The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	0	9036	6097032		Bacillus_thuringiensis_phage(50.0%)	6	NA	NA
WP_004855823.1|3025_3658_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014227367.1|4241_4748_+	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_014836996.1|4936_6310_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_004855828.1|6346_6457_-	YshB family small membrane protein	NA	NA	NA	NA	NA
WP_014836997.1|6568_7978_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
WP_004127098.1|7986_9036_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	2.2e-08
>prophage 2
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	15860	16778	6097032		Pandoravirus(100.0%)	1	NA	NA
WP_014836999.1|15860_16778_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	30.0	4.2e-19
>prophage 3
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	77660	79172	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_014837038.1|77660_79172_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	6.7e-14
>prophage 4
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	87476	91003	6097032		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_004127220.1|87476_88097_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_014837045.1|88168_88843_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004107505.1|88934_90308_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
WP_004127228.1|90304_91003_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 5
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	95815	97150	6097032		Erwinia_phage(100.0%)	1	NA	NA
WP_004127247.1|95815_97150_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
>prophage 6
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	109520	110270	6097032		Escherichia_phage(100.0%)	1	NA	NA
WP_014227432.1|109520_110270_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.1	6.0e-24
>prophage 7
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	126952	128821	6097032		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004856052.1|126952_128821_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.7	2.8e-06
>prophage 8
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	139012	140659	6097032		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_014227445.1|139012_140659_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	33.0	1.6e-66
>prophage 9
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	150349	161184	6097032		Vibrio_phage(20.0%)	9	NA	NA
WP_004097491.1|150349_151078_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.0	1.6e-21
WP_014837064.1|151180_153199_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.7	5.4e-112
WP_014227451.1|153202_154165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837065.1|154148_155564_-	cytosine permease	NA	NA	NA	NA	NA
WP_014227452.1|155582_156599_-	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	25.3	2.2e-08
WP_004097500.1|156820_157561_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162140784.1|157625_159122_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004127388.1|159247_160513_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.8	8.3e-42
WP_004097507.1|160854_161184_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	2.5e-14
>prophage 10
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	165234	169512	6097032		Catovirus(33.33%)	4	NA	NA
WP_004097518.1|165234_166365_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.3	1.9e-26
WP_014837068.1|166361_167624_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.6	2.8e-26
WP_014837069.1|167702_168377_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_004097526.1|168381_169512_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	42.5	5.1e-19
>prophage 11
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	192874	196733	6097032		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_009651718.1|192874_193777_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.9	2.3e-17
WP_014227468.1|193776_194493_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_014227469.1|194570_196733_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	1.3e-116
>prophage 12
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	200582	202409	6097032		Catovirus(100.0%)	1	NA	NA
WP_014837082.1|200582_202409_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	2.8e-83
>prophage 13
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	213212	219391	6097032		Alteromonas_phage(33.33%)	7	NA	NA
WP_014837089.1|213212_214661_+	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	56.4	6.8e-08
WP_004097585.1|214731_215487_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_014837090.1|215500_216106_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_009651715.1|216102_217743_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.6	2.6e-40
WP_004097589.1|217820_218072_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_014227481.1|218075_218615_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004097593.1|218617_219391_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.0	1.5e-25
>prophage 14
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	228595	229210	6097032		Streptococcus_phage(100.0%)	1	NA	NA
WP_014227487.1|228595_229210_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.1	1.4e-18
>prophage 15
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	239090	258808	6097032		uncultured_Mediterranean_phage(16.67%)	14	NA	NA
WP_014227490.1|239090_240041_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.6	3.0e-28
WP_004097636.1|241042_242227_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
WP_004097638.1|242459_242843_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002438628.1|242844_243390_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.1	3.1e-14
WP_004097640.1|243543_243972_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_004097642.1|243975_244680_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_004097644.1|245099_245597_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_004097645.1|245663_246029_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_004097647.1|246354_250383_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	30.2	1.1e-23
WP_014227492.1|250459_254683_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	1.3e-67
WP_004097650.1|255092_256433_+	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
WP_014837098.1|256476_256794_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_004097653.1|256797_257103_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014837099.1|257275_258808_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.7	3.8e-09
>prophage 16
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	267353	276126	6097032		Klosneuvirus(25.0%)	9	NA	NA
WP_014227502.1|267353_268025_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	31.2	1.9e-21
WP_004097673.1|268067_268658_+	YjaG family protein	NA	NA	NA	NA	NA
WP_004097675.1|268844_269117_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.2e-19
WP_004097677.1|269129_269822_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_014837107.1|269825_270260_-	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_014837108.1|270512_271901_+	two-component system sensor histidine kinase ZraS	NA	NA	NA	NA	NA
WP_014837109.1|271897_273232_+	sigma-54-dependent response regulator transcription factor ZraR	NA	Q6XM27	Feldmannia_irregularis_virus	29.9	2.4e-07
WP_014837110.1|273228_274521_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_014837111.1|274536_276126_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	3.2e-67
>prophage 17
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	289926	293610	6097032		Dickeya_phage(100.0%)	1	NA	NA
WP_014837115.1|289926_293610_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 18
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	309931	310720	6097032		Pseudomonas_phage(100.0%)	1	NA	NA
WP_014837127.1|309931_310720_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.4	2.4e-47
>prophage 19
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	323629	324739	6097032		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004097762.1|323629_324739_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 20
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	331938	332547	6097032		Lactococcus_phage(100.0%)	1	NA	NA
WP_004097774.1|331938_332547_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	7.8e-14
>prophage 21
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	338386	341027	6097032		Escherichia_phage(50.0%)	2	NA	NA
WP_004097788.1|338386_339802_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	2.8e-200
WP_014837135.1|339947_341027_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	2.6e-28
>prophage 22
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	345146	350419	6097032		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_004097797.1|345146_347972_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_004097799.1|348218_348746_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	96.4	3.5e-55
WP_014837138.1|348832_350419_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	2.4e-06
>prophage 23
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	362231	363581	6097032		Moraxella_phage(100.0%)	1	NA	NA
WP_014227555.1|362231_363581_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.8	6.7e-159
>prophage 24
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	377205	388317	6097032		Staphylococcus_phage(33.33%)	8	NA	NA
WP_014837149.1|377205_379164_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	6.0e-92
WP_004109428.1|379575_380889_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_014837150.1|380925_381609_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_014837151.1|381815_383963_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.3	3.1e-33
WP_014227570.1|384224_385136_-	allose kinase	NA	NA	NA	NA	NA
WP_014227571.1|385119_385815_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_014837152.1|385825_386806_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_014837153.1|386784_388317_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	26.5	1.4e-11
>prophage 25
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	393983	395625	6097032		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_004097859.1|393983_394670_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.9	1.1e-08
WP_014837160.1|394866_395625_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.2	9.7e-14
>prophage 26
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	400976	407881	6097032		Burkholderia_virus(25.0%)	8	NA	NA
WP_038422897.1|400976_402452_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.0	5.3e-56
WP_014837163.1|402597_402903_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_014227587.1|402902_403823_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	43.8	9.7e-08
WP_004097877.1|403973_404654_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.3	2.7e-31
WP_014837164.1|404877_405660_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_014227589.1|405693_406290_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014837165.1|406405_406993_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042934246.1|407446_407881_+	hypothetical protein	NA	E5AGC9	Erwinia_phage	39.1	1.2e-19
>prophage 27
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	421735	427265	6097032		Cronobacter_phage(33.33%)	5	NA	NA
WP_003855929.1|421735_422029_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
WP_014227597.1|422072_423719_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	1.0e-188
WP_004097909.1|423852_424206_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_014837171.1|424252_425119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837172.1|425141_427265_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.0	1.2e-29
>prophage 28
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	438161	443379	6097032		Morganella_phage(33.33%)	6	NA	NA
WP_014227610.1|438161_438692_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-45
WP_004097938.1|438832_439192_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_004097939.1|439202_439598_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_004109180.1|439608_440343_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_042934248.1|440335_442126_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	1.3e-16
WP_014227612.1|442401_443379_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.2e-27
>prophage 29
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	450630	451176	6097032		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004097954.1|450630_451176_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	7.7e-29
>prophage 30
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	455814	457146	6097032		Vibrio_phage(100.0%)	1	NA	NA
WP_014837183.1|455814_457146_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.6	4.3e-17
>prophage 31
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	464571	468933	6097032		Pithovirus(50.0%)	3	NA	NA
WP_004097979.1|464571_465870_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
WP_004097980.1|466019_466445_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_014837188.1|466482_468933_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	31.9	3.2e-66
>prophage 32
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	508995	515548	6097032		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_004098041.1|508995_509523_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	7.1e-56
WP_004098043.1|509926_510883_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014837206.1|510993_512496_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	2.2e-09
WP_014837207.1|512506_513532_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004098052.1|513518_514505_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_004098053.1|514549_515548_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 33
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	536089	538404	6097032		Ralstonia_phage(50.0%)	2	NA	NA
WP_014837215.1|536089_537922_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	34.1	1.5e-20
WP_014227659.1|537939_538404_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	8.5e-53
>prophage 34
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	548704	628888	6097032	transposase,integrase,protease,tRNA	Enterobacteria_phage(14.29%)	57	569272:569287	623469:623484
WP_014837220.1|548704_549652_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	22.7	1.5e-11
WP_014837221.1|550030_552739_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.1	1.7e-47
WP_009652347.1|552806_553193_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_014837222.1|553347_554823_-	N-acetylglucosamine-binding protein GbpA	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.5	1.9e-21
WP_004098115.1|555083_555545_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_014227670.1|555556_556492_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	7.7e-53
WP_072351778.1|556528_556633_-	pyrBI operon leader peptide	NA	NA	NA	NA	NA
WP_014227671.1|556825_557278_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_014227672.1|557389_558394_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_004098122.1|558558_558984_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_014227673.1|559036_559795_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_014837223.1|559835_560858_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004098126.1|561010_561514_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004098127.1|561636_564492_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	6.0e-141
WP_004098129.1|564491_564935_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_014837224.1|565057_566569_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	2.7e-47
WP_004098132.1|566962_568060_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_014227676.1|568059_569142_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_014227677.1|569183_570686_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	8.8e-83
569272:569287	attL	TGCACAATGCCGTCGC	NA	NA	NA	NA
WP_014837225.1|570772_571594_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_014837226.1|571955_573461_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014227680.1|573479_574289_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_004098142.1|574485_575343_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014837227.1|575494_577408_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_014227682.1|577933_579874_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_004098145.1|579922_580936_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004098146.1|580977_581862_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_004098147.1|581887_582787_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_014837228.1|582955_584455_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_014837229.1|584631_585942_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014227685.1|585934_587008_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.6e-22
WP_004117574.1|587013_587838_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_014227686.1|587848_588736_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_014227687.1|588725_589598_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004128305.1|589788_590808_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.3	2.6e-46
WP_014837230.1|590947_591526_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014837231.1|591525_592539_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_014837232.1|593130_594402_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.3	8.2e-82
WP_014837233.1|595661_596441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040216732.1|596515_596998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837235.1|597987_599070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003031967.1|599343_600312_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_160537662.1|601591_603100_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.4	1.2e-44
WP_014837239.1|604334_606419_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_077253178.1|606429_609027_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_014837241.1|612872_616514_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_014837242.1|616525_617128_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_089046459.1|617124_617727_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_077253179.1|618352_619321_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	2.3e-185
WP_014837244.1|619674_619917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837245.1|620316_621534_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_014837246.1|621620_622574_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042933959.1|623601_624273_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
623469:623484	attR	GCGACGGCATTGTGCA	NA	NA	NA	NA
WP_014837252.1|624935_625754_+	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.0	1.8e-13
WP_014837253.1|625750_626695_+	DMT family transporter	NA	NA	NA	NA	NA
WP_157872483.1|626918_627044_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014837254.1|627274_628888_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	37.4	1.5e-83
>prophage 35
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	644082	644325	6097032		Vibrio_phage(100.0%)	1	NA	NA
WP_044350487.1|644082_644325_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	42.4	8.1e-07
>prophage 36
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	648509	650111	6097032		Yersinia_phage(50.0%)	3	NA	NA
WP_040217125.1|648509_649334_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.2	1.2e-41
WP_044347584.1|649339_649588_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_014837277.1|649667_650111_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	32.8	1.1e-12
>prophage 37
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	666542	667907	6097032		Burkholderia_virus(100.0%)	1	NA	NA
WP_014227732.1|666542_667907_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.3e-45
>prophage 38
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	680710	686425	6097032		Staphylococcus_phage(50.0%)	3	NA	NA
WP_014837298.1|680710_683440_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	1.7e-20
WP_042934268.1|683436_684504_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014837300.1|685027_686425_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.9	3.4e-20
>prophage 39
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	694818	698205	6097032	holin	Serratia_phage(100.0%)	1	NA	NA
WP_014837304.1|694818_698205_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
>prophage 40
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	704082	704667	6097032		Moraxella_phage(100.0%)	1	NA	NA
WP_004098242.1|704082_704667_-	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.3	5.0e-10
>prophage 41
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	714460	717991	6097032		Nocardia_phage(100.0%)	1	NA	NA
WP_042933977.1|714460_717991_-	type I restriction-modification system endonuclease	NA	G9FI19	Nocardia_phage	21.7	8.8e-09
>prophage 42
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	729534	731372	6097032		Streptococcus_phage(50.0%)	2	NA	NA
WP_014837325.1|729534_730746_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	32.7	1.6e-58
WP_014837326.1|730745_731372_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.8	2.7e-54
>prophage 43
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	764323	765532	6097032	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_001352368.1|764323_765532_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 44
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	774907	778111	6097032	transposase	Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_014227808.1|774907_775969_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.3	2.1e-06
WP_014227809.1|775986_776997_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_014227810.1|777136_778111_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	1.8e-68
>prophage 45
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	781273	782553	6097032		Shigella_phage(50.0%)	2	NA	NA
WP_014227813.1|781273_782011_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.3e-63
WP_009652817.1|782013_782553_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	60.6	7.1e-27
>prophage 46
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	795858	798563	6097032		Streptococcus_phage(50.0%)	3	NA	NA
WP_004098388.1|795858_797448_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.3	2.4e-30
WP_014227828.1|797665_798277_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_003856556.1|798401_798563_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	3.0e-13
>prophage 47
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	803231	804554	6097032		Geobacillus_virus(100.0%)	1	NA	NA
WP_014837352.1|803231_804554_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.4	3.4e-78
>prophage 48
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	810853	816072	6097032		Enterococcus_phage(33.33%)	3	NA	NA
WP_004098414.1|810853_812086_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.1e-86
WP_014227837.1|812194_813862_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.4e-41
WP_014837356.1|814134_816072_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	3.6e-12
>prophage 49
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	820036	821461	6097032		Bacillus_phage(100.0%)	1	NA	NA
WP_014227844.1|820036_821461_+	two-component system sensor histidine kinase CreC	NA	W8CYF6	Bacillus_phage	27.7	2.1e-17
>prophage 50
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	832544	833498	6097032		Cyanophage(100.0%)	1	NA	NA
WP_004098458.1|832544_833498_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	2.8e-10
>prophage 51
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	837885	855407	6097032	holin,tRNA	Chrysochromulina_ericina_virus(16.67%)	13	NA	NA
WP_004128758.1|837885_839802_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
WP_014837364.1|839889_841026_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	3.6e-28
WP_042933979.1|841193_842141_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014227856.1|842265_842613_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_014227857.1|842690_843224_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	55.5	2.6e-53
WP_014227858.1|843240_843684_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_042933981.1|844069_846169_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.3	2.0e-32
WP_042933983.1|847592_848252_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014227862.1|848719_849895_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.1	8.4e-89
WP_014227863.1|849947_850847_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_003018940.1|851013_851277_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_004098483.1|851607_852546_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_038424943.1|852590_855407_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.5	2.3e-76
>prophage 52
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	881700	882849	6097032		Halovirus(100.0%)	1	NA	NA
WP_014837384.1|881700_882849_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	1.8e-48
>prophage 53
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	889451	890820	6097032		Bacillus_phage(50.0%)	2	NA	NA
WP_004098524.1|889451_889931_+	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	40.9	6.7e-29
WP_014227890.1|889971_890820_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	S4TT53	Salmonella_phage	30.7	9.9e-07
>prophage 54
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	903361	906268	6097032		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_014227898.1|903361_906268_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	2.9e-21
>prophage 55
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	915026	915728	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_014837394.1|915026_915728_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.7	7.6e-21
>prophage 56
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	936495	938220	6097032		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_025106489.1|936495_938220_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.3	1.0e-34
>prophage 57
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	964337	965381	6097032		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_009654638.1|964337_965381_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.6	2.2e-101
>prophage 58
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	969711	970263	6097032		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_014837410.1|969711_970263_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	35.1	7.8e-13
>prophage 59
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	981510	982935	6097032		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004098637.1|981510_982935_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 60
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	992716	993487	6097032		Escherichia_phage(100.0%)	1	NA	NA
WP_014227944.1|992716_993487_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	37.0	7.5e-30
>prophage 61
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	998370	1004951	6097032		Mamastrovirus(33.33%)	5	NA	NA
WP_014837416.1|998370_999972_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	49.2	1.3e-20
WP_042933986.1|1000072_1002463_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_014227950.1|1002666_1003203_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.8	2.7e-18
WP_004098666.1|1003254_1003917_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_014837419.1|1004024_1004951_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.8e-22
>prophage 62
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1017562	1024328	6097032	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071881716.1|1017562_1018960_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	4.9e-27
WP_014837424.1|1019011_1019893_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_004098689.1|1019953_1020409_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_014227967.1|1020573_1021290_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_014837425.1|1021289_1021826_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_014227969.1|1021898_1024328_+	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	32.2	6.7e-40
