099141_2099735_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	76.9	1.1e-20
WP_014295491.1|2099867_2100665_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_014295492.1|2100657_2101500_-	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.4	1.0e-16
WP_014295493.1|2101475_2102318_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.0	2.2e-19
WP_014295494.1|2102314_2102869_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_014295495.1|2102878_2103823_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014295496.1|2103886_2105176_-	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	25.9	6.1e-16
WP_014295497.1|2105176_2106421_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	42.2	6.1e-90