>prophage 63
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1046323	1050978	6097032	transposase	Planktothrix_phage(50.0%)	4	NA	NA
WP_004098728.1|1046323_1047121_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	1.2e-14
WP_014837439.1|1047120_1048011_+	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_014837440.1|1048007_1049990_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_014837441.1|1050048_1050978_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	40.4	9.3e-59
>prophage 64
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1054144	1054489	6097032		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_004098733.1|1054144_1054489_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.6e-27
>prophage 65
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1058620	1064424	6097032	protease	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_004098740.1|1058620_1060060_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.5	1.8e-24
WP_004098741.1|1060251_1061409_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_014227995.1|1061445_1064424_-	viral enhancin protein	NA	A9YMZ4	Helicoverpa_armigera_granulovirus	24.0	1.1e-41
>prophage 66
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1074948	1075707	6097032		Flavobacterium_phage(100.0%)	1	NA	NA
WP_004098751.1|1074948_1075707_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	2.1e-24
>prophage 67
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1084541	1088659	6097032		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_014837450.1|1084541_1085138_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	4.6e-27
WP_014837451.1|1085176_1088659_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.3	2.7e-204
>prophage 68
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1103429	1104461	6097032		Planktothrix_phage(100.0%)	1	NA	NA
WP_014837456.1|1103429_1104461_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	7.2e-36
>prophage 69
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1111145	1111949	6097032		Indivirus(100.0%)	1	NA	NA
WP_014837458.1|1111145_1111949_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
>prophage 70
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1115993	1120202	6097032		Lactobacillus_phage(50.0%)	4	NA	NA
WP_014228024.1|1115993_1117361_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	30.6	4.3e-12
WP_014837463.1|1117432_1118188_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_014228026.1|1118220_1118943_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014228028.1|1119470_1120202_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.0	4.6e-37
>prophage 71
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1124302	1124884	6097032		Caulobacter_phage(100.0%)	1	NA	NA
WP_014837469.1|1124302_1124884_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.6	1.1e-12
>prophage 72
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1159898	1161374	6097032		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_014228053.1|1159898_1161374_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	1.7e-46
>prophage 73
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1166645	1167119	6097032		Burkholderia_phage(100.0%)	1	NA	NA
WP_032693194.1|1166645_1167119_-	hypothetical protein	NA	K4NX96	Burkholderia_phage	34.4	2.8e-19
>prophage 74
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1183791	1188662	6097032		Catovirus(50.0%)	5	NA	NA
WP_014837504.1|1183791_1185324_-	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	35.0	1.4e-67
WP_014837505.1|1185334_1186210_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014837506.1|1186240_1186921_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014837507.1|1186923_1187568_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014837508.1|1187564_1188662_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.2	1.0e-08
>prophage 75
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1200725	1214721	6097032	integrase	Enterobacteria_phage(80.0%)	13	1201599:1201615	1218269:1218285
WP_014837514.1|1200725_1203059_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.1	0.0e+00
1201599:1201615	attL	CAGCACCATAAACAGCG	NA	NA	NA	NA
WP_014837515.1|1203070_1203391_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_014837516.1|1203387_1203615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071886311.1|1203611_1204160_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	67.6	3.1e-30
WP_000556592.1|1204156_1204423_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_014837518.1|1204972_1205710_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.8	1.7e-71
WP_014837519.1|1205706_1205952_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.4e-19
WP_014837520.1|1205969_1206536_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	1.1e-57
WP_042934000.1|1207171_1207951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837523.1|1209488_1210658_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.5	1.4e-141
WP_014837524.1|1211010_1212264_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	2.2e-95
WP_004848066.1|1212274_1213378_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.2	2.4e-61
WP_004129421.1|1213668_1214721_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.2	1.3e-112
1218269:1218285	attR	CGCTGTTTATGGTGCTG	NA	NA	NA	NA
>prophage 76
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1219472	1220216	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_014837530.1|1219472_1220216_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	7.8e-32
>prophage 77
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1227400	1228243	6097032		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014837535.1|1227400_1228243_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.6	1.2e-12
>prophage 78
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1237488	1241613	6097032		Brazilian_cedratvirus(66.67%)	5	NA	NA
WP_014837542.1|1237488_1238307_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	2.3e-16
WP_004099328.1|1238320_1239130_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004129481.1|1239852_1240035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004848112.1|1240142_1240838_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	8.1e-07
WP_014228113.1|1240830_1241613_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.7	5.1e-10
>prophage 79
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1253005	1254052	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_014228120.1|1253005_1254052_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	8.9e-34
>prophage 80
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1262108	1262876	6097032		Planktothrix_phage(100.0%)	1	NA	NA
WP_004848135.1|1262108_1262876_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	1.5e-25
>prophage 81
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1287265	1296486	6097032		Bacillus_phage(60.0%)	7	NA	NA
WP_004099396.1|1287265_1288177_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.9	4.2e-104
WP_014837564.1|1288267_1289173_+	fructokinase	NA	NA	NA	NA	NA
WP_014228145.1|1289221_1289584_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_014837565.1|1289873_1293008_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	4.9e-11
WP_014228147.1|1293004_1294207_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	34.7	6.3e-07
WP_004099401.1|1294485_1295175_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
WP_004848171.1|1295196_1296486_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	27.9	1.0e-26
>prophage 82
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1312952	1317901	6097032	transposase,tRNA	uncultured_Mediterranean_phage(75.0%)	5	NA	NA
WP_004129667.1|1312952_1314080_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.6	1.5e-90
WP_004099423.1|1314102_1314435_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_071886312.1|1314462_1316310_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004848195.1|1316320_1317292_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	7.2e-46
WP_014228411.1|1317466_1317901_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
>prophage 83
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1322932	1324600	6097032		Indivirus(50.0%)	2	NA	NA
WP_014837576.1|1322932_1324036_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	4.2e-50
WP_004129690.1|1324129_1324600_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
>prophage 84
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1341611	1343315	6097032		Lactobacillus_phage(100.0%)	1	NA	NA
WP_014837584.1|1341611_1343315_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	27.1	3.7e-21
>prophage 85
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1358472	1363522	6097032	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_003021624.1|1358472_1359096_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_004099538.1|1359228_1360503_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.1	2.8e-130
WP_004099539.1|1360686_1363041_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	1.0e-223
WP_002444653.1|1363249_1363522_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 86
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1366873	1367569	6097032		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_014228183.1|1366873_1367569_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.4e-88
>prophage 87
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1371996	1375540	6097032		Bacillus_phage(100.0%)	2	NA	NA
WP_014837594.1|1371996_1373769_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	1.3e-48
WP_014837595.1|1373761_1375540_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	4.9e-40
>prophage 88
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1386921	1388031	6097032		Planktothrix_phage(100.0%)	1	NA	NA
WP_004848307.1|1386921_1388031_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.0e-24
>prophage 89
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1397183	1406570	6097032		Enterobacteria_phage(33.33%)	10	NA	NA
WP_014837605.1|1397183_1398257_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	40.8	4.5e-65
WP_004848323.1|1398369_1398633_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003859006.1|1398632_1398773_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_014228203.1|1398769_1399468_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014837606.1|1399569_1401024_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	6.9e-16
WP_014228205.1|1400998_1401469_-	YlaC family protein	NA	NA	NA	NA	NA
WP_014837607.1|1401595_1402162_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_004099646.1|1402324_1402543_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004129911.1|1402569_1402944_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_014228207.1|1403423_1406570_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	3.5e-49
>prophage 90
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1412086	1419933	6097032	transposase	Sodalis_phage(25.0%)	9	NA	NA
WP_014837608.1|1412086_1413022_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.6	4.3e-64
WP_014228211.1|1413088_1413262_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_004848351.1|1413276_1413804_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_004848353.1|1413873_1414251_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_004099669.1|1414401_1414953_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.3e-28
WP_042934011.1|1415044_1416952_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	1.3e-43
WP_004099673.1|1417009_1417342_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004129946.1|1417341_1417947_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_009653565.1|1418058_1419933_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.3	5.6e-111
>prophage 91
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1434350	1438177	6097032		Pteropox_virus(50.0%)	2	NA	NA
WP_014837615.1|1434350_1435601_+	phospholipase	NA	A0A1B1MR92	Pteropox_virus	22.4	4.1e-25
WP_014837616.1|1435675_1438177_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	5.0e-115
>prophage 92
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1443075	1443756	6097032		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004848402.1|1443075_1443756_+	iron ABC transporter ATP-binding protein FetA	NA	F2Y165	Organic_Lake_phycodnavirus	31.3	2.7e-15
>prophage 93
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1446942	1447629	6097032		Planktothrix_phage(100.0%)	1	NA	NA
WP_014228231.1|1446942_1447629_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	7.6e-34
>prophage 94
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1456482	1525579	6097032	terminase,tRNA,tail,integrase,holin	Salmonella_phage(18.31%)	93	1503932:1503951	1526879:1526898
WP_004848430.1|1456482_1457868_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	1.0e-45
WP_004099787.1|1458162_1458375_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004099791.1|1458376_1459243_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
WP_004223135.1|1460715_1461051_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_042934012.1|1461063_1461303_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	3.9e-09
WP_032419565.1|1461302_1461521_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	58.6	3.3e-15
WP_023304908.1|1461522_1461741_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.6e-09
WP_014837627.1|1461737_1462505_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.2	1.4e-65
WP_014837628.1|1462501_1463029_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	5.5e-56
WP_071886314.1|1463025_1463184_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.0	8.7e-10
WP_040218321.1|1463180_1463804_-	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	48.1	1.3e-45
WP_014342891.1|1463800_1464136_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	34.3	1.3e-10
WP_162140788.1|1464105_1464303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934013.1|1464544_1464829_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	61.7	2.3e-29
WP_014837629.1|1464836_1465808_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	91.0	1.8e-65
WP_008807814.1|1465887_1466094_-	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_004219883.1|1466086_1466212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038989578.1|1466760_1467537_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_038989577.1|1467524_1468067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024622727.1|1468358_1469048_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_004178811.1|1469152_1469386_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_004141720.1|1469425_1469746_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_042934285.1|1469880_1470609_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	1.6e-37
WP_014837634.1|1470605_1471382_+	Origin specific replication-binding factor	NA	A0A193GYX1	Enterobacter_phage	65.4	3.0e-95
WP_014837636.1|1471680_1472121_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.8	4.9e-10
WP_042934014.1|1472117_1472393_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	76.2	3.5e-30
WP_014837640.1|1473203_1473716_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	74.9	6.2e-73
WP_014837641.1|1474521_1474710_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	80.0	1.0e-20
WP_014837643.1|1474963_1475431_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.2	9.8e-33
WP_004243010.1|1475411_1475579_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_014837644.1|1475575_1476247_+	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	71.6	7.3e-98
WP_042934015.1|1476239_1476821_+	recombination protein NinG	NA	E7C9S3	Salmonella_phage	49.8	2.1e-40
WP_014837646.1|1476817_1476958_+	YlcG family protein	NA	NA	NA	NA	NA
WP_042934016.1|1476954_1477452_+	antiterminator	NA	G8C7V7	Escherichia_phage	92.7	1.9e-87
WP_031280382.1|1478266_1478566_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_014837648.1|1478562_1479105_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	78.1	3.1e-78
WP_014837649.1|1479101_1479278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019705419.1|1479357_1479573_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	54.3	2.0e-12
WP_042934018.1|1479776_1480553_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	62.3	3.5e-11
WP_014837651.1|1480503_1481904_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.8	2.3e-186
WP_042934019.1|1482141_1483593_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.1	2.5e-191
WP_042934020.1|1483648_1484197_+	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	54.6	2.6e-48
WP_014837655.1|1484458_1485658_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.6	9.4e-104
WP_014837656.1|1485669_1486164_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	64.4	4.2e-50
WP_014837657.1|1486175_1487117_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	76.8	5.4e-139
WP_014837658.1|1487162_1487423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934022.1|1487391_1487808_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	1.4e-38
WP_014837660.1|1487807_1488308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837661.1|1488307_1488694_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	76.6	2.6e-47
WP_014837662.1|1488788_1489229_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	52.4	3.0e-39
WP_014837663.1|1489232_1490378_+	DUF3383 family protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.6	1.9e-162
WP_004199809.1|1490388_1490829_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_014837664.1|1490832_1491258_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	64.2	1.5e-40
WP_004152565.1|1491293_1491446_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_014837665.1|1491435_1493361_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	73.5	1.1e-189
WP_042934023.1|1493360_1493951_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	64.1	5.9e-59
WP_162140800.1|1494026_1494254_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	54.7	1.3e-19
WP_014837668.1|1494256_1495288_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	53.4	6.6e-98
WP_014837669.1|1495388_1495622_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	51.3	2.9e-17
WP_014837670.1|1496040_1496697_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	58.0	1.6e-68
WP_014837671.1|1496693_1497047_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	78.6	3.3e-49
WP_042934024.1|1497046_1498246_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	74.4	8.4e-161
WP_042934025.1|1498242_1499016_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	50.2	3.8e-66
WP_042934026.1|1499015_1499801_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.3	1.4e-26
WP_042934027.1|1499800_1500379_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	50.3	2.1e-48
WP_014837674.1|1500402_1502688_+	hypothetical protein	NA	A0A2P0ZZ83	Klebsiella_phage	36.2	4.4e-102
WP_009308066.1|1502697_1502955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934028.1|1503318_1503639_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.0	7.7e-21
1503932:1503951	attL	TGGGGGTACATTTGGGGGTA	NA	NA	NA	NA
WP_042934029.1|1503984_1505199_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	52.8	2.6e-125
WP_014837677.1|1505342_1506275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029602956.1|1506386_1506599_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	47.2	3.2e-07
WP_042934030.1|1506598_1507030_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.2	5.3e-25
WP_042934031.1|1507043_1507646_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	55.3	1.2e-51
WP_014837681.1|1507645_1507825_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_014837682.1|1507821_1508781_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	44.3	3.8e-07
WP_042934032.1|1508777_1509281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934033.1|1509277_1509487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934034.1|1509483_1510110_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.5	1.4e-26
WP_014837686.1|1510119_1510470_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	68.2	8.9e-39
WP_014837687.1|1510462_1513219_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	55.3	2.9e-289
WP_071886316.1|1513402_1513846_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_014837689.1|1513866_1514844_+	helix-turn-helix domain-containing protein	NA	F1C596	Cronobacter_phage	56.7	1.1e-83
WP_014837690.1|1514875_1515733_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	40.5	1.4e-40
WP_042934035.1|1515986_1516085_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_014837691.1|1516613_1516940_+	hypothetical protein	NA	M1PRT9	Cellulophaga_phage	77.7	1.8e-33
WP_014837692.1|1517073_1517259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837693.1|1517724_1518864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934036.1|1519030_1519201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213174.1|1519200_1519527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837694.1|1519534_1522525_+|tail	phage tail length tape-measure protein 1	tail	F1C5E9	Cronobacter_phage	33.3	1.1e-73
WP_042934037.1|1523067_1523439_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	52.9	1.8e-29
WP_014837696.1|1524942_1525140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837697.1|1525147_1525579_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	65.7	6.0e-45
1526879:1526898	attR	TGGGGGTACATTTGGGGGTA	NA	NA	NA	NA
>prophage 95
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1531984	1532860	6097032		Burkholderia_virus(100.0%)	1	NA	NA
WP_014837703.1|1531984_1532860_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.9	1.6e-20
>prophage 96
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1539639	1544682	6097032	tRNA	Acinetobacter_phage(33.33%)	4	NA	NA
WP_014837706.1|1539639_1541115_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.5	3.8e-46
WP_004848495.1|1541456_1542974_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	2.5e-85
WP_042934041.1|1543134_1543539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228247.1|1543806_1544682_-	class A extended-spectrum beta-lactamase OXY-1-1	NA	A0A1B0VBP7	Salmonella_phage	74.6	3.1e-112
>prophage 97
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1549449	1550934	6097032		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_014837712.1|1549449_1550934_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	21.2	5.7e-10
>prophage 98
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1558279	1559680	6097032		Bacillus_phage(100.0%)	1	NA	NA
WP_014837717.1|1558279_1559680_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.1	2.3e-16
>prophage 99
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1564075	1564867	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_014837719.1|1564075_1564867_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.7	2.7e-14
>prophage 100
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1580295	1581045	6097032		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_014837727.1|1580295_1581045_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.2	1.3e-18
>prophage 101
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1603010	1606541	6097032	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_014837737.1|1603010_1605323_+	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	36.0	3.7e-40
WP_001339175.1|1605332_1606541_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	2.3e-235
>prophage 102
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1627328	1630052	6097032		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_014228313.1|1627328_1630052_+	cation-transporting P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	27.2	1.2e-66
>prophage 103
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1640696	1642740	6097032		Bacillus_virus(50.0%)	2	NA	NA
WP_004848592.1|1640696_1641740_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	6.0e-14
WP_014228320.1|1641729_1642740_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.3e-16
>prophage 104
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1648089	1649556	6097032		Streptococcus_phage(100.0%)	1	NA	NA
WP_014228326.1|1648089_1649556_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	22.0	1.8e-16
>prophage 105
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1655701	1657229	6097032		Planktothrix_phage(100.0%)	2	NA	NA
WP_014837756.1|1655701_1656406_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	3.1e-22
WP_014837757.1|1656392_1657229_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	6.9e-13
>prophage 106
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1661793	1667711	6097032	holin	Catovirus(50.0%)	4	NA	NA
WP_014837759.1|1661793_1663458_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
WP_014837760.1|1663472_1664945_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014228339.1|1664955_1665549_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_014837761.1|1665677_1667711_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.1	7.6e-21
>prophage 107
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1671176	1672721	6097032		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_014228343.1|1671176_1672721_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	3.1e-14
>prophage 108
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1684269	1689169	6097032		Tupanvirus(50.0%)	2	NA	NA
WP_014837772.1|1684269_1688151_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.0	4.0e-55
WP_014837773.1|1688374_1689169_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	25.6	9.9e-09
>prophage 109
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1693059	1695177	6097032		Plodia_interpunctella_granulovirus(100.0%)	1	NA	NA
WP_014837774.1|1693059_1695177_-	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	2.4e-33
>prophage 110
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1704242	1707859	6097032		Burkholderia_phage(50.0%)	4	NA	NA
WP_014837782.1|1704242_1704647_-	helix-turn-helix domain-containing protein	NA	A0A1S5NNJ5	Burkholderia_phage	33.3	6.1e-07
WP_071886318.1|1704627_1704921_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014837783.1|1705107_1706196_-	oxidoreductase	NA	NA	NA	NA	NA
WP_014228366.1|1706356_1707859_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	1.3e-14
>prophage 111
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1725429	1744091	6097032		Cedratvirus(14.29%)	16	NA	NA
WP_004848726.1|1725429_1726458_+	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.1	1.7e-29
WP_014837794.1|1726496_1727441_-	sugar kinase	NA	NA	NA	NA	NA
WP_014837795.1|1727452_1728454_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014837796.1|1728453_1729440_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047725149.1|1729436_1730942_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	6.6e-14
WP_014837797.1|1730986_1731967_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014837798.1|1732505_1734815_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.1	3.9e-82
WP_014837799.1|1734998_1735541_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_014837800.1|1735537_1736227_-	acireductone synthase	NA	NA	NA	NA	NA
WP_160742792.1|1736421_1737567_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014228387.1|1737567_1738197_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.3	2.0e-52
WP_014837801.1|1738181_1739405_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.1	4.5e-61
WP_014228389.1|1739509_1740421_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002894394.1|1741287_1741851_+	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_004848755.1|1742020_1743586_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
WP_004100140.1|1743662_1744091_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.5e-19
>prophage 112
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1748178	1749716	6097032		Morganella_phage(33.33%)	3	NA	NA
WP_004100146.1|1748178_1748388_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.6	4.5e-22
WP_014228394.1|1748452_1748836_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	8.9e-24
WP_014837805.1|1748927_1749716_+	deaminated glutathione amidase	NA	M1HKP1	Paramecium_bursaria_Chlorella_virus	24.2	2.8e-08
>prophage 113
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1753632	1756076	6097032		Stx2-converting_phage(50.0%)	2	NA	NA
WP_014228398.1|1753632_1754832_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.7	1.4e-104
WP_014837807.1|1754975_1756076_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.0e-08
>prophage 114
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1763092	1771190	6097032	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
WP_014228403.1|1763092_1765675_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.1	1.2e-188
WP_014228404.1|1765901_1766384_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_014837810.1|1766583_1768371_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.2	6.2e-27
WP_014837811.1|1768426_1770094_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004100186.1|1770464_1771190_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.7e-28
>prophage 115
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1777038	1778085	6097032		Pseudomonas_phage(100.0%)	1	NA	NA
WP_014837814.1|1777038_1778085_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	8.3e-48
>prophage 116
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1782152	1783814	6097032		Ostreococcus_mediterraneus_virus(100.0%)	1	NA	NA
WP_014228410.1|1782152_1783814_-	asparagine synthase B	NA	A0A0P0C0R1	Ostreococcus_mediterraneus_virus	39.7	7.9e-85
>prophage 117
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1788441	1798393	6097032	tRNA	Vibrio_phage(25.0%)	7	NA	NA
WP_014228414.1|1788441_1790394_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	3.2e-08
WP_014228415.1|1790572_1792240_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	92.4	1.3e-310
WP_004130464.1|1792678_1794082_+	chitoporin	NA	NA	NA	NA	NA
WP_004848843.1|1794128_1794461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228416.1|1794513_1795809_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.5	1.8e-60
WP_014837817.1|1795863_1797003_-	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_014837818.1|1796989_1798393_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.4	1.0e-08
>prophage 118
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1801397	1802171	6097032		Mycobacterium_phage(100.0%)	1	NA	NA
WP_014837821.1|1801397_1802171_-	esterase	NA	W0LK50	Mycobacterium_phage	38.0	5.3e-07
>prophage 119
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1808612	1810097	6097032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004848870.1|1808612_1810097_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	2.5e-21
>prophage 120
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1818364	1825855	6097032		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_014837833.1|1818364_1820413_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.9	5.5e-27
WP_014837834.1|1820434_1822114_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_009651669.1|1822113_1822203_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_004848892.1|1822512_1822719_+	DUF2517 family protein	NA	NA	NA	NA	NA
WP_014837835.1|1822962_1824411_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1K1	Organic_Lake_phycodnavirus	32.6	8.0e-57
WP_014228435.1|1824373_1825855_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.0	1.3e-46
>prophage 121
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1831651	1832443	6097032		Kaumoebavirus(100.0%)	1	NA	NA
WP_014837838.1|1831651_1832443_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.1	7.5e-09
>prophage 122
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1871592	1875109	6097032		Vibriophage(33.33%)	4	NA	NA
WP_014228459.1|1871592_1872312_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	33.0	2.9e-23
WP_014228460.1|1872308_1873253_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.8	5.2e-25
WP_014228461.1|1873370_1873742_-	YbgS-like family protein	NA	NA	NA	NA	NA
WP_014228462.1|1874056_1875109_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.6	1.8e-82
>prophage 123
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1879429	1885956	6097032		Tupanvirus(33.33%)	7	NA	NA
WP_004130603.1|1879429_1880446_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	7.5e-78
WP_014837851.1|1880657_1882127_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	30.7	7.4e-10
WP_004848991.1|1882194_1882983_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_004848993.1|1883136_1883286_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_014228467.1|1883432_1884206_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004848997.1|1884205_1884895_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014228468.1|1884897_1885956_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.8	3.1e-18
>prophage 124
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1893129	1893861	6097032		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014228475.1|1893129_1893861_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.8	1.7e-52
>prophage 125
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1900626	1905579	6097032		Catovirus(50.0%)	3	NA	NA
WP_014228482.1|1900626_1902150_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.8	2.4e-80
WP_009653774.1|1903743_1904220_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_032694541.1|1904289_1905579_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	5.0e-18
>prophage 126
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1909254	1909977	6097032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014228488.1|1909254_1909977_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	8.1e-10
>prophage 127
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1916541	1917447	6097032		Streptococcus_phage(100.0%)	1	NA	NA
WP_014228492.1|1916541_1917447_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.7	3.1e-27
>prophage 128
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1927230	1928970	6097032		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_014837869.1|1927230_1928970_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	1.5e-17
>prophage 129
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1934114	1942651	6097032		Micromonas_pusilla_virus(20.0%)	8	NA	NA
WP_014228507.1|1934114_1934960_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	31.6	6.4e-06
WP_014837873.1|1934959_1935952_+	transketolase family protein	NA	NA	NA	NA	NA
WP_004849082.1|1936253_1937603_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.5	1.0e-45
WP_014228509.1|1937803_1939948_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	2.0e-43
WP_014837874.1|1939990_1940959_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_004130722.1|1941093_1941354_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004130731.1|1941638_1941905_-	DksA/TraR family C4-type zinc finger protein	NA	A0A0A0PZH0	Pectobacterium_bacteriophage	57.3	9.5e-17
WP_004849092.1|1941973_1942651_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	31.0	3.4e-18
>prophage 130
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1953947	1959051	6097032		Planktothrix_phage(33.33%)	6	NA	NA
WP_004849106.1|1953947_1954670_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	1.5e-35
WP_004100490.1|1954666_1955326_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_004849110.1|1955459_1956206_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_004130751.1|1956577_1957081_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.6	1.9e-05
WP_004100495.1|1957299_1958187_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_004130755.1|1958538_1959051_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	31.3	2.3e-14
>prophage 131
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1962961	1970015	6097032		Klosneuvirus(33.33%)	6	NA	NA
WP_014228519.1|1962961_1963996_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	35.0	1.0e-05
WP_014837878.1|1964152_1965529_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	24.0	8.4e-24
WP_014228521.1|1965599_1966316_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004130773.1|1966357_1967272_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_014837879.1|1967462_1968245_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_004849135.1|1968422_1970015_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	8.5e-60
>prophage 132
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1978376	1980809	6097032		Citrobacter_phage(100.0%)	1	NA	NA
WP_014837885.1|1978376_1980809_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	42.0	1.0e-08
>prophage 133
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1984987	1986841	6097032		Planktothrix_phage(100.0%)	1	NA	NA
WP_014837890.1|1984987_1986841_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	4.1e-13
>prophage 134
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	1996515	2075038	6097032	transposase,holin,integrase,terminase	Escherichia_phage(34.15%)	90	2044261:2044320	2056609:2057431
WP_014837894.1|1996515_1997802_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	54.2	4.8e-122
WP_004111685.1|1997801_1998017_-	excisionase family protein	NA	NA	NA	NA	NA
WP_014837895.1|1998104_1998449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064404689.1|1998445_1998670_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	58.1	6.8e-16
WP_123828190.1|1998712_1998946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025108072.1|1999011_1999305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025108070.1|1999895_2000300_-	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	54.9	1.2e-13
WP_009653783.1|2000379_2000607_+	transcriptional regulator	NA	K7PHK4	Enterobacteria_phage	44.3	1.4e-08
WP_009653775.1|2000590_2001016_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_071886321.1|2001029_2001284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009653780.1|2001280_2002357_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	42.6	4.7e-30
WP_014837897.1|2002369_2002627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029946971.1|2002686_2002905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004111726.1|2003342_2003636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837900.1|2004415_2004598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025108065.1|2004764_2005358_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	48.5	3.9e-42
WP_014837902.1|2005354_2006251_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	73.4	7.7e-127
WP_014837903.1|2006243_2008226_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.9	2.8e-193
WP_089046440.1|2008222_2008363_+	YlcG family protein	NA	NA	NA	NA	NA
WP_025108063.1|2008359_2008968_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	60.2	1.5e-70
WP_031280382.1|2009680_2009980_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_004849279.1|2009976_2010519_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	76.4	2.0e-77
WP_014837905.1|2010515_2010860_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	82.5	4.5e-43
WP_014837906.1|2010856_2011132_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	35.6	3.0e-05
WP_014837907.1|2011367_2011652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837908.1|2011790_2012084_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	73.2	4.0e-32
WP_014228564.1|2012208_2012394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837909.1|2012544_2012745_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	1.0e-18
WP_042934307.1|2012811_2013183_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	76.3	2.4e-50
WP_014837910.1|2013186_2014158_+|terminase	terminase small subunit	terminase	Q6J1S5	Burkholderia_virus	38.5	5.6e-30
WP_014837911.1|2014159_2015752_+|terminase	phage terminase	terminase	Q775B9	Bordetella_phage	40.4	8.7e-97
WP_014837912.1|2015752_2015974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113705927.1|2015970_2017587_+	hypothetical protein	NA	A0A1B1ITN4	uncultured_Mediterranean_phage	29.0	5.8e-56
WP_014837914.1|2017583_2017877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837915.1|2017912_2018878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837916.1|2019015_2019867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837917.1|2019877_2020144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837918.1|2020192_2020618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934047.1|2020617_2021244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837920.1|2021252_2023937_+	hypothetical protein	NA	A0A2I7RHD1	Vibrio_phage	26.5	7.4e-24
WP_049824817.1|2023926_2024370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049824818.1|2024344_2025160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934310.1|2025694_2027779_+	transglycosylase SLT domain-containing protein	NA	T1SBJ1	Salmonella_phage	48.1	1.6e-106
WP_014837924.1|2027775_2029584_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	70.9	2.2e-237
WP_014837925.1|2029587_2032062_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	86.2	0.0e+00
WP_042928472.1|2032065_2032371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654380.1|2032452_2032605_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	77.6	6.9e-12
WP_001067855.1|2033767_2034472_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|2034532_2035369_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001145207.1|2035368_2036127_-	APH(3'') family aminoglycoside O-phosphotransferase	NA	Q75ZG1	Hepacivirus	34.4	6.7e-23
WP_001043265.1|2036231_2037047_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|2037353_2038205_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|2038960_2039665_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014837927.1|2039701_2040829_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|2040879_2041107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|2041130_2041322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|2041803_2042346_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|2042358_2043219_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
2044261:2044320	attL	TCCGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACA	NA	NA	NA	NA
WP_001067855.1|2044315_2045020_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032152941.1|2045271_2045562_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|2045598_2046303_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|2046377_2047391_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|2047548_2048022_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
WP_000503573.1|2048152_2048941_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|2049146_2049494_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|2049487_2050327_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376616.1|2050454_2050658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|2050812_2052018_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|2052028_2052334_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|2052560_2053325_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|2053817_2054402_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|2054401_2055640_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|2055636_2056542_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|2056663_2057368_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|2058592_2059261_-	EAL domain-containing protein	NA	NA	NA	NA	NA
2056609:2057431	attR	TCCGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_000993386.1|2059296_2059533_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_014837931.1|2059529_2059892_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|2059909_2061604_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|2061655_2062078_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732293.1|2062113_2062389_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|2062402_2062753_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|2062824_2063259_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_029676039.1|2064352_2065000_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	99.5	3.8e-128
WP_000656305.1|2065200_2065578_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014837933.1|2068365_2069070_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_024220179.1|2069667_2070522_-	TEM family class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	99.6	1.1e-159
WP_001067855.1|2071112_2071817_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_042934048.1|2072172_2072589_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	48.4	1.2e-26
WP_038423245.1|2073048_2074251_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	2.7e-95
WP_004849345.1|2074279_2075038_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	2.0e-11
>prophage 135
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2082601	2094127	6097032		Bacillus_phage(33.33%)	13	NA	NA
WP_004100567.1|2082601_2082865_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	1.6e-27
WP_009653259.1|2083069_2083360_+	YbjC family protein	NA	NA	NA	NA	NA
WP_014228599.1|2083343_2084066_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_009653278.1|2084169_2085072_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	2.0e-34
WP_014837937.1|2085161_2085641_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_014837938.1|2085989_2087102_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_004134592.1|2087204_2088338_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	7.7e-31
WP_014228601.1|2088348_2089302_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004130847.1|2089298_2090144_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_004100588.1|2090201_2090690_+	YbjO family protein	NA	NA	NA	NA	NA
WP_014837939.1|2090732_2091863_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.2	2.8e-25
WP_004849381.1|2091941_2092658_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	1.1e-35
WP_014837940.1|2092654_2094127_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.4	7.4e-26
>prophage 136
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2097386	2100126	6097032		Planktothrix_phage(50.0%)	4	NA	NA
WP_004111834.1|2097386_2098115_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-29
WP_014837942.1|2098342_2098858_-	lipoprotein	NA	NA	NA	NA	NA
WP_004100606.1|2098975_2099299_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014837943.1|2099295_2100126_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	28.9	8.2e-06
>prophage 137
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2114002	2125153	6097032	protease,tRNA	Planktothrix_phage(14.29%)	9	NA	NA
WP_014837948.1|2114002_2115949_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	38.7	1.2e-36
WP_004100627.1|2116017_2116248_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.4e-16
WP_004100628.1|2116572_2116890_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.4e-13
WP_014837949.1|2116920_2119203_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	2.1e-165
WP_002211347.1|2119340_2119559_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_009653303.1|2119838_2120543_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_014837950.1|2120581_2122303_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	2.4e-15
WP_014228628.1|2122303_2124070_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	7.0e-23
WP_004849433.1|2124184_2125153_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.6e-61
>prophage 138
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2131103	2137097	6097032	tRNA	Escherichia_phage(50.0%)	4	NA	NA
WP_004849446.1|2131103_2132447_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.7	7.8e-83
WP_009653254.1|2132538_2133831_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	3.6e-93
WP_014837951.1|2134030_2136469_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	8.0e-219
WP_009653301.1|2136479_2137097_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	3.4e-73
>prophage 139
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2144228	2147455	6097032		Tetraselmis_virus(100.0%)	2	NA	NA
WP_004871674.1|2144228_2144969_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.8e-20
WP_014228637.1|2145172_2147455_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	1.9e-161
>prophage 140
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2151503	2152592	6097032		Streptococcus_phage(100.0%)	1	NA	NA
WP_004849472.1|2151503_2152592_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 141
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2156885	2161438	6097032		Bacillus_phage(100.0%)	3	NA	NA
WP_004100704.1|2156885_2157173_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
WP_014837960.1|2157388_2159644_+	ComEC family protein	NA	NA	NA	NA	NA
WP_004849478.1|2159689_2161438_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	5.1e-58
>prophage 142
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2177472	2187743	6097032	transposase,tRNA	Clostridium_botulinum_C_phage(16.67%)	7	NA	NA
WP_014228411.1|2177472_2177907_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
WP_014228652.1|2178000_2179191_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_014228653.1|2179378_2180464_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.0	1.5e-100
WP_004849497.1|2181054_2182455_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.0	5.0e-80
WP_025107499.1|2182758_2183961_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.1	6.4e-44
WP_014837970.1|2184288_2186904_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_014837971.1|2186969_2187743_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	8.1e-32
>prophage 143
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2194455	2196363	6097032		Tupanvirus(100.0%)	1	NA	NA
WP_014837974.1|2194455_2196363_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	7.3e-50
>prophage 144
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2209138	2211193	6097032		Bacillus_phage(100.0%)	1	NA	NA
WP_014228667.1|2209138_2211193_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.2	2.7e-18
>prophage 145
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2226263	2228411	6097032		Bacillus_phage(100.0%)	1	NA	NA
WP_004849540.1|2226263_2228411_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	1.6e-24
>prophage 146
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2238985	2239645	6097032	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004100829.1|2238985_2239645_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	3.8e-46
>prophage 147
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2258086	2258827	6097032		Planktothrix_phage(100.0%)	1	NA	NA
WP_004849580.1|2258086_2258827_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	4.7e-29
>prophage 148
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2282155	2282935	6097032		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014228719.1|2282155_2282935_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	1.9e-17
>prophage 149
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2301752	2308372	6097032		Morganella_phage(50.0%)	5	NA	NA
WP_004849644.1|2301752_2301965_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	77.1	8.4e-24
WP_004849645.1|2302626_2302848_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	56.5	6.7e-16
WP_014228737.1|2303484_2306604_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.6	6.1e-46
WP_014838032.1|2306922_2307309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131145.1|2307667_2308372_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	5.3e-30
>prophage 150
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2322400	2323429	6097032		Bacillus_phage(100.0%)	1	NA	NA
WP_014228752.1|2322400_2323429_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.4	5.2e-18
>prophage 151
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2328301	2329684	6097032		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014228757.1|2328301_2329684_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.0	5.7e-20
>prophage 152
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2343174	2343915	6097032		Planktothrix_phage(100.0%)	1	NA	NA
WP_014228772.1|2343174_2343915_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	6.7e-36
>prophage 153
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2351347	2352262	6097032		Bacillus_phage(100.0%)	1	NA	NA
WP_014838049.1|2351347_2352262_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.1	4.8e-15
>prophage 154
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2355439	2362017	6097032		Serratia_phage(50.0%)	4	NA	NA
WP_014838051.1|2355439_2357737_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	44.2	5.0e-05
WP_004100938.1|2357788_2358109_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_004131253.1|2358129_2359206_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_014838052.1|2359515_2362017_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.9	6.1e-12
>prophage 155
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2376607	2378855	6097032		Enterobacteria_phage(100.0%)	3	NA	NA
WP_004131287.1|2376607_2376781_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	88.9	3.2e-05
WP_009653397.1|2377016_2378339_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	1.2e-200
WP_014838059.1|2378360_2378855_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	78.1	3.3e-39
>prophage 156
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2395754	2398609	6097032		Cronobacter_phage(50.0%)	4	NA	NA
WP_014228807.1|2395754_2396543_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	1.9e-92
WP_014838068.1|2396593_2396887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838069.1|2397002_2397791_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_014228810.1|2397913_2398609_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.8	1.2e-26
>prophage 157
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2411580	2412135	6097032		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_014228822.1|2411580_2412135_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.6	5.1e-28
>prophage 158
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2420504	2421425	6097032		Morganella_phage(100.0%)	1	NA	NA
WP_004849864.1|2420504_2421425_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	42.4	1.3e-57
>prophage 159
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2424655	2424901	6097032		Salmonella_phage(100.0%)	1	NA	NA
WP_004101040.1|2424655_2424901_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	47.4	7.7e-13
>prophage 160
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2446140	2447322	6097032		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_014838089.1|2446140_2446875_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	35.0	1.0e-15
WP_000103754.1|2447085_2447322_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 161
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2450622	2451264	6097032		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004849914.1|2450622_2451264_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	5.9e-28
>prophage 162
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2467034	2467292	6097032		Erwinia_phage(100.0%)	1	NA	NA
WP_004131427.1|2467034_2467292_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	3.6e-05
>prophage 163
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2473582	2477333	6097032		Planktothrix_phage(50.0%)	4	NA	NA
WP_014228855.1|2473582_2474284_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.3	5.4e-35
WP_014228856.1|2474283_2475528_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_014228857.1|2475576_2476488_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_014838101.1|2476502_2477333_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	2.8e-22
>prophage 164
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2484437	2485388	6097032		Cyanophage(100.0%)	1	NA	NA
WP_014228865.1|2484437_2485388_+	transaldolase	NA	A0A127KMN5	Cyanophage	35.1	1.6e-13
>prophage 165
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2490742	2491879	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_014228869.1|2490742_2491879_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.6	1.3e-30
>prophage 166
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2498662	2586717	6097032	capsid,terminase,tRNA,portal,tail,integrase,protease,holin,head	Klebsiella_phage(16.95%)	104	2497799:2497816	2579897:2579914
2497799:2497816	attL	CCAGCGCCGCCGCGCCCC	NA	NA	NA	NA
WP_014838107.1|2498662_2500033_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	2.1e-107
WP_004131471.1|2500036_2500678_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004849976.1|2500737_2501844_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_014838108.1|2501882_2502359_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_014838109.1|2502368_2503031_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_014228876.1|2503267_2504518_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_008806033.1|2504630_2505773_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	81.9	1.2e-172
WP_008806034.1|2505762_2505999_-	excisionase	NA	NA	NA	NA	NA
WP_040235764.1|2506299_2506536_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.9e-09
WP_014838111.1|2506528_2507080_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	46.0	7.0e-30
WP_042934056.1|2507076_2507304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934057.1|2507731_2508076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838115.1|2508203_2508989_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	4.5e-62
WP_023343167.1|2508981_2509182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934058.1|2509181_2509709_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	70.9	9.3e-64
WP_014838117.1|2509844_2510675_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	82.4	9.3e-127
WP_014838118.1|2510727_2511099_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	80.5	4.8e-51
WP_087855718.1|2511915_2512431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038808210.1|2512703_2513336_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	6.0e-33
WP_025714631.1|2513433_2513664_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	51.6	2.7e-12
WP_014838120.1|2513897_2514365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838121.1|2514445_2514994_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	66.9	3.0e-65
WP_023322342.1|2515166_2515346_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
WP_014838122.1|2515335_2516247_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	75.2	9.8e-53
WP_038808205.1|2516243_2516702_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_193366223.1|2516722_2518072_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.4	7.3e-105
WP_042934060.1|2518064_2520047_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.1	4.4e-199
WP_014838125.1|2520043_2520520_+|protease	SOS-response repressor and protease LexA	protease	NA	NA	NA	NA
WP_042934062.1|2520516_2520915_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	70.6	1.2e-44
WP_049824822.1|2521004_2521826_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.8	1.8e-90
WP_014838127.1|2521907_2522894_+	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	48.9	1.5e-91
WP_042934063.1|2522912_2523743_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	47.2	1.7e-59
WP_023343183.1|2523952_2524144_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	81.0	2.1e-21
WP_014838128.1|2524293_2525346_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	76.9	2.8e-168
WP_130951362.1|2525767_2526346_+	SocA family protein	NA	A0A088CD78	Shigella_phage	62.5	6.3e-05
WP_049824823.1|2526342_2526822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838130.1|2526999_2527149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934064.1|2527409_2527799_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	78.1	1.2e-47
WP_042934065.1|2527788_2528067_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	77.8	1.4e-34
WP_014838132.1|2528156_2528696_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	2.6e-101
WP_042934066.1|2528692_2529040_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.0	4.0e-39
WP_014838134.1|2529036_2529312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014838135.1|2529861_2530107_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.2	2.3e-17
WP_014838136.1|2530430_2530772_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.9	1.3e-47
WP_014838137.1|2530889_2531354_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	6.3e-48
WP_077253184.1|2531307_2533044_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.9	1.1e-137
WP_042934068.1|2533050_2534370_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	59.3	1.2e-139
WP_014838140.1|2534345_2535053_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.0	6.4e-68
WP_014838141.1|2535062_2536283_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.8	1.2e-141
WP_014838142.1|2536328_2536583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032734570.1|2536588_2536921_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_042934069.1|2536933_2537272_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	66.1	2.1e-37
WP_014838144.1|2537268_2537718_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	5.1e-63
WP_014838145.1|2537714_2538062_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	58.4	1.5e-30
WP_014838146.1|2538118_2538829_+|tail	tail protein	tail	K7PHL2	Enterobacterial_phage	69.5	9.9e-85
WP_014838147.1|2538859_2539264_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.0	2.1e-31
WP_042934070.1|2539266_2539572_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.0	2.8e-28
WP_071886327.1|2539626_2539968_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	46.8	5.7e-06
WP_014838149.1|2540027_2543633_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	55.4	4.7e-207
WP_042934071.1|2543653_2544127_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.2	3.2e-55
WP_014838151.1|2544113_2544599_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	66.2	2.3e-53
WP_042934072.1|2544608_2544989_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	81.0	1.2e-57
WP_014838152.1|2544985_2548069_+	kinase	NA	A0A286S259	Klebsiella_phage	69.3	0.0e+00
WP_014838153.1|2548133_2550353_+	hypothetical protein	NA	A0A2P0ZZ83	Klebsiella_phage	36.6	9.5e-102
WP_042934074.1|2550362_2550620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934075.1|2550655_2550928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838154.1|2550937_2552929_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_014838155.1|2553019_2553568_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	89.5	1.8e-86
WP_031592310.1|2553697_2553940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838156.1|2553939_2554182_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	82.3	7.3e-32
WP_042934076.1|2554259_2554679_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	1.2e-34
WP_014838158.1|2554681_2555947_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.6	1.8e-209
WP_014838159.1|2556187_2557294_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_157872487.1|2557400_2557946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934078.1|2558764_2559178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838161.1|2559401_2559584_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.9	1.1e-19
WP_014838162.1|2559727_2561512_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	7.3e-20
WP_014228927.1|2561589_2562780_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_009653379.1|2563059_2564103_+	type II asparaginase	NA	NA	NA	NA	NA
WP_014838164.1|2564139_2564907_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	26.7	8.9e-15
WP_014838165.1|2564907_2565861_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_014228931.1|2565857_2566856_-	iron-dicitrate ABC transporter permease FecC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.1	5.4e-12
WP_014838166.1|2566852_2567755_-	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_032720060.1|2567813_2570150_-	TonB-dependent receptor family protein	NA	NA	NA	NA	NA
WP_014838168.1|2570248_2571196_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_014838169.1|2571192_2571714_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014228936.1|2571973_2572762_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_009653416.1|2573304_2574219_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	4.5e-74
WP_014838171.1|2574309_2574948_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004131510.1|2575077_2575341_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_086074258.1|2575389_2575515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100248259.1|2575655_2575730_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004101234.1|2575729_2575831_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_014838172.1|2575888_2576902_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_014228939.1|2577198_2577438_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_014228940.1|2577432_2577777_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_014228941.1|2577763_2578273_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014838173.1|2578435_2579128_+	CTP synthase	NA	NA	NA	NA	NA
WP_162140806.1|2580448_2581243_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
2579897:2579914	attR	CCAGCGCCGCCGCGCCCC	NA	NA	NA	NA
WP_004138309.1|2581226_2581673_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004850011.1|2581836_2582337_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_014838175.1|2582333_2583866_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.4	3.2e-08
WP_014228948.1|2584227_2585385_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014838177.1|2585433_2586717_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.6	2.9e-10
>prophage 167
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2590049	2590904	6097032		Indivirus(100.0%)	1	NA	NA
WP_014228950.1|2590049_2590904_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	25.3	3.2e-13
>prophage 168
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2594532	2595786	6097032		Tupanvirus(100.0%)	1	NA	NA
WP_014838180.1|2594532_2595786_-	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	28.0	2.6e-24
>prophage 169
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2601477	2605533	6097032		Staphylococcus_phage(50.0%)	3	NA	NA
WP_014838184.1|2601477_2602461_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.9	5.7e-06
WP_014228959.1|2602594_2603353_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_014228961.1|2604891_2605533_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	39.1	2.6e-20
>prophage 170
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2611479	2613435	6097032		Streptococcus_phage(100.0%)	1	NA	NA
WP_014228966.1|2611479_2613435_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.9	4.4e-42
>prophage 171
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2617668	2618301	6097032		Bacillus_phage(100.0%)	1	NA	NA
WP_014838191.1|2617668_2618301_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.4	6.9e-13
>prophage 172
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2624312	2625533	6097032		Klosneuvirus(100.0%)	1	NA	NA
WP_014838196.1|2624312_2625533_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	9.5e-27
>prophage 173
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2634951	2635779	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_004850083.1|2634951_2635779_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.1	1.2e-70
>prophage 174
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2641993	2647733	6097032		Tupanvirus(50.0%)	5	NA	NA
WP_014228985.1|2641993_2644252_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.9	2.1e-144
WP_165795096.1|2644370_2644688_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_014228987.1|2644763_2646155_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_004850102.1|2646289_2646880_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_014838201.1|2646971_2647733_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	4.0e-15
>prophage 175
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2652111	2653428	6097032		Streptococcus_phage(100.0%)	1	NA	NA
WP_014838202.1|2652111_2653428_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.8	1.9e-41
>prophage 176
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2664159	2667117	6097032		Acinetobacter_phage(100.0%)	2	NA	NA
WP_014838209.1|2664159_2665518_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	4.7e-35
WP_004850135.1|2665521_2667117_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.7	1.1e-46
>prophage 177
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2680069	2682667	6097032		Tupanvirus(100.0%)	1	NA	NA
WP_014838214.1|2680069_2682667_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.0	2.9e-89
>prophage 178
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2687511	2688102	6097032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004121245.1|2687511_2688102_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	3.5e-43
>prophage 179
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2693680	2699866	6097032		Bodo_saltans_virus(33.33%)	5	NA	NA
WP_014229019.1|2693680_2695615_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	25.1	1.8e-08
WP_014838219.1|2695696_2696854_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004121225.1|2697036_2697825_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004850180.1|2698062_2698872_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.6e-14
WP_014229021.1|2698873_2699866_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.7	2.1e-08
>prophage 180
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2722985	2724005	6097032		Bacillus_phage(100.0%)	1	NA	NA
WP_014229034.1|2722985_2724005_+	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.6	6.9e-15
>prophage 181
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2732870	2733665	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_025107016.1|2732870_2733665_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	1.8e-31
>prophage 182
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2748425	2749151	6097032		Planktothrix_phage(100.0%)	1	NA	NA
WP_162933639.1|2748425_2749151_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.1	5.2e-33
>prophage 183
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2755204	2762371	6097032		Streptococcus_phage(25.0%)	7	NA	NA
WP_014229052.1|2755204_2756110_+	PLP-dependent cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	38.0	5.2e-46
WP_014229053.1|2756102_2756531_+	M67 family metallopeptidase	NA	NA	NA	NA	NA
WP_014229054.1|2756590_2756881_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_014838257.1|2756877_2758053_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A291ATS8	Pandoravirus	33.6	2.3e-09
WP_014229057.1|2759022_2760501_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.3	2.1e-89
WP_014229058.1|2760690_2761557_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014838260.1|2761528_2762371_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	7.2e-34
>prophage 184
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2772980	2809362	6097032	transposase,plate	Bluetongue_virus(33.33%)	27	NA	NA
WP_014838267.1|2772980_2774324_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_014838268.1|2774320_2774986_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_042934081.1|2774982_2776671_+	OmpA family protein	NA	NA	NA	NA	NA
WP_014838270.1|2776815_2777307_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_157872488.1|2777384_2777555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838274.1|2780193_2782689_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	1.8e-19
WP_014838275.1|2782941_2784909_+	membrane protein	NA	A0A077K801	Ralstonia_phage	32.4	1.7e-62
WP_042934082.1|2784910_2785171_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014838276.1|2785170_2786604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113705935.1|2786768_2789978_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_014838278.1|2790073_2790352_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014838279.1|2790364_2792125_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_014838280.1|2792088_2793174_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032749377.1|2793151_2793691_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_014838282.1|2793692_2794148_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_014838283.1|2794171_2795506_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014838284.1|2795668_2797348_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_162140807.1|2797402_2798842_-	MFS transporter	NA	NA	NA	NA	NA
WP_001339197.1|2799092_2800301_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_035689358.1|2800310_2800682_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001089068.1|2801519_2802725_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000088605.1|2802806_2803430_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|2803407_2804094_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|2804101_2804488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|2804480_2804801_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001339197.1|2806229_2807438_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001339175.1|2808153_2809362_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	2.3e-235
>prophage 185
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2817773	2818499	6097032		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014838296.1|2817773_2818499_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	3.5e-45
>prophage 186
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2831666	2835254	6097032		Morganella_phage(33.33%)	4	NA	NA
WP_004850301.1|2831666_2832089_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.2	2.6e-32
WP_014229114.1|2832088_2833354_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.4	1.0e-156
WP_177331765.1|2833426_2834518_-	oxidoreductase	NA	NA	NA	NA	NA
WP_014838308.1|2834510_2835254_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.6	1.9e-14
>prophage 187
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2838302	2845253	6097032	protease,tRNA	Enterobacteria_phage(40.0%)	7	NA	NA
WP_014229118.1|2838302_2839676_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.8e-50
WP_014838310.1|2839720_2840656_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	7.0e-139
WP_042934342.1|2841467_2842406_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_014229121.1|2842784_2843075_-	Bor family protein	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
WP_004850323.1|2843263_2843698_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
WP_004850325.1|2843780_2843993_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_009652979.1|2844146_2845253_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.4	4.9e-107
>prophage 188
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2849607	2855156	6097032	holin	Enterobacterial_phage(33.33%)	9	NA	NA
WP_046877232.1|2849607_2850309_+	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	40.0	2.5e-32
WP_014229124.1|2850768_2851131_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	57.5	7.1e-31
WP_014838313.1|2851207_2851600_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	65.4	6.5e-38
WP_032749344.1|2851589_2851862_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.4	2.2e-16
WP_014838315.1|2851869_2852412_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	66.9	4.0e-70
WP_032693413.1|2852638_2853004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004101621.1|2853331_2853604_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_014229134.1|2853600_2854041_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_004112629.1|2854166_2855156_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
>prophage 189
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2864456	2865977	6097032		Indivirus(100.0%)	1	NA	NA
WP_014838321.1|2864456_2865977_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.3	6.9e-11
>prophage 190
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2888597	2890104	6097032		Streptococcus_phage(50.0%)	2	NA	NA
WP_032720791.1|2888597_2889287_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.1	5.7e-13
WP_042934086.1|2889357_2890104_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	29.9	4.8e-05
>prophage 191
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2913052	2914123	6097032		Synechococcus_phage(100.0%)	1	NA	NA
WP_014838352.1|2913052_2914123_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	39.3	2.4e-10
>prophage 192
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2923271	2927882	6097032		Klosneuvirus(50.0%)	2	NA	NA
WP_014838357.1|2923271_2927174_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
WP_014838358.1|2927222_2927882_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	50.4	1.4e-29
>prophage 193
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2939892	2944509	6097032		Bacillus_phage(20.0%)	8	NA	NA
WP_014229205.1|2939892_2940864_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.7	2.1e-13
WP_004850536.1|2940929_2941133_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	53.7	6.0e-11
WP_014838364.1|2941424_2941622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004850538.1|2941742_2941907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004101739.1|2941928_2942171_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	82.3	1.6e-31
WP_014838366.1|2942395_2942923_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	47.7	8.2e-20
WP_004101746.1|2943092_2943368_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_014229209.1|2943390_2944509_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.5	4.7e-33
>prophage 194
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2951745	2953254	6097032		Mollivirus(100.0%)	1	NA	NA
WP_014229212.1|2951745_2953254_+	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	29.5	1.7e-30
>prophage 195
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2966596	2968561	6097032		Phage_TP(100.0%)	1	NA	NA
WP_042934350.1|2966596_2968561_+	U32 family peptidase	NA	Q6DW11	Phage_TP	26.7	6.6e-22
>prophage 196
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2975310	2976321	6097032		Mycoplasma_phage(100.0%)	1	NA	NA
WP_014229231.1|2975310_2976321_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.8	4.7e-24
>prophage 197
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	2993336	2995448	6097032		Salmonella_phage(100.0%)	1	NA	NA
WP_014838400.1|2993336_2995448_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.9	1.2e-138
>prophage 198
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3005982	3006762	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_014838408.1|3005982_3006762_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	1.9e-20
>prophage 199
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3020786	3021491	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_160740895.1|3020786_3021491_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	1.1e-30
>prophage 200
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3026959	3028504	6097032		Escherichia_phage(100.0%)	1	NA	NA
WP_014838420.1|3026959_3028504_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.6	1.9e-19
>prophage 201
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3034607	3036098	6097032		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004850706.1|3034607_3036098_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.3	1.1e-32
>prophage 202
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3046077	3047682	6097032		Planktothrix_phage(100.0%)	1	NA	NA
WP_014838430.1|3046077_3047682_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.1e-19
>prophage 203
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3051923	3058302	6097032		Tupanvirus(25.0%)	7	NA	NA
WP_014838434.1|3051923_3052934_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	2.5e-25
WP_014229291.1|3053190_3053790_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	40.6	5.3e-23
WP_014838435.1|3054050_3054512_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	34.3	1.7e-13
WP_042934094.1|3054550_3055243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934095.1|3055488_3055968_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_014838437.1|3056024_3056552_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014838438.1|3056589_3058302_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	25.5	4.7e-32
>prophage 204
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3084861	3086450	6097032		Bacillus_virus(50.0%)	2	NA	NA
WP_014838453.1|3084861_3085677_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	21.3	4.3e-07
WP_014838454.1|3085673_3086450_+	ABC transporter ATP-binding protein	NA	A0A140XAK6	Dickeya_phage	48.4	1.5e-17
>prophage 205
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3103016	3103745	6097032		Pithovirus(100.0%)	1	NA	NA
WP_032695014.1|3103016_3103745_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	2.8e-18
>prophage 206
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3117316	3118201	6097032		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_004850866.1|3117316_3118201_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.7	3.7e-81
>prophage 207
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3125436	3126834	6097032		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_014838476.1|3125436_3126834_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	3.1e-42
>prophage 208
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3145715	3146531	6097032		Autographa_californica_nuclear_polyhedrosis_virus(100.0%)	1	NA	NA
WP_038424510.1|3145715_3146531_+	APH(3')-I family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	97.0	1.0e-157
>prophage 209
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3159930	3180493	6097032		Bacillus_phage(50.0%)	5	NA	NA
WP_014838498.1|3159930_3161733_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	23.5	5.7e-20
WP_014838499.1|3161719_3163432_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.2	1.8e-31
WP_032694987.1|3163688_3164648_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_014838501.1|3164831_3170930_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.7	6.8e-33
WP_014838502.1|3171016_3180493_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	8.1e-49
>prophage 210
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3192729	3193476	6097032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_162097199.1|3192729_3193476_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.3e-15
>prophage 211
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3198083	3200081	6097032		Acinetobacter_phage(100.0%)	1	NA	NA
WP_014838515.1|3198083_3200081_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.3	4.2e-08
>prophage 212
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3203831	3204560	6097032		Escherichia_phage(100.0%)	1	NA	NA
WP_014229408.1|3203831_3204560_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	38.4	8.4e-23
>prophage 213
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3222752	3223589	6097032		Mycobacterium_phage(100.0%)	1	NA	NA
WP_014838530.1|3222752_3223589_-	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	37.7	2.4e-13
>prophage 214
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3232849	3234382	6097032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014838539.1|3232849_3234382_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	5.0e-17
>prophage 215
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3242153	3245718	6097032		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_014838545.1|3242153_3243149_+	2-hydroxyacid dehydrogenase	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	30.5	4.4e-22
WP_014838546.1|3243238_3244501_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_025106268.1|3244632_3245718_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	67.1	6.0e-142
>prophage 216
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3250145	3250955	6097032		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_014229450.1|3250145_3250955_-	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	29.4	2.8e-11
>prophage 217
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3254941	3256399	6097032		Mycoplasma_phage(100.0%)	1	NA	NA
WP_014838551.1|3254941_3256399_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	36.0	2.6e-39
>prophage 218
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3263458	3264199	6097032		Indivirus(100.0%)	1	NA	NA
WP_004102264.1|3263458_3264199_-	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.1	7.3e-14
>prophage 219
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3267700	3268492	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_014229467.1|3267700_3268492_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.5	1.6e-19
>prophage 220
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3288186	3289599	6097032		Bacillus_phage(100.0%)	1	NA	NA
WP_042934100.1|3288186_3289599_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.4	3.5e-17
>prophage 221
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3295120	3295882	6097032		Escherichia_phage(100.0%)	1	NA	NA
WP_014838580.1|3295120_3295882_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.3	1.5e-30
>prophage 222
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3300438	3301200	6097032		Moraxella_phage(100.0%)	1	NA	NA
WP_014838585.1|3300438_3301200_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.0	1.7e-42
>prophage 223
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3308773	3309154	6097032		Streptococcus_phage(100.0%)	1	NA	NA
WP_004102351.1|3308773_3309154_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	1.4e-08
>prophage 224
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3312931	3314437	6097032		Staphylococcus_phage(50.0%)	2	NA	NA
WP_014838596.1|3312931_3313630_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	2.8e-15
WP_014229496.1|3313639_3314437_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A1M7XV31	Cedratvirus	26.9	1.2e-11
>prophage 225
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3318617	3319721	6097032		uncultured_virus(100.0%)	1	NA	NA
WP_014838597.1|3318617_3319721_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.9	3.6e-102
>prophage 226
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3327603	3334819	6097032		Escherichia_phage(50.0%)	4	NA	NA
WP_014838605.1|3327603_3328674_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	44.6	1.0e-64
WP_014838606.1|3328881_3331989_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.9	0.0e+00
WP_014838607.1|3333367_3334456_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	82.5	3.7e-176
WP_014229513.1|3334558_3334819_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	83.5	9.9e-35
>prophage 227
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3341042	3351442	6097032		Klosneuvirus(20.0%)	9	NA	NA
WP_014838613.1|3341042_3343085_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.2	3.1e-14
WP_004851244.1|3343256_3344006_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_014229523.1|3344096_3344783_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014838615.1|3344834_3345266_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	38.6	3.3e-19
WP_004851251.1|3345543_3347007_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
WP_029946863.1|3347241_3348618_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_014838618.1|3348661_3349681_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004851257.1|3349695_3350910_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	9.7e-48
WP_014229526.1|3351115_3351442_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	7.6e-24
>prophage 228
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3356208	3358334	6097032		Escherichia_phage(100.0%)	3	NA	NA
WP_014229529.1|3356208_3356826_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	4.4e-73
WP_014229530.1|3356827_3357685_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	NA	NA	NA	NA
WP_014838620.1|3357725_3358334_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.6	2.2e-24
>prophage 229
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3368707	3370864	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_014838629.1|3368707_3370864_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.0	6.0e-16
>prophage 230
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3378214	3379174	6097032		Salmonella_phage(100.0%)	1	NA	NA
WP_004851304.1|3378214_3379174_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	1.3e-52
>prophage 231
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3390099	3392877	6097032		Lactobacillus_phage(100.0%)	1	NA	NA
WP_014838639.1|3390099_3392877_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	30.8	1.1e-65
>prophage 232
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3409401	3409917	6097032		Streptococcus_phage(100.0%)	1	NA	NA
WP_014229564.1|3409401_3409917_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.8	4.1e-24
>prophage 233
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3424859	3427828	6097032		Molluscum_contagiosum_virus(50.0%)	3	NA	NA
WP_014838651.1|3424859_3425342_+	glutathione peroxidase	NA	A0A1S7DMQ0	Molluscum_contagiosum_virus	40.2	3.0e-16
WP_014229575.1|3425518_3426208_-	VIT family protein	NA	NA	NA	NA	NA
WP_014229576.1|3426526_3427828_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.5e-17
>prophage 234
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3439276	3439480	6097032		Salmonella_phage(100.0%)	1	NA	NA
WP_004851411.1|3439276_3439480_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	67.2	3.5e-19
>prophage 235
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3444837	3446208	6097032		Pandoravirus(100.0%)	1	NA	NA
WP_014838659.1|3444837_3446208_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	33.1	8.9e-66
>prophage 236
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3457172	3458447	6097032	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_004851444.1|3457172_3458447_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.8	9.4e-86
>prophage 237
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3467087	3468565	6097032		Salmonella_phage(50.0%)	2	NA	NA
WP_004119475.1|3467087_3467609_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	2.1e-47
WP_014838670.1|3467668_3468565_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	29.7	2.7e-07
>prophage 238
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3472722	3481423	6097032		Bacillus_phage(20.0%)	9	NA	NA
WP_014229604.1|3472722_3473577_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	38.7	4.7e-17
WP_004851476.1|3473701_3474283_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.3	9.0e-44
WP_004851479.1|3474339_3475506_-	MFS transporter	NA	NA	NA	NA	NA
WP_049082851.1|3475671_3475761_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_004851481.1|3476057_3477083_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	1.8e-31
WP_014229606.1|3477101_3478013_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229607.1|3478125_3479310_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_014838673.1|3479608_3480757_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	5.0e-86
WP_004851490.1|3480787_3481423_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.6e-22
>prophage 239
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3495928	3496813	6097032		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_014229621.1|3495928_3496813_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	55.8	2.8e-81
>prophage 240
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3505083	3510478	6097032	integrase	Planktothrix_phage(33.33%)	4	3506115:3506128	3514027:3514040
WP_014838682.1|3505083_3506064_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.2e-11
WP_014838683.1|3506060_3507026_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	26.9	1.8e-09
3506115:3506128	attL	CGCGATGGGCTGTT	NA	NA	NA	NA
WP_014838684.1|3507099_3509505_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_014229630.1|3509929_3510478_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.9	7.2e-51
3514027:3514040	attR	CGCGATGGGCTGTT	NA	NA	NA	NA
>prophage 241
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3516499	3517051	6097032	integrase	Escherichia_phage(100.0%)	1	3513742:3513756	3523976:3523990
3513742:3513756	attL	GATATGCAGGACGTT	NA	NA	NA	NA
WP_014838689.1|3516499_3517051_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
WP_014838689.1|3516499_3517051_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
3523976:3523990	attR	AACGTCCTGCATATC	NA	NA	NA	NA
>prophage 242
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3520811	3521684	6097032		Lactobacillus_phage(100.0%)	1	NA	NA
WP_014229640.1|3520811_3521684_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.3e-05
>prophage 243
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3525110	3526181	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_014838694.1|3525110_3526181_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	9.8e-28
>prophage 244
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3554116	3556459	6097032		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_014838709.1|3554116_3556459_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.0	1.7e-03
>prophage 245
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3577131	3581459	6097032		Planktothrix_phage(50.0%)	3	NA	NA
WP_014229681.1|3577131_3577953_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	3.3e-15
WP_089046452.1|3578459_3580532_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_014838728.1|3580670_3581459_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.8	8.5e-29
>prophage 246
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3594169	3596133	6097032		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_014229695.1|3594169_3595186_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	6.0e-43
WP_014229696.1|3595182_3596133_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.6	4.8e-34
>prophage 247
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3614295	3615516	6097032		environmental_halophage(100.0%)	1	NA	NA
WP_042934112.1|3614295_3615516_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.9	3.1e-94
>prophage 248
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3633221	3651207	6097032	tRNA	Tupanvirus(25.0%)	17	NA	NA
WP_014229722.1|3633221_3635600_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.0	2.9e-173
WP_004851771.1|3635942_3636776_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_014229723.1|3636929_3637976_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.4	2.3e-82
WP_160741222.1|3638141_3638321_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_014229725.1|3638355_3639798_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.4	9.7e-55
WP_014229726.1|3639959_3640424_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_014229727.1|3640505_3641255_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	4.2e-09
WP_014229728.1|3641254_3641806_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_014229729.1|3642030_3642831_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_009653750.1|3642857_3643844_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_004851790.1|3643944_3644244_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	9.4e-13
WP_014229730.1|3644248_3646636_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004851795.1|3646651_3647635_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	2.9e-34
WP_004102963.1|3648031_3648388_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3648438_3648636_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_052746887.1|3648732_3649275_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	5.3e-14
WP_004102966.1|3649278_3651207_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	6.7e-128
>prophage 249
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3658244	3658742	6097032		Serratia_phage(100.0%)	1	NA	NA
WP_004898926.1|3658244_3658742_+	PH domain-containing protein	NA	A0A249Y2R5	Serratia_phage	33.3	3.1e-16
>prophage 250
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3667254	3670151	6097032		Lactobacillus_phage(33.33%)	3	NA	NA
WP_014838749.1|3667254_3668091_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	41.2	3.9e-08
WP_004851821.1|3668136_3669141_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	28.6	6.8e-15
WP_004851823.1|3669137_3670151_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.7e-13
>prophage 251
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3678452	3688525	6097032		Morganella_phage(20.0%)	10	NA	NA
WP_042934113.1|3678452_3679070_-	thymidine kinase	NA	A0A192YC86	Morganella_phage	50.5	9.5e-52
WP_004121719.1|3679625_3680033_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_004851836.1|3680167_3681070_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.5e-58
WP_014838752.1|3681267_3682281_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	27.7	7.6e-06
WP_014229740.1|3682361_3683270_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_014229741.1|3683382_3683841_+	YchJ family protein	NA	NA	NA	NA	NA
WP_004121732.1|3683883_3684726_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	46.3	1.6e-12
WP_004103123.1|3685605_3686283_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_014229743.1|3686282_3686993_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_014838755.1|3686989_3688525_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	3.7e-20
>prophage 252
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3704959	3705748	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_014838761.1|3704959_3705748_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	1.0e-29
>prophage 253
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3711107	3716812	6097032		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
WP_009651994.1|3711107_3711338_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	46.7	9.1e-08
WP_004121802.1|3711602_3712703_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_004103146.1|3712791_3713646_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.8	8.9e-48
WP_004851879.1|3713685_3714498_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004851880.1|3714501_3714894_-	SirB family protein	NA	NA	NA	NA	NA
WP_014229755.1|3714890_3715730_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004851884.1|3715729_3716812_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	40.0	1.1e-07
>prophage 254
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3720025	3722902	6097032		Tupanvirus(50.0%)	2	NA	NA
WP_004103157.1|3720025_3720973_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	3.0e-44
WP_025108450.1|3721222_3722902_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	8.7e-23
>prophage 255
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3726578	3727586	6097032	integrase	uncultured_Caudovirales_phage(100.0%)	1	3726558:3726572	3728829:3728843
3726558:3726572	attL	CCACAAAATCCACGC	NA	NA	NA	NA
WP_014838768.1|3726578_3727586_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.4	2.1e-48
WP_014838768.1|3726578_3727586_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.4	2.1e-48
3728829:3728843	attR	CCACAAAATCCACGC	NA	NA	NA	NA
>prophage 256
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3746169	3747642	6097032		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014229771.1|3746169_3747642_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.7	2.8e-25
>prophage 257
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3750663	3751122	6097032		Acinetobacter_phage(100.0%)	1	NA	NA
WP_009651983.1|3750663_3751122_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	35.9	2.1e-19
>prophage 258
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3757938	3764134	6097032		Morganella_phage(25.0%)	6	NA	NA
WP_014229778.1|3757938_3758466_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	58.2	8.4e-49
WP_014838784.1|3758544_3759039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838785.1|3759272_3760913_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.0	5.0e-132
WP_004851947.1|3761227_3762121_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229781.1|3762180_3762867_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	3.0e-06
WP_025108425.1|3763045_3764134_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	6.7e-24
>prophage 259
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3785253	3785865	6097032		Geobacillus_virus(100.0%)	1	NA	NA
WP_009651970.1|3785253_3785865_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 260
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3801355	3809440	6097032	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_014229806.1|3801355_3803041_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	4.2e-33
WP_042934114.1|3803249_3803834_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_004852009.1|3803877_3804573_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_014229807.1|3804640_3806551_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.9	4.2e-90
WP_004113724.1|3806683_3807028_+	RidA family protein	NA	NA	NA	NA	NA
WP_014229808.1|3807198_3808338_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_014229809.1|3808345_3809440_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.3	1.8e-21
>prophage 261
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3816601	3817957	6097032		Pandoravirus(100.0%)	1	NA	NA
WP_014838807.1|3816601_3817957_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.3	2.7e-43
>prophage 262
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3821801	3823361	6097032		Moraxella_phage(100.0%)	1	NA	NA
WP_014838809.1|3821801_3823361_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	6.6e-41
>prophage 263
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3830794	3831004	6097032		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3830794_3831004_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 264
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3836256	3838305	6097032		Moraxella_phage(100.0%)	1	NA	NA
WP_014838815.1|3836256_3838305_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.1	3.4e-85
>prophage 265
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3845774	3846428	6097032		Escherichia_phage(100.0%)	1	NA	NA
WP_014229829.1|3845774_3846428_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	52.1	1.7e-59
>prophage 266
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3855676	3856645	6097032		Pectobacterium_phage(50.0%)	2	NA	NA
WP_004103351.1|3855676_3855907_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
WP_014229839.1|3855985_3856645_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	32.8	2.6e-15
>prophage 267
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3864100	3869774	6097032		Cyanophage(50.0%)	4	NA	NA
WP_004122041.1|3864100_3865576_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.7e-78
WP_161505349.1|3865901_3866807_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229845.1|3866932_3868375_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_014229846.1|3868439_3869774_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	62.9	1.2e-22
>prophage 268
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3874795	3881136	6097032		Listeria_phage(25.0%)	7	NA	NA
WP_014229851.1|3874795_3876118_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_004852123.1|3876133_3877078_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_014838829.1|3877156_3877909_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	1.5e-14
WP_014838830.1|3877908_3878694_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_014838831.1|3878902_3879913_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.6	8.1e-08
WP_004103390.1|3879921_3880533_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_014229855.1|3880614_3881136_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 269
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3885007	3891727	6097032	tRNA	Escherichia_coli_phage(33.33%)	7	NA	NA
WP_014229856.1|3885007_3885826_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.9	9.1e-58
WP_004122068.1|3885879_3886275_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_009652021.1|3886314_3887058_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	29.1	1.5e-22
WP_004852151.1|3887054_3888077_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_014838836.1|3888374_3889118_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_014838837.1|3889194_3889764_-	VOC family protein	NA	NA	NA	NA	NA
WP_009652018.1|3889993_3891727_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	4.1e-84
>prophage 270
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3898750	3900265	6097032		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014229863.1|3898750_3900265_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	1.5e-10
>prophage 271
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3917540	3918293	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_014838848.1|3917540_3918293_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.4e-27
>prophage 272
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3924998	3937167	6097032		Burkholderia_phage(28.57%)	12	NA	NA
WP_014838854.1|3924998_3926666_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	36.7	9.3e-17
WP_025106102.1|3926773_3926953_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_004852222.1|3927028_3927940_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_014229885.1|3928123_3929035_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_014229886.1|3929009_3929504_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.0	1.4e-32
WP_042934379.1|3929484_3930918_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.5	1.7e-96
WP_014229888.1|3930974_3931670_-	phosphohydrolase	NA	S4W232	Pandoravirus	26.5	2.3e-06
WP_004852229.1|3931712_3931994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014229889.1|3932621_3933692_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.1	5.3e-90
WP_071886336.1|3934361_3934724_+	GtrA family protein	NA	NA	NA	NA	NA
WP_014229891.1|3934720_3935713_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.5	1.3e-50
WP_014838856.1|3935709_3937167_+	hypothetical protein	NA	E5AGC8	Erwinia_phage	40.9	1.0e-99
>prophage 273
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3944113	3951964	6097032		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_014838863.1|3944113_3946801_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.8	4.7e-71
WP_014229901.1|3946851_3947283_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	42.8	5.0e-23
WP_014838864.1|3947816_3948902_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014838865.1|3948901_3951964_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	22.3	1.5e-25
>prophage 274
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3974434	3976841	6097032		Diadromus_pulchellus_ascovirus(50.0%)	3	NA	NA
WP_042934119.1|3974434_3975145_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	29.1	2.0e-08
WP_032738874.1|3975339_3975912_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014838887.1|3976148_3976841_-	DUF1738 domain-containing protein	NA	A0A1V0EBY3	Caulobacter_phage	44.2	1.6e-47
>prophage 275
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	3981074	3981989	6097032		Lactobacillus_phage(100.0%)	1	NA	NA
WP_014838891.1|3981074_3981989_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	29.3	4.3e-08
>prophage 276
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4023096	4028076	6097032		Stx2-converting_phage(50.0%)	3	NA	NA
WP_014838910.1|4023096_4024263_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.9	8.9e-184
WP_014838911.1|4024443_4025868_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_014838912.1|4025973_4028076_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	6.3e-63
>prophage 277
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4041218	4043276	6097032		uncultured_virus(50.0%)	2	NA	NA
WP_014838919.1|4041218_4042043_+	Fe-S cluster assembly protein NifU	NA	A0A218MKD1	uncultured_virus	45.1	9.5e-23
WP_014838920.1|4042073_4043276_+	cysteine desulfurase NifS	NA	A0A1X7C038	Faustovirus	27.8	1.2e-29
>prophage 278
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4055797	4056697	6097032		Cellulophaga_phage(100.0%)	1	NA	NA
WP_014838931.1|4055797_4056697_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	89.5	5.4e-11
>prophage 279
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4062241	4080881	6097032		Escherichia_phage(18.18%)	16	NA	NA
WP_004122447.1|4062241_4062841_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A1V0SIZ6	Klosneuvirus	34.2	1.5e-17
WP_014838935.1|4062924_4064244_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.0	9.6e-09
WP_014838936.1|4064375_4065521_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_014838937.1|4065521_4066415_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004852435.1|4066411_4067566_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	40.9	3.0e-75
WP_014838938.1|4067584_4069477_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_004852439.1|4069490_4070231_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.8	1.1e-06
WP_004138730.1|4070230_4070998_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014838941.1|4072303_4073308_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	2.3e-31
WP_004138729.1|4073779_4073902_+	small membrane protein	NA	NA	NA	NA	NA
WP_014838943.1|4074482_4075649_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	1.8e-112
WP_014230057.1|4075822_4076377_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.7	7.3e-51
WP_014230058.1|4076392_4077283_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.1	2.4e-27
WP_004122480.1|4077314_4078184_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.7	3.7e-110
WP_014838944.1|4078197_4079262_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
WP_014838945.1|4079474_4080881_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	4.3e-39
>prophage 280
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4099488	4181431	6097032	capsid,terminase,tRNA,lysis,portal,tail,integrase,plate,holin,transposase,head	Escherichia_phage(34.04%)	78	4144167:4144189	4177120:4177142
WP_016946203.1|4099488_4100385_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.0	7.4e-45
WP_001352368.1|4100482_4101691_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_014838960.1|4102699_4104286_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	2.9e-36
WP_014230076.1|4104525_4106373_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004852489.1|4106400_4106982_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	1.3e-31
WP_004122537.1|4107072_4107714_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	1.7e-35
WP_014838961.1|4107828_4108677_-	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_014838962.1|4108813_4110166_+	molecular chaperone	NA	NA	NA	NA	NA
WP_014230079.1|4110256_4111540_-	citrate synthase	NA	NA	NA	NA	NA
WP_042934130.1|4112371_4114342_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_014230081.1|4114338_4115037_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032451537.1|4115406_4115547_+	small membrane protein	NA	NA	NA	NA	NA
WP_042934387.1|4115655_4116273_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004852509.1|4116569_4117844_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_014230083.1|4118078_4119593_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014230084.1|4119573_4120608_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_014838966.1|4120607_4121582_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	3.4e-19
WP_014838967.1|4121578_4122424_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004852520.1|4122420_4123359_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014838968.1|4123358_4124258_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_014230088.1|4124460_4125213_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014838969.1|4125297_4126194_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_014838970.1|4126201_4127320_-	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_025107779.1|4127334_4127790_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230092.1|4127790_4128516_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014838972.1|4128512_4129205_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014838973.1|4129269_4130043_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014838974.1|4130071_4130833_-	amidinotransferase	NA	NA	NA	NA	NA
WP_014838975.1|4131216_4132470_+	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014838976.1|4132469_4135592_+	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_014230098.1|4135592_4138670_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_014230099.1|4138671_4140087_+	MFS transporter	NA	NA	NA	NA	NA
WP_014838977.1|4140083_4141619_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.6	6.3e-28
WP_014230101.1|4141615_4142338_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
WP_014230102.1|4142656_4144018_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	91.8	4.7e-200
4144167:4144189	attL	CCCTTACGCGGGCTTATTTTTTT	NA	NA	NA	NA
WP_071886339.1|4144287_4144509_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.6	2.2e-27
WP_014838979.1|4144593_4145751_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	79.2	8.6e-171
WP_042934389.1|4145750_4146230_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	86.7	6.5e-64
WP_014838981.1|4146241_4148680_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	74.9	1.4e-308
WP_014838982.1|4148672_4148792_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	89.7	2.6e-14
WP_014838983.1|4148824_4149100_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	76.7	3.2e-31
WP_014838984.1|4149160_4149676_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	76.2	8.5e-70
WP_014838985.1|4149689_4150871_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	3.9e-195
WP_014838986.1|4150981_4152055_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	3.8e-40
WP_014838987.1|4152106_4153225_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	5.8e-55
WP_042934131.1|4153234_4155184_-	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	50.9	3.9e-06
WP_014838989.1|4155263_4155845_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	54.6	3.6e-53
WP_014838990.1|4155852_4156761_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.5	1.1e-112
WP_014838991.1|4156765_4157113_-	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	77.4	8.3e-45
WP_042934132.1|4157109_4157751_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.0	1.7e-91
WP_014838993.1|4158149_4159106_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_042934133.1|4159148_4160069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838995.1|4160269_4160719_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.7	2.5e-49
WP_014838996.1|4160711_4161179_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	75.5	2.4e-63
WP_014838997.1|4161141_4161300_-	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	72.0	1.1e-12
WP_014838998.1|4161274_4161706_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	65.5	9.0e-41
WP_014838999.1|4161702_4162200_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	85.5	1.1e-79
WP_004175164.1|4162186_4162477_-|holin	phage holin family protein	holin	O80308	Escherichia_phage	84.7	1.2e-36
WP_014839000.1|4162481_4162685_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	80.6	4.2e-25
WP_014839001.1|4162684_4163191_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	82.8	7.8e-60
WP_162140814.1|4163287_4164007_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	78.4	5.3e-94
WP_014839003.1|4164034_4165093_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	81.8	1.5e-161
WP_014839004.1|4165166_4166021_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	79.6	2.8e-126
WP_014839005.1|4166186_4167956_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.8	3.7e-306
WP_014839006.1|4167955_4168999_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.4	5.2e-167
WP_014839007.1|4169705_4170137_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	90.2	1.1e-67
WP_049824829.1|4171689_4173978_-	replication endonuclease	NA	U5N0W3	Enterobacteria_phage	74.3	0.0e+00
WP_014839009.1|4173967_4174243_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	61.5	1.5e-25
WP_014839010.1|4174259_4174475_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_042934135.1|4174539_4175040_-	hypothetical protein	NA	M1SV55	Escherichia_phage	86.1	6.1e-81
WP_016831472.1|4175209_4175485_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	85.7	4.0e-42
WP_016831471.1|4175607_4175907_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	69.7	5.7e-34
WP_014839012.1|4176021_4177035_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	82.5	4.0e-164
WP_009654032.1|4177215_4178109_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.9	8.8e-14
4177120:4177142	attR	CCCTTACGCGGGCTTATTTTTTT	NA	NA	NA	NA
WP_014230103.1|4178109_4178580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038423091.1|4178566_4179367_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014230105.1|4179783_4180557_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-27
WP_014230106.1|4180567_4181431_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.9e-11
>prophage 281
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4190065	4191433	6097032		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_014839019.1|4190065_4191433_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	28.0	4.7e-43
>prophage 282
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4198919	4199924	6097032		Serratia_phage(100.0%)	1	NA	NA
WP_014839024.1|4198919_4199924_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	26.3	5.4e-12
>prophage 283
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4208663	4216121	6097032	integrase	Enterobacteria_phage(33.33%)	7	NA	NA
WP_020244643.1|4208663_4209242_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	35.9	1.8e-15
WP_020244642.1|4209597_4210059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839030.1|4210209_4210452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839032.1|4211014_4211968_-	hypothetical protein	NA	A0A1B1ITH5	uncultured_Mediterranean_phage	30.4	2.9e-31
WP_071598686.1|4211999_4212263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839033.1|4212386_4213748_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014839034.1|4214144_4216121_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.6	1.1e-160
>prophage 284
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4224584	4233442	6097032	tRNA	Enterobacteria_phage(60.0%)	9	NA	NA
WP_038424974.1|4224584_4226618_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.5	8.0e-55
WP_014839039.1|4226817_4227285_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_004852612.1|4227388_4227856_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	79.9	5.1e-66
WP_004852613.1|4227909_4228629_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_014839040.1|4228622_4230311_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.3	4.6e-258
WP_014839041.1|4230521_4231280_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	69.8	4.7e-77
WP_004103838.1|4231685_4231799_+	protein YohO	NA	NA	NA	NA	NA
WP_014839042.1|4231773_4232511_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014230133.1|4232494_4233442_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	6.2e-10
>prophage 285
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4240015	4240570	6097032		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_014839047.1|4240015_4240570_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.2	5.1e-20
>prophage 286
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4244765	4245500	6097032		Streptococcus_phage(100.0%)	1	NA	NA
WP_014230141.1|4244765_4245500_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	41.6	1.3e-50
>prophage 287
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4261409	4262930	6097032		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_014230153.1|4261409_4262930_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 288
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4266688	4270655	6097032		Cellulophaga_phage(50.0%)	3	NA	NA
WP_004103895.1|4266688_4267357_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	6.9e-56
WP_014839058.1|4267725_4268562_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_014230158.1|4268681_4270655_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.8	8.1e-12
>prophage 289
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4274773	4275631	6097032		Catovirus(100.0%)	1	NA	NA
WP_014230162.1|4274773_4275631_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	30.5	1.5e-23
>prophage 290
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4286856	4291162	6097032		Ostreococcus_tauri_virus(50.0%)	3	NA	NA
WP_014839067.1|4286856_4288323_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.1	6.6e-43
WP_025106743.1|4289452_4290166_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004122922.1|4290592_4291162_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	5.2e-12
>prophage 291
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4296921	4347627	6097032	transposase,plate,protease	Salmonella_phage(20.0%)	43	NA	NA
WP_014230176.1|4296921_4298511_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	4.7e-18
WP_004122937.1|4298514_4298859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230177.1|4299189_4300386_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.8	2.8e-23
WP_014230178.1|4300382_4301102_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_014839073.1|4301250_4303008_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	5.8e-102
WP_004114143.1|4303145_4303430_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_014230180.1|4303491_4304085_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_014230181.1|4304165_4304924_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004122954.1|4304973_4305981_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.5	3.1e-84
WP_042934393.1|4306159_4306387_+	YejL family protein	NA	NA	NA	NA	NA
WP_014230182.1|4306406_4308167_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_014230184.1|4308614_4309067_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_014230185.1|4309059_4309596_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032693684.1|4309576_4310680_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_014839078.1|4310634_4312398_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032693683.1|4312421_4313156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230189.1|4313220_4313415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230191.1|4313766_4317186_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_014839082.1|4317172_4318333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230193.1|4318336_4318603_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014230194.1|4318632_4319313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230195.1|4319309_4321214_-	LysM peptidoglycan-binding domain-containing protein	NA	S6BFI4	Thermus_phage	53.5	3.2e-05
WP_014230196.1|4321222_4321762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839083.1|4321754_4324370_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_113705932.1|4324661_4324892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000654811.1|4324911_4325880_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_014839086.1|4327977_4328469_-	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_171817012.1|4328473_4330198_-	OmpA family protein	NA	NA	NA	NA	NA
WP_014839088.1|4330201_4330855_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_014839089.1|4330851_4332189_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_164504666.1|4332207_4333752_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_014230205.1|4333794_4334292_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_075208269.1|4334604_4334931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009653963.1|4335273_4336380_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_014230206.1|4336582_4337074_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_014230207.1|4337118_4338753_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_162097206.1|4339121_4340279_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.6	9.4e-77
WP_014230209.1|4340241_4341678_-	magnesium transporter	NA	NA	NA	NA	NA
WP_014230210.1|4341846_4343490_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.6	1.2e-08
WP_014839091.1|4343566_4344217_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_014839092.1|4344216_4345281_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
WP_014230213.1|4345353_4346406_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_014230214.1|4346508_4347627_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.5	1.9e-119
>prophage 292
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4351770	4366223	6097032		Pseudomonas_phage(28.57%)	9	NA	NA
WP_014839093.1|4351770_4354617_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	7.5e-43
WP_014839094.1|4354747_4357381_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	6.2e-92
WP_014839095.1|4357566_4358295_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_014839096.1|4358639_4360925_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	3.5e-285
WP_004852757.1|4361028_4362159_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	7.3e-175
WP_004104002.1|4362158_4362413_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
WP_014230219.1|4362605_4364150_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0SI18	Klosneuvirus	28.3	3.0e-38
WP_014230220.1|4364194_4365151_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230221.1|4365155_4366223_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	3.9e-08
>prophage 293
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4374079	4375285	6097032		Oenococcus_phage(100.0%)	1	NA	NA
WP_014839100.1|4374079_4375285_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.8e-25
>prophage 294
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4378390	4380868	6097032	transposase	Tupanvirus(50.0%)	2	NA	NA
WP_014230229.1|4378390_4379839_+	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	6.9e-101
WP_014839101.1|4379887_4380868_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.7	1.8e-73
>prophage 295
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4402436	4402988	6097032	integrase	Escherichia_phage(100.0%)	1	4392500:4392513	4404026:4404039
4392500:4392513	attL	CGAGACCAGCCAGC	NA	NA	NA	NA
WP_014839116.1|4402436_4402988_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
WP_014839116.1|4402436_4402988_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
4404026:4404039	attR	CGAGACCAGCCAGC	NA	NA	NA	NA
>prophage 296
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4422127	4422727	6097032		Salmonella_phage(100.0%)	1	NA	NA
WP_004852850.1|4422127_4422727_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 297
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4434544	4435564	6097032		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014230261.1|4434544_4435564_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	2.7e-19
>prophage 298
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4439830	4442035	6097032		Salmonella_phage(66.67%)	4	NA	NA
WP_042934138.1|4439830_4440085_+	hypothetical protein	NA	J9Q735	Salmonella_phage	44.7	3.7e-10
WP_014230267.1|4440088_4440655_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	58.3	7.2e-46
WP_046877205.1|4440722_4441220_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004852881.1|4441261_4442035_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.7	3.9e-10
>prophage 299
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4446328	4447846	6097032		Mollivirus(100.0%)	1	NA	NA
WP_004123211.1|4446328_4447846_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.4e-88
>prophage 300
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4454268	4455405	6097032		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_009654654.1|4454268_4455405_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.5e-21
>prophage 301
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4463818	4464907	6097032		Pandoravirus(100.0%)	1	NA	NA
WP_014230282.1|4463818_4464907_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 302
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4474026	4478981	6097032		Enterobacteria_phage(33.33%)	5	NA	NA
WP_014839143.1|4474026_4474923_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	77.9	1.2e-124
WP_014839144.1|4475150_4475486_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_004852922.1|4476156_4476411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839147.1|4477005_4477884_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	24.8	4.6e-07
WP_014839148.1|4478048_4478981_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.6	2.1e-10
>prophage 303
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4484142	4484886	6097032		Clostridioides_phage(100.0%)	1	NA	NA
WP_032694853.1|4484142_4484886_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.6	9.5e-14
>prophage 304
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4502811	4507058	6097032		Lactobacillus_phage(50.0%)	4	NA	NA
WP_014230310.1|4502811_4503738_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.7	2.0e-08
WP_004852990.1|4503827_4504826_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_004123346.1|4504822_4505041_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_014839158.1|4505033_4507058_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.0	2.6e-146
>prophage 305
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4510951	4512742	6097032		Hokovirus(100.0%)	1	NA	NA
WP_014839162.1|4510951_4512742_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.0	3.4e-17
>prophage 306
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4516925	4525518	6097032		Streptococcus_phage(25.0%)	10	NA	NA
WP_014230319.1|4516925_4517837_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.1	1.0e-57
WP_014839167.1|4517903_4518998_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.5	2.4e-29
WP_014230321.1|4518987_4519863_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_004123378.1|4519862_4520696_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_014230322.1|4520695_4521712_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_014839168.1|4521937_4522837_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	1.9e-24
WP_014839169.1|4522930_4523506_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_004853030.1|4523569_4524019_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_004853033.1|4524005_4524431_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_004870750.1|4524642_4525518_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	32.4	7.5e-18
>prophage 307
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4558761	4560462	6097032		Rhodococcus_phage(50.0%)	2	NA	NA
WP_014839185.1|4558761_4559628_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	34.5	9.7e-34
WP_004104417.1|4559748_4560462_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.4e-38
>prophage 308
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4567727	4569017	6097032		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004853099.1|4567727_4569017_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	9.2e-65
>prophage 309
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4572520	4574196	6097032		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_014839189.1|4572520_4573558_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.2	4.1e-71
WP_014230347.1|4573554_4574196_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.2	1.2e-28
>prophage 310
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4586636	4586828	6097032		Escherichia_phage(100.0%)	1	NA	NA
WP_009654356.1|4586636_4586828_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	73.0	1.1e-17
>prophage 311
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4590808	4592275	6097032		Klosneuvirus(100.0%)	1	NA	NA
WP_014230355.1|4590808_4592275_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	9.8e-87
>prophage 312
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4605361	4605793	6097032		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004114414.1|4605361_4605793_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 313
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4617964	4624322	6097032		Mycoplasma_phage(20.0%)	8	NA	NA
WP_014839205.1|4617964_4619251_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.6	3.4e-35
WP_004104502.1|4619357_4619558_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004104503.1|4619559_4619895_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_014839206.1|4619896_4621747_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.7	6.5e-104
WP_014839207.1|4621762_4622278_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004104506.1|4622351_4622675_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_002913991.1|4622694_4623081_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_004134936.1|4623107_4624322_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
>prophage 314
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4638644	4654278	6097032	tRNA	Bacillus_phage(33.33%)	12	NA	NA
WP_009654385.1|4638644_4639898_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	3.3e-99
WP_014839214.1|4640223_4641414_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|4641472_4641811_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_014230390.1|4641876_4643214_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.1	3.0e-10
WP_032720547.1|4643200_4643905_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_089046454.1|4643918_4645355_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.6	3.8e-11
WP_014839218.1|4645917_4649805_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	7.7e-131
WP_014839219.1|4649979_4651596_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_071846082.1|4651592_4652138_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	4.5e-05
WP_004853258.1|4652157_4652793_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_014230398.1|4653002_4653851_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004114478.1|4654017_4654278_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	3.2e-17
>prophage 315
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4657285	4660982	6097032		Micromonas_sp._RCC1109_virus(50.0%)	3	NA	NA
WP_004104573.1|4657285_4657966_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	2.8e-20
WP_014230401.1|4658192_4659167_-	signal peptidase I	NA	NA	NA	NA	NA
WP_004853275.1|4659182_4660982_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.3	6.5e-24
>prophage 316
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4666760	4671909	6097032	transposase,tRNA	Cafeteria_roenbergensis_virus(20.0%)	6	NA	NA
WP_004853282.1|4666760_4668092_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	1.1e-44
WP_004104596.1|4668136_4668520_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	69.9	3.1e-32
WP_014230405.1|4668831_4669521_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	51.2	4.6e-55
WP_014228411.1|4669604_4670039_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
WP_014839227.1|4670206_4671280_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_004104599.1|4671483_4671909_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	4.6e-13
>prophage 317
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4677208	4679236	6097032		Burkholderia_virus(50.0%)	2	NA	NA
WP_032721132.1|4677208_4678507_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
WP_032721134.1|4678780_4679236_-	DUF4385 domain-containing protein	NA	A0A222YVL1	Synechococcus_phage	47.0	2.8e-32
>prophage 318
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4685171	4687745	6097032		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014226431.1|4685171_4687745_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	3.1e-128
>prophage 319
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4694548	4695619	6097032		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_014226435.1|4694548_4695619_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	4.8e-91
>prophage 320
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4710883	4713246	6097032	integrase	Staphylococcus_phage(50.0%)	2	4703995:4704009	4717102:4717116
4703995:4704009	attL	TCAGCCTCGCGCTGA	NA	NA	NA	NA
WP_004104655.1|4710883_4711366_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.8e-29
WP_014839244.1|4712058_4713246_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.5	1.4e-104
4717102:4717116	attR	TCAGCCTCGCGCTGA	NA	NA	NA	NA
>prophage 321
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4716247	4718616	6097032		Enterobacteria_phage(100.0%)	4	NA	NA
WP_014839246.1|4716247_4716814_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_014839247.1|4716831_4717077_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	55.6	2.7e-18
WP_014839248.1|4717073_4717811_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.8	2.6e-72
WP_014839249.1|4718349_4718616_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	7.5e-30
>prophage 322
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4722521	4723421	6097032		Escherichia_virus(100.0%)	1	NA	NA
WP_014839253.1|4722521_4723421_+	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	86.3	1.4e-147
>prophage 323
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4735512	4737033	6097032		Pithovirus(100.0%)	1	NA	NA
WP_014839262.1|4735512_4737033_+	amino acid ABC transporter permease/ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	3.9e-14
>prophage 324
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4744404	4745046	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_032694815.1|4744404_4745046_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	23.9	2.6e-12
>prophage 325
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4748109	4751595	6097032		Mollivirus(50.0%)	4	NA	NA
WP_014839276.1|4748109_4748886_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.2	4.2e-12
WP_014839277.1|4749031_4749952_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004853415.1|4749991_4750765_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014839278.1|4750800_4751595_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	29.3	3.5e-06
>prophage 326
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4766897	4772188	6097032		Gordonia_phage(25.0%)	5	NA	NA
WP_004853449.1|4766897_4767143_+	glutaredoxin-like protein NrdH	NA	A0A0E3T8B5	Gordonia_phage	37.3	6.1e-10
WP_004104769.1|4767139_4767550_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_014839292.1|4767522_4769667_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	2.0e-189
WP_014839293.1|4769677_4770640_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	70.8	1.2e-130
WP_014226499.1|4770985_4772188_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.2	2.9e-28
>prophage 327
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4787058	4795375	6097032	tRNA	Vibrio_phage(20.0%)	9	NA	NA
WP_000906486.1|4787058_4787244_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_014839301.1|4787482_4790110_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	39.0	9.9e-82
WP_014226510.1|4790240_4790741_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_004104808.1|4790812_4791871_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	5.2e-114
WP_014226512.1|4791951_4792449_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.8	1.3e-27
WP_014226513.1|4792653_4792881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014226514.1|4792917_4793796_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014226515.1|4793804_4794668_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_161506263.1|4794664_4795375_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	4.8e-07
>prophage 328
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4800951	4801917	6097032		Tetraselmis_virus(100.0%)	1	NA	NA
WP_014839304.1|4800951_4801917_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.0	8.8e-36
>prophage 329
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4841867	4842689	6097032		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014226545.1|4841867_4842689_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.6e-12
>prophage 330
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4850657	4853988	6097032		Cedratvirus(33.33%)	3	NA	NA
WP_014839336.1|4850657_4851437_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.8	1.3e-10
WP_014839337.1|4851628_4852882_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	Q6A202	Oenococcus_phage	30.9	1.0e-44
WP_014226555.1|4853220_4853988_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.9	1.1e-20
>prophage 331
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4866885	4872097	6097032		Planktothrix_phage(66.67%)	3	NA	NA
WP_014226568.1|4866885_4868829_-	ABC transporter permease	NA	G9BWD6	Planktothrix_phage	39.9	1.7e-30
WP_014839348.1|4868828_4869989_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_014839349.1|4869985_4872097_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.2	6.9e-17
>prophage 332
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4882264	4884826	6097032		Catovirus(100.0%)	1	NA	NA
WP_042934154.1|4882264_4884826_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.7	4.0e-27
>prophage 333
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4890933	4894708	6097032		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_004104962.1|4890933_4891926_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_042934155.1|4892085_4893204_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	6.5e-06
WP_009651549.1|4893326_4893953_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	2.4e-34
WP_042934156.1|4893946_4894708_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.6	1.7e-58
>prophage 334
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4897781	4899814	6097032		Tupanvirus(50.0%)	2	NA	NA
WP_004853621.1|4897781_4898387_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	36.5	6.1e-27
WP_014226587.1|4898386_4899814_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.3	3.9e-32
>prophage 335
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4918986	4924311	6097032		Vibrio_phage(33.33%)	4	NA	NA
WP_004124321.1|4918986_4919658_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.5e-15
WP_014839382.1|4920118_4921228_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004105008.1|4921294_4922593_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	3.7e-130
WP_004105009.1|4922673_4924311_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	1.1e-155
>prophage 336
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4927733	4933142	6097032		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_042934162.1|4927733_4929077_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.6	1.0e-34
WP_014226598.1|4929199_4931953_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.6	2.0e-48
WP_014226599.1|4932002_4933142_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	7.2e-45
>prophage 337
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4940583	4941429	6097032		Vibrio_phage(100.0%)	1	NA	NA
WP_004853651.1|4940583_4941429_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 338
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4953829	4954585	6097032		Bacillus_phage(100.0%)	1	NA	NA
WP_014839388.1|4953829_4954585_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.1	1.6e-08
>prophage 339
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4965182	4967757	6097032	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_014226621.1|4965182_4966388_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	4.4e-69
WP_014839393.1|4966387_4966825_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_009651598.1|4966947_4967757_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.3	2.5e-15
>prophage 340
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	4972790	4973606	6097032		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_014226625.1|4972790_4973606_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.8	2.5e-07
>prophage 341
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5007491	5018605	6097032		Deep-sea_thermophilic_phage(25.0%)	5	NA	NA
WP_014226651.1|5007491_5008745_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	29.4	5.0e-15
WP_004853841.1|5008972_5010304_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_014839419.1|5010345_5012181_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	42.5	2.6e-04
WP_014839420.1|5012177_5015723_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.9	4.7e-10
WP_014839421.1|5015719_5018605_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.8	5.8e-59
>prophage 342
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5026050	5028297	6097032		Hokovirus(100.0%)	1	NA	NA
WP_014226660.1|5026050_5028297_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	22.9	1.5e-09
>prophage 343
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5033918	5043073	6097032		Staphylococcus_phage(33.33%)	7	NA	NA
WP_014839433.1|5033918_5036078_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.4	4.9e-18
WP_014839434.1|5036700_5037717_+	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_014226666.1|5037677_5038157_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004105268.1|5038153_5038927_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839435.1|5038995_5040423_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.5	4.5e-36
WP_014226668.1|5040430_5041768_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_162140818.1|5042071_5043073_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	29.9	3.4e-30
>prophage 344
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5054709	5055837	6097032		Bacillus_phage(100.0%)	1	NA	NA
WP_014226681.1|5054709_5055837_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.9	3.9e-11
>prophage 345
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5063956	5066448	6097032		Aichi_virus(50.0%)	2	NA	NA
WP_014839446.1|5063956_5065375_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.2	3.5e-25
WP_004124661.1|5065686_5066448_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	1.4e-20
>prophage 346
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5097608	5101455	6097032		Acinetobacter_phage(50.0%)	3	NA	NA
WP_004124798.1|5097608_5099162_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.8	6.6e-158
WP_014226713.1|5099659_5100082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009654966.1|5100681_5101455_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	6.8e-23
>prophage 347
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5108753	5110310	6097032		Catovirus(100.0%)	1	NA	NA
WP_014226721.1|5108753_5110310_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.2	8.7e-17
>prophage 348
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5117672	5118848	6097032		Streptococcus_phage(100.0%)	1	NA	NA
WP_014839477.1|5117672_5118848_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.8	7.7e-42
>prophage 349
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5123989	5126124	6097032		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_014839481.1|5123989_5124415_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	1.2e-50
WP_014839482.1|5124428_5125721_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.8	7.4e-171
WP_014839483.1|5125773_5126124_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.4	1.3e-24
>prophage 350
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5131413	5132094	6097032		Bacillus_phage(100.0%)	1	NA	NA
WP_014839488.1|5131413_5132094_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	1.7e-30
>prophage 351
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5139295	5140147	6097032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014839495.1|5139295_5140147_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.0	1.5e-47
>prophage 352
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5143155	5148545	6097032	integrase	Erwinia_phage(25.0%)	6	5141900:5141914	5149348:5149362
5141900:5141914	attL	ACCGGCTTCCGTAGG	NA	NA	NA	NA
WP_014839499.1|5143155_5143407_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	55.8	4.5e-08
WP_042934170.1|5143463_5143832_+	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	29.8	1.1e-05
WP_014839500.1|5144178_5145099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839501.1|5145088_5146219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839502.1|5146330_5147500_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.9	5.1e-139
WP_004854045.1|5147819_5148545_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.0	2.5e-11
5149348:5149362	attR	ACCGGCTTCCGTAGG	NA	NA	NA	NA
>prophage 353
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5153202	5159285	6097032	tRNA	Catovirus(25.0%)	5	NA	NA
WP_004134430.1|5153202_5154720_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	7.7e-87
WP_100248296.1|5154729_5155828_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_014226791.1|5155913_5157647_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	1.6e-59
WP_004854054.1|5157652_5158366_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004105555.1|5158388_5159285_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.6e-31
>prophage 354
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5171525	5177427	6097032		Pandoravirus(50.0%)	4	NA	NA
WP_014839512.1|5171525_5172959_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	5.7e-31
WP_004854083.1|5173149_5173641_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_025105965.1|5173749_5174493_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014839514.1|5174553_5177427_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.4	3.3e-264
>prophage 355
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5185603	5186836	6097032		Catovirus(100.0%)	1	NA	NA
WP_004115297.1|5185603_5186836_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	1.4e-102
>prophage 356
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5204329	5204986	6097032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014226824.1|5204329_5204986_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	4.8e-09
>prophage 357
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5212261	5213416	6097032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014226830.1|5212261_5213416_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	8.1e-129
>prophage 358
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5231432	5232515	6097032		Geobacillus_virus(100.0%)	1	NA	NA
WP_014226844.1|5231432_5232515_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	38.1	3.8e-11
>prophage 359
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5238787	5251008	6097032		Clostridium_phage(20.0%)	12	NA	NA
WP_042934178.1|5238787_5239339_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.7	2.8e-34
WP_042934179.1|5239364_5239703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839544.1|5239825_5240902_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	31.0	2.4e-34
WP_014839546.1|5241409_5241871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113705933.1|5241893_5242058_-	ash family protein	NA	NA	NA	NA	NA
WP_014839547.1|5242428_5243322_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_042934413.1|5243326_5245915_+	DEAD/DEAH box helicase	NA	M1ILW8	Acanthocystis_turfacea_Chlorella_virus	31.2	1.9e-08
WP_014839549.1|5245950_5247093_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	29.0	9.8e-10
WP_014839550.1|5247703_5249092_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_014839551.1|5249154_5249361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014226848.1|5249361_5249604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839553.1|5249637_5251008_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	35.4	4.3e-44
>prophage 360
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5270170	5280113	6097032		Staphylococcus_phage(25.0%)	7	NA	NA
WP_014226865.1|5270170_5270998_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	4.2e-63
WP_014226867.1|5271646_5273830_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	4.5e-104
WP_004854230.1|5273950_5275363_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_004125254.1|5275447_5276185_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_014839567.1|5276377_5278636_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	9.8e-86
WP_009651841.1|5278758_5279628_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839568.1|5279705_5280113_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	52.2	1.5e-21
>prophage 361
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5283404	5285300	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_004854242.1|5283404_5285300_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.9	1.4e-90
>prophage 362
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5289622	5291457	6097032		Erwinia_phage(50.0%)	2	NA	NA
WP_004125303.1|5289622_5290291_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.1	4.7e-36
WP_014839571.1|5290296_5291457_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.2	3.7e-89
>prophage 363
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5298787	5302072	6097032		Staphylococcus_phage(50.0%)	4	NA	NA
WP_004854262.1|5298787_5299441_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	1.2e-44
WP_004854265.1|5299819_5300101_+	ubiquinone biosynthesis accessory factor UbiK	NA	NA	NA	NA	NA
WP_004854266.1|5300155_5300365_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_014839576.1|5300638_5302072_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.6	1.5e-39
>prophage 364
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5307183	5308425	6097032		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_014226887.1|5307183_5308425_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.6	2.7e-90
>prophage 365
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5317609	5323298	6097032	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_014839584.1|5317609_5318623_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	5.3e-108
WP_001144069.1|5318984_5319200_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014226898.1|5319434_5321180_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	4.1e-76
WP_004105908.1|5321453_5323298_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 366
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5336616	5342936	6097032	tRNA	Klosneuvirus(50.0%)	4	NA	NA
WP_004854393.1|5336616_5337996_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	9.0e-34
WP_014226909.1|5338033_5338366_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_014226910.1|5338585_5339569_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_014839595.1|5339843_5342936_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.7	1.8e-159
>prophage 367
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5351635	5352553	6097032		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_014839602.1|5351635_5352553_+	hypothetical protein	NA	A0A2H4J6N0	uncultured_Caudovirales_phage	27.0	3.8e-20
>prophage 368
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5357566	5359054	6097032		Bacillus_phage(100.0%)	1	NA	NA
WP_014839605.1|5357566_5359054_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W8CYL7	Bacillus_phage	28.6	1.6e-07
>prophage 369
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5371521	5372490	6097032		Escherichia_phage(100.0%)	1	NA	NA
WP_014839614.1|5371521_5372490_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	34.9	5.9e-40
>prophage 370
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5388774	5389920	6097032		Streptococcus_phage(100.0%)	1	NA	NA
WP_014226948.1|5388774_5389920_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	38.6	2.2e-46
>prophage 371
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5406144	5416297	6097032		Escherichia_phage(16.67%)	12	NA	NA
WP_014226962.1|5406144_5406918_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	2.6e-22
WP_014226963.1|5406982_5407972_-	Fic family protein	NA	NA	NA	NA	NA
WP_014226964.1|5407976_5408840_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.2	2.1e-49
WP_014226965.1|5408903_5410985_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_014226966.1|5410942_5411329_+	YraN family protein	NA	NA	NA	NA	NA
WP_002918211.1|5411351_5411942_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_004125578.1|5411951_5412527_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_014226967.1|5412634_5413675_-	permease	NA	NA	NA	NA	NA
WP_004854517.1|5414525_5415044_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.0	2.4e-11
WP_014226969.1|5415023_5415467_-	YhbP family protein	NA	NA	NA	NA	NA
WP_014226970.1|5415522_5415807_+	GIY-YIG nuclease family protein	NA	A0A120L170	Cnaphalocrocis_medinalis_granulovirus	50.6	5.8e-12
WP_004125592.1|5415793_5416297_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	32.7	1.7e-14
>prophage 372
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5421491	5423453	6097032		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_014839626.1|5421491_5423453_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	4.7e-52
>prophage 373
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5428852	5440492	6097032	protease	Cafeteria_roenbergensis_virus(25.0%)	8	NA	NA
WP_004106093.1|5428852_5431543_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.6	3.9e-25
WP_004854539.1|5431567_5433055_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004125659.1|5433082_5433535_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_014226976.1|5434126_5435470_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	94.4	1.6e-64
WP_004106103.1|5435721_5436051_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_014226977.1|5436280_5437618_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_014226978.1|5437610_5438459_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.0	3.7e-22
WP_004854549.1|5438557_5440492_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	9.2e-117
>prophage 374
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5447079	5448521	6097032		Indivirus(50.0%)	2	NA	NA
WP_004854564.1|5447079_5448051_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.4	1.3e-07
WP_004854566.1|5448248_5448521_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.3	1.3e-16
>prophage 375
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5452580	5466563	6097032		Staphylococcus_phage(28.57%)	16	NA	NA
WP_004125691.1|5452580_5453393_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.8	6.3e-19
WP_004854581.1|5453602_5454580_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004854583.1|5454594_5455581_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	32.2	3.5e-40
WP_004854584.1|5455595_5456162_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	82.8	1.3e-58
WP_004854587.1|5456158_5456734_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004125703.1|5456702_5457248_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_004125705.1|5457254_5457980_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_004854591.1|5458027_5459461_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004125711.1|5459483_5459771_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_004854593.1|5459836_5460325_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004106169.1|5460370_5461225_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_004106170.1|5461221_5461494_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_014226984.1|5461546_5462272_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_014226985.1|5462268_5462922_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_014839635.1|5463156_5465496_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	6.0e-38
WP_014226987.1|5465627_5466563_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.3	2.9e-15
>prophage 376
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5478779	5479268	6097032	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_014226996.1|5478779_5479268_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.7	4.9e-27
>prophage 377
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5483172	5484540	6097032	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_014226999.1|5483172_5484540_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	24.2	4.3e-20
>prophage 378
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5491688	5492957	6097032		Oenococcus_phage(100.0%)	1	NA	NA
WP_014839648.1|5491688_5492957_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.5	4.0e-60
>prophage 379
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5511850	5512894	6097032		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|5511850_5512894_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 380
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5541790	5543262	6097032	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_014839661.1|5541790_5542300_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_014839662.1|5542314_5543262_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.8	1.7e-07
>prophage 381
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5563143	5568715	6097032		Tupanvirus(33.33%)	7	NA	NA
WP_004097636.1|5563143_5564328_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
WP_004115957.1|5564398_5566513_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.2	6.2e-58
WP_004106370.1|5566609_5567080_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_002920115.1|5567175_5567550_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_025107828.1|5567674_5567962_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_004854839.1|5567969_5568329_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_004854840.1|5568328_5568715_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	9.3e-21
>prophage 382
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5574344	5587196	6097032		Tupanvirus(14.29%)	12	NA	NA
WP_014839671.1|5574344_5576249_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.1	3.8e-75
WP_042934420.1|5576310_5577801_-	nicotinate phosphoribosyltransferase	NA	K4F7Y4	Cronobacter_phage	49.9	2.0e-140
WP_014839673.1|5577805_5578675_-	ribose-phosphate pyrophosphokinase	NA	A0A2P1CBA5	Salmonella_phage	41.3	3.1e-48
WP_014227046.1|5578871_5579591_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	27.3	3.3e-19
WP_162140819.1|5579696_5580695_+	hydrolase	NA	NA	NA	NA	NA
WP_004125965.1|5580691_5580910_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	38.8	4.0e-05
WP_004854874.1|5580945_5581818_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_004854875.1|5581861_5582266_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242758.1|5582570_5583203_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_014839675.1|5583254_5585333_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	86.2	1.8e-62
WP_014839676.1|5585322_5586543_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_014227049.1|5586632_5587196_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.1	4.3e-59
>prophage 383
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5599510	5600338	6097032		Vibrio_phage(100.0%)	1	NA	NA
WP_014227055.1|5599510_5600338_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	51.1	1.2e-70
>prophage 384
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5615259	5621437	6097032		Staphylococcus_phage(50.0%)	3	NA	NA
WP_014227066.1|5615259_5616882_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.9	4.5e-141
WP_014839693.1|5616942_5619036_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_009654839.1|5619046_5621437_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	1.2e-14
>prophage 385
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5624927	5625686	6097032		Escherichia_phage(100.0%)	1	NA	NA
WP_004106478.1|5624927_5625686_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	3.0e-23
>prophage 386
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5628696	5631144	6097032		Dickeya_phage(100.0%)	1	NA	NA
WP_014227071.1|5628696_5631144_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.6e-33
>prophage 387
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5648838	5650646	6097032		Enterococcus_phage(50.0%)	2	NA	NA
WP_014839700.1|5648838_5649579_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	26.1	3.1e-12
WP_014839701.1|5649575_5650646_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 388
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5658985	5660484	6097032		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
WP_004126158.1|5658985_5659699_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	7.2e-11
WP_004855045.1|5659716_5660484_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.4e-14
>prophage 389
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5669498	5675259	6097032		Klosneuvirus(25.0%)	5	NA	NA
WP_014839711.1|5669498_5670764_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	3.7e-26
WP_014839712.1|5670881_5672396_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.9	1.5e-13
WP_004106554.1|5672428_5673283_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_014227095.1|5673539_5674598_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004106557.1|5674590_5675259_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	9.5e-13
>prophage 390
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5678352	5682418	6097032		Dickeya_phage(50.0%)	4	NA	NA
WP_004855080.1|5678352_5678979_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	62.8	5.5e-31
WP_014839714.1|5679057_5681262_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.0	9.4e-118
WP_004106582.1|5681340_5681586_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
WP_004126198.1|5681752_5682418_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	6.2e-57
>prophage 391
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5705010	5709117	6097032		Tupanvirus(66.67%)	3	NA	NA
WP_014227124.1|5705010_5706996_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	1.6e-20
WP_004126208.1|5706992_5707976_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	32.7	2.8e-37
WP_004855110.1|5707977_5709117_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.2	2.3e-27
>prophage 392
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5715528	5716299	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_014227132.1|5715528_5716299_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.0	6.6e-18
>prophage 393
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5719466	5720420	6097032		Cedratvirus(100.0%)	1	NA	NA
WP_014227135.1|5719466_5720420_+	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	33.9	5.6e-35
>prophage 394
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5732604	5734647	6097032		Indivirus(100.0%)	1	NA	NA
WP_014839726.1|5732604_5734647_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	2.9e-44
>prophage 395
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5745626	5747704	6097032		Bacillus_phage(100.0%)	2	NA	NA
WP_001157751.1|5745626_5746346_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_014839734.1|5746342_5747704_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	9.6e-12
>prophage 396
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5778299	5779412	6097032	transposase	Phage_Gifsy-1(100.0%)	1	NA	NA
WP_032694189.1|5778299_5779412_+|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	88.6	9.4e-191
>prophage 397
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5795989	5802201	6097032		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_014227182.1|5795989_5798101_-	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	33.9	5.6e-35
WP_014227183.1|5798121_5798925_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_042934215.1|5798915_5799494_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_014227185.1|5800207_5801221_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	2.5e-17
WP_014227186.1|5801217_5802201_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	1.5e-14
>prophage 398
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5819923	5820895	6097032		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_009652700.1|5819923_5820895_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.5	1.4e-17
>prophage 399
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5824253	5826184	6097032		Morganella_phage(50.0%)	2	NA	NA
WP_004126446.1|5824253_5824466_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	71.4	6.0e-22
WP_014227198.1|5824564_5826184_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	25.4	2.8e-26
>prophage 400
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5830570	5831566	6097032		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_014227201.1|5830570_5831566_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.2	8.6e-10
>prophage 401
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5836507	5838049	6097032		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014227206.1|5836507_5838049_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	1.0e-17
>prophage 402
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5859412	5861254	6097032		Tupanvirus(100.0%)	1	NA	NA
WP_014839778.1|5859412_5861254_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.1	2.0e-12
>prophage 403
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5877386	5886533	6097032		Rhizobium_phage(20.0%)	9	NA	NA
WP_004106850.1|5877386_5877638_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	7.6e-16
WP_004126582.1|5877749_5878181_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_014839784.1|5878426_5879971_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_025107808.1|5879980_5881252_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	33.9	2.1e-08
WP_025107809.1|5881255_5882191_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_042934221.1|5882187_5882985_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004855475.1|5883145_5884171_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.0e-18
WP_014839786.1|5884180_5885374_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	2.9e-36
WP_014227239.1|5885588_5886533_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.1	8.6e-36
>prophage 404
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5899395	5904134	6097032		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_004106901.1|5899395_5899872_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.7	2.4e-26
WP_014839792.1|5899995_5900805_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.6	3.8e-24
WP_003024094.1|5901004_5901172_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002436699.1|5901192_5901429_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004126657.1|5901645_5902311_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_014227252.1|5902486_5903698_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.8	5.8e-45
WP_004855506.1|5903675_5904134_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	58.8	2.4e-47
>prophage 405
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5909701	5914728	6097032		Pseudomonas_phage(33.33%)	4	NA	NA
WP_014839798.1|5909701_5911378_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.9	2.1e-21
WP_004126677.1|5911635_5912259_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.2	2.6e-20
WP_004106927.1|5912313_5912589_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004855514.1|5912607_5914728_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	2.8e-10
>prophage 406
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5925844	5926696	6097032		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004855525.1|5925844_5926696_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	1.3e-14
>prophage 407
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5930062	5931454	6097032		environmental_Halophage(100.0%)	1	NA	NA
WP_004855527.1|5930062_5931454_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.9	1.6e-67
>prophage 408
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5952385	5957464	6097032		Wolbachia_phage(50.0%)	6	NA	NA
WP_071886348.1|5952385_5953414_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	46.6	3.8e-77
WP_014839812.1|5953570_5954176_-	shikimate kinase	NA	NA	NA	NA	NA
WP_038424928.1|5954363_5954831_+	DUF3237 domain-containing protein	NA	NA	NA	NA	NA
WP_014839814.1|5954943_5955951_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014839815.1|5955952_5956255_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014227281.1|5956414_5957464_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.2	4.5e-70
>prophage 409
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5973069	5974236	6097032		Salmonella_phage(100.0%)	1	NA	NA
WP_014839828.1|5973069_5974236_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	5.0e-25
>prophage 410
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5978723	5979689	6097032	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_014839832.1|5978723_5979689_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.8	3.9e-68
>prophage 411
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	5986975	5988088	6097032		Bacillus_virus(100.0%)	1	NA	NA
WP_042934228.1|5986975_5988088_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	9.5e-26
>prophage 412
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	6000521	6005863	6097032		Micromonas_sp._RCC1109_virus(50.0%)	6	NA	NA
WP_004855639.1|6000521_6002210_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	6.9e-60
WP_004107123.1|6002312_6002408_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_004107126.1|6002989_6003079_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_014839843.1|6003150_6003597_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014227319.1|6003667_6004501_+	EamA family transporter	NA	NA	NA	NA	NA
WP_004855651.1|6004678_6005863_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.7	2.9e-12
>prophage 413
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	6017259	6018220	6097032		Synechococcus_phage(50.0%)	2	NA	NA
WP_014227324.1|6017259_6017688_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.3	2.5e-14
WP_004126917.1|6017806_6018220_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	35.4	1.3e-17
>prophage 414
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	6021717	6022866	6097032		Oenococcus_phage(100.0%)	1	NA	NA
WP_014227329.1|6021717_6022866_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	4.7e-52
>prophage 415
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	6028297	6035816	6097032		Bacillus_virus(33.33%)	7	NA	NA
WP_004126944.1|6028297_6030712_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.9	4.8e-115
WP_004126948.1|6030740_6031814_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004107206.1|6031952_6033053_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.3	6.9e-53
WP_004871826.1|6033057_6034458_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004871828.1|6035079_6035220_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004871829.1|6035235_6035595_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004871831.1|6035558_6035816_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	7.1e-17
>prophage 416
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	6043291	6044629	6097032		Moraxella_phage(100.0%)	1	NA	NA
WP_014839859.1|6043291_6044629_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	36.4	5.8e-62
>prophage 417
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	6050508	6058111	6097032		Bacillus_phage(25.0%)	6	NA	NA
WP_004855746.1|6050508_6051282_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.1	9.9e-14
WP_004855748.1|6051329_6052220_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004107261.1|6052219_6053179_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004127017.1|6053371_6054412_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.4	4.0e-50
WP_014227346.1|6054728_6056558_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.7	1.6e-126
WP_014839862.1|6056740_6058111_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.8	1.9e-36
>prophage 418
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	6072692	6073685	6097032		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_014839868.1|6072692_6073685_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	3.2e-49
>prophage 419
NC_018106	Klebsiella michiganensis E718, complete sequence	6097032	6076854	6082733	6097032		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_014227355.1|6076854_6078723_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	1.4e-66
WP_014227356.1|6078908_6079328_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_014227357.1|6079338_6080844_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.5	6.9e-19
WP_004855792.1|6080849_6081815_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_004855794.1|6081842_6082733_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	24.5	7.4e-05
>prophage 1
NC_021501	Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence	110781	31	54563	110781	transposase,integrase	Escherichia_phage(18.75%)	44	39694:39753	50979:51237
WP_015493080.1|31_454_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493081.1|453_1725_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_016479949.1|1860_2832_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493083.1|2828_4034_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_016479950.1|4396_5029_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.7	1.6e-06
WP_000654811.1|5089_6058_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_157872492.1|6165_6750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157872493.1|6884_7529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001752311.1|7741_8773_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_157872494.1|8794_9271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016479952.1|11284_13288_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_016479953.1|13377_14622_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_001067855.1|16640_17345_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_016479955.1|17378_19961_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	1.6e-23
WP_032934863.1|21732_21951_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_008322213.1|21952_22258_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_008322211.1|22259_22574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322208.1|22563_23355_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.4	1.4e-50
WP_016479957.1|23553_24876_-	GntP family transporter	NA	NA	NA	NA	NA
WP_089046468.1|25812_26933_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.0e-51
WP_022652311.1|28673_29663_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	61.2	5.0e-103
WP_022652312.1|30518_30788_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_016479963.1|30791_31322_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087728544.1|31453_32470_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_004201176.1|34120_35761_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_004201172.1|35816_36107_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201171.1|36300_36630_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201169.1|36634_37666_+	protein-disulfide reductase DsbD N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004201168.1|37676_38315_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|38319_38685_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201164.1|38688_39501_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
39694:39753	attL	TAGGGGTCAGTTTGGATATAGAGAATTATTGTACGGTAAGCCTGTTTTTTGAACAGACTT	NA	NA	NA	NA
WP_000855769.1|40058_40904_-	RmtC family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_003149906.1|41200_42730_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032072922.1|43472_44234_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_016479967.1|44267_44954_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
WP_015460531.1|44950_45883_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_015460530.1|45884_46850_+	TniQ family protein	NA	NA	NA	NA	NA
WP_032072921.1|47228_48068_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.5	2.9e-11
WP_000376617.1|48195_48438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001183923.1|48521_48821_-	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_032072920.1|50370_51030_+	endonuclease III	NA	NA	NA	NA	NA
WP_001145102.1|52182_53175_-	hypothetical protein	NA	NA	NA	NA	NA
50979:51237	attR	TAGGGGTCAGTTTGGATATAGAGAATTATTGTACGGTAAGCCTGTTTTTTGAACAGACTTACCTATAGCAATAGGGTGTCCTCCCGCGCTATACGGCATTTTCAGAGGTTTGACCTTAATCGGATAACCTAAATGCGATACTGCAAGAGCGACAACTTAAAAGCGATAGCCACTGACGCAAAATCAACCACTTACGAACCAAGATTGGTTAAATAATGCGCTTAACGTACAAAAATTTCCGTTCTCCAAACTGACCCCT	NA	NA	NA	NA
WP_000074143.1|53223_53379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|53582_54563_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NC_018107	Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence	353865	818	55498	353865	protease,transposase,integrase	uncultured_Caudovirales_phage(28.0%)	55	48178:48237	54334:55531
WP_001067855.1|818_1523_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004118538.1|2099_2432_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011977829.1|2785_3934_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_004118534.1|4207_4582_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_001549953.1|5110_6307_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118529.1|6378_7206_-	universal stress protein	NA	NA	NA	NA	NA
WP_001549885.1|7224_8703_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_001549886.1|9186_9540_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549887.1|9635_10919_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549888.1|10968_11397_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_025801347.1|11454_12168_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.4	5.1e-97
WP_001067855.1|12385_13090_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001239317.1|13169_13670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477564.1|18437_19028_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|19164_19737_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_014839878.1|19773_21165_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_000248278.1|21315_21543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632382.1|21804_22245_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_004189161.1|22241_22592_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_014839879.1|22622_24215_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	1.2e-175
WP_000587837.1|24772_25315_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|25327_26188_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001352368.1|26330_27539_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001389365.1|27811_28576_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000993245.1|28813_29026_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087807.1|29091_29328_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|29324_29690_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|29707_31393_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|31431_31857_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|31884_32160_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|32175_32541_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|32612_33068_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_017901326.1|33198_33738_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_017901327.1|33734_33926_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_017901328.1|34104_34578_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_014839881.1|34580_35804_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_014839882.1|35814_36771_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_024266325.1|36770_37850_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.5	5.6e-39
WP_014839883.1|37851_38625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839884.1|38617_39760_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.5	6.3e-33
WP_014839885.1|39771_40830_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_014839886.1|41141_41726_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	29.0	4.5e-11
WP_014839887.1|41722_42886_+	TerD family protein	NA	NA	NA	NA	NA
WP_014839888.1|42908_43364_+	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_014839889.1|43387_44428_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.8	5.5e-76
WP_014839890.1|44478_45057_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_014839891.1|45800_47042_+	VWA domain-containing protein	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.5	8.2e-10
WP_014839892.1|47069_47720_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
48178:48237	attL	AGGGAAGGTGCGAATAAGCGGGGAAATTCTTCTCGGCTGACTCAGTCATTTCATTTCTTC	NA	NA	NA	NA
WP_014839893.1|48325_49342_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
WP_001752311.1|49556_50588_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_017901373.1|51112_51298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252868.1|51313_51463_-	DinI-like family protein	NA	NA	NA	NA	NA
WP_017901372.1|51626_52730_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	62.1	1.0e-120
WP_071600436.1|52788_53502_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014839893.1|54481_55498_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
54334:55531	attR	AGGGAAGGTGCGAATAAGCGGGGAAATTCTTCTCGGCTGACTCAGTCATTTCATTTCTTCATGTTTGAGCCGATTTTTTCTCCCGTAAATGCCTTGAATCAGCCTATTTAGACCGTTTCTTCGCCATTTAAGGCGTTATCCCCAGTTTTTAGTGAGATCTCTCCCACTGACGTATCATTTGGTCCGCCCGAAACAGGTTGGCCAGCGTGAATAACATCGCCAGTTGGTTATCGTTTTTCAGCAACCCCTTGTATCTGGCTTTCACGAAGCCGAACTGTCGCTTGATGATGCGAAATGGGTGCTCCACCTTGGCCCGGATGCTGGCTTTCATGTATTCGATGTTGATGGCCGTTTTGTTCTTGCGTGGATGCTGTTTCAAGGTTCTTACCTTGCCGGGGCGCTCGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGCGCCCCTTGGTAGCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGCAGCAGATTACCCAGCTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACCAGGCTGTGGGTCAGGCCACTCTTGGCATCGACACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTGATGCATCTCCGGATCGCGTTGCTGCTCTTTGTTCTTGGTCGAGCTGGGTGCCTCAATGATGGTGGCATCGACCAAGGTGCCTTGAGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATTGATGGTCTTGAACAATTGGCGGGCCAGTTGATGCTGCTCCAGCAGGTGGCGGAAATTCATGATGGTGGTGCGGTCAGGCAAGGCGCTATCCAGGGATAACCGGGCAAACCGACGCATGGAGGCGATTTCGTACAGAGCATCTTCCATCGCGCCATCGCTCAGGTTGTACCAATGCTGCATGCAGTGAATGCGTAGCATGGTTTCCAGCGGATAAGGTCGCCGGCCATTACCAGCCTTGGGGTAAAACGGCTCGATGACTTCCACCATGTTTTGCCATGGCAGAATCTGCTCCATACGGGACAAGAAAATCTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAAGGTAAGTTGATGACTCATGATGAACCCTGTTCCATGGCTCCAGATGACAAACATGATCTCATATCAGGGACTTGTTCGCACCTTCCT	NA	NA	NA	NA
>prophage 2
NC_018107	Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence	353865	70249	176691	353865	transposase,integrase	Escherichia_phage(19.23%)	96	102248:102264	173995:174011
WP_001567368.1|70249_71653_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_014839900.1|71993_72242_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014839901.1|72231_72516_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	54.8	2.9e-19
WP_042934526.1|72706_73183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934501.1|73188_73866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934502.1|73882_74602_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_014839902.1|74842_75445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839903.1|76042_76987_-	DsbA family protein	NA	NA	NA	NA	NA
WP_125316032.1|77049_77259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934503.1|77322_77664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839905.1|77677_77983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934505.1|77999_78728_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_042934506.1|78860_79454_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_042934508.1|79754_83105_-	viral (Super1) RNA helicase	NA	NA	NA	NA	NA
WP_125316029.1|83516_83798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839906.1|83869_87814_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014839907.1|87815_89225_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_014839908.1|89214_90252_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_024266295.1|90610_91153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900906.1|91169_91694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900905.1|91887_92643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900904.1|93250_93715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839910.1|93714_94524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839911.1|94538_97475_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_014839912.1|97464_99591_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_014839913.1|99593_100691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024266292.1|100703_101378_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_014839915.1|101386_102523_+	S49 family peptidase	NA	A0A0K2FHL6	Achromobacter_phage	30.2	2.0e-10
102248:102264	attL	GCAGGAAAGTTACTTTC	NA	NA	NA	NA
WP_017900900.1|102529_103303_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	32.1	6.0e-11
WP_014839917.1|103354_103711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839918.1|104338_104686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900898.1|104847_105252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025999308.1|105419_105707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900896.1|105796_106012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839919.1|107546_107924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009653249.1|108284_109256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009653224.1|109796_110057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900895.1|110264_110426_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_004220208.1|110497_111577_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_014839920.1|113288_114563_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.8	2.2e-143
WP_052626781.1|114571_114928_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.7	5.0e-21
WP_014839921.1|115481_117275_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014839922.1|117784_118852_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_042934513.1|118860_119331_-	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_042934515.1|119323_121057_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_014839923.1|121053_122097_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_014839924.1|122235_122811_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_001067855.1|122958_123663_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000792636.1|123755_124289_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_014839925.1|124461_124776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|125030_125387_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|125376_125778_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|125774_126065_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000427623.1|126508_127513_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_014839926.1|127633_128593_-	cation transporter	NA	A0A1V0SED0	Indivirus	25.3	4.5e-08
WP_011638900.1|128612_129179_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	64.6	2.2e-58
WP_001067855.1|129283_129988_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001752509.1|130314_130815_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_014839927.1|131131_132112_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_000780222.1|132389_132671_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|132651_132981_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_001067855.1|134022_134727_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000155092.1|136511_137396_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|137451_138927_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_002001451.1|139325_140510_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_002026779.1|140558_140744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252464.1|140963_141245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359986.1|141225_141999_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_000050481.1|143397_144939_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|145343_146183_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|146176_146524_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|146687_147479_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|147484_147775_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|147886_148384_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_011091028.1|150514_151390_+	class A extended-spectrum beta-lactamase CTX-M-3	NA	A0A1B0VBP7	Salmonella_phage	82.1	5.4e-125
WP_013023839.1|151436_151913_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001235713.1|153215_153773_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|153936_156942_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001749986.1|157245_157698_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_032488579.1|157794_158349_-	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_000845048.1|158640_159654_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001162012.1|159959_160517_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|160519_163492_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000427614.1|163570_164575_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_014839931.1|164903_165245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900953.1|165828_166434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839932.1|167005_167890_+	hypothetical protein	NA	A0A1B0VDL5	Salmonella_phage	41.1	9.8e-50
WP_017900677.1|169647_169902_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_014839933.1|170075_171209_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_024266348.1|171269_171587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024266349.1|171622_172681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839934.1|172684_173008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839935.1|173007_173763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839936.1|173759_174719_-	DNA replication protein	NA	NA	NA	NA	NA
173995:174011	attR	GCAGGAAAGTTACTTTC	NA	NA	NA	NA
WP_017901130.1|175177_175621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839937.1|175722_176691_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.2	2.6e-181
>prophage 3
NC_018107	Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence	353865	271912	321271	353865	transposase,integrase	Escherichia_phage(36.36%)	53	263204:263218	317976:317990
263204:263218	attL	TCAGCTGCTGGCCGG	NA	NA	NA	NA
WP_000343760.1|271912_273133_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_017900716.1|273363_273708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839965.1|274402_274939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900715.1|275014_275218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900714.1|275301_275778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900713.1|276254_276836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900712.1|276852_277146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025999287.1|277179_277761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839966.1|278148_279018_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_014839967.1|279071_279392_+	hypothetical protein	NA	J9Q750	Salmonella_phage	53.8	8.2e-31
WP_014839968.1|280073_280277_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	64.2	2.8e-16
WP_025999286.1|280319_280931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839969.1|280995_281241_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	65.8	6.1e-18
WP_017900706.1|281568_282303_+	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	36.3	9.4e-14
WP_014839970.1|282568_282793_+	hypothetical protein	NA	B1GS76	Salmonella_phage	51.2	2.3e-08
WP_017900705.1|282796_283870_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.8	1.1e-18
WP_017900703.1|284286_284694_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	56.1	3.5e-18
WP_017900702.1|284690_284975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839971.1|285464_285677_+	hypothetical protein	NA	J9Q804	Salmonella_phage	50.0	3.0e-13
WP_017900701.1|285933_286566_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	55.9	1.5e-28
WP_017900700.1|286605_287127_+	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	68.5	5.4e-64
WP_009654227.1|287219_287507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654204.1|287759_288080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900698.1|288169_288604_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	28.3	4.3e-06
WP_017900697.1|288689_289322_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	41.2	8.3e-27
WP_025999285.1|289603_289948_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_017900695.1|289944_290190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099501131.1|290263_290653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839972.1|290741_290906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654205.1|292897_293320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654202.1|293312_293495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900692.1|293487_293907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900691.1|293930_294368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900690.1|294463_294955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900689.1|295458_295872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343760.1|296212_297433_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_014839973.1|297499_297922_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	1.8e-30
WP_014839974.1|298094_300323_-	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_017900685.1|300319_301501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900684.1|301637_302498_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_014839975.1|302505_303024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162893507.1|303063_304287_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001067855.1|307951_308656_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|311968_312673_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_049824851.1|312682_313153_+	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_014839978.1|313172_313961_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014839979.1|313960_314479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|314483_314900_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|315285_315990_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839981.1|317623_318526_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	4.5e-159
317976:317990	attR	CCGGCCAGCAGCTGA	NA	NA	NA	NA
WP_002210513.1|318787_319549_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|319569_320430_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|320566_321271_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
