The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010280	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 chromosome, complete genome	4864348	180231	217077	4864348	protease,integrase,portal,lysis,terminase,head,tail	Salmonella_phage(45.61%)	58	180142:180166	217346:217370
180142:180166	attL	CTGCTTTTTTATACTAAGTTGAACG	NA	NA	NA	NA
WP_000533680.1|180231_181302_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	99.6	3.0e-154
WP_001556007.1|181279_181498_-	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_001060559.1|181674_182649_-	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	44.0	5.2e-28
WP_000208026.1|182718_182952_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	91.1	6.0e-15
WP_000161224.1|182955_183174_-	DUF4014 family protein	NA	C6ZR28	Salmonella_phage	97.2	7.0e-34
WP_000065091.1|183175_183772_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	55.2	8.7e-42
WP_020924094.1|183768_184293_-	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	64.8	1.6e-39
WP_001214773.1|184304_184478_-	DUF2737 family protein	NA	A0A2H4FUQ1	Salmonella_phage	96.5	2.1e-25
WP_001111323.1|184488_184782_-	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	100.0	5.5e-50
WP_001016182.1|184797_185346_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
WP_000168278.1|185842_186301_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	89.0	2.6e-70
WP_001046987.1|186301_187009_-	recombinase	NA	B8K1D9	Salmonella_phage	96.2	6.7e-134
WP_000902091.1|187005_187149_-	hypothetical protein	NA	I6S1M5	Salmonella_phage	100.0	4.2e-19
WP_000156731.1|187138_187327_-	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_001670815.1|187307_187481_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	100.0	8.9e-24
WP_071882771.1|187675_188686_-	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	80.4	7.2e-73
WP_000246166.1|188769_188964_-	Restriction inhibitor protein ral	NA	A0A2H4FS18	Salmonella_phage	100.0	2.5e-30
WP_000915090.1|189088_189226_-	hypothetical protein	NA	Q716D9	Shigella_phage	100.0	1.3e-22
WP_000219336.1|189234_189540_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	92.8	1.3e-25
WP_000233126.1|189907_190276_-	hypothetical protein	NA	K7PJJ3	Enterobacteria_phage	100.0	1.3e-56
WP_000428318.1|190294_191011_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000620665.1|191117_191312_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_001177653.1|191420_191699_+	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_000220588.1|191733_192378_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_000050079.1|192364_193207_+	replication protein	NA	K7PGT1	Enterobacteria_phage	94.2	1.0e-128
WP_000171135.1|193209_194055_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	73.6	2.1e-110
WP_000145948.1|194051_194342_+	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_001036029.1|194338_194608_+	hypothetical protein	NA	G9L682	Escherichia_phage	98.9	1.9e-44
WP_000796285.1|194680_195007_+	hypothetical protein	NA	Q716D0	Shigella_phage	99.1	4.2e-59
WP_000049638.1|195003_195204_+	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
WP_000344578.1|195215_195467_+	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	64.3	1.1e-22
WP_000736889.1|195691_196129_+	recombination protein NinB	NA	A0A192Y6T2	Salmonella_phage	98.6	9.4e-78
WP_000679702.1|196125_196299_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113769.1|196265_196442_+	NinE family protein	NA	Q5G8S3	Enterobacteria_phage	100.0	3.0e-27
WP_000566850.1|196438_196618_+	protein ninF	NA	I6R994	Salmonella_phage	94.9	1.1e-27
WP_001224087.1|196592_197201_+	protein ninG	NA	I6S604	Salmonella_phage	95.0	2.9e-93
WP_001028837.1|197197_197869_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	95.5	2.0e-127
WP_000512805.1|197859_198378_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.8	2.2e-94
WP_000286100.1|198841_199045_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001670814.1|199022_199520_+	lysozyme RrrD	NA	I6R0P2	Salmonella_phage	100.0	9.9e-92
WP_001670813.1|199608_200046_+|lysis	lysis protein	lysis	A0A2I6PIF7	Escherichia_phage	97.9	6.5e-71
WP_000191867.1|200124_200652_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.6	3.3e-45
WP_000807823.1|200947_201190_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	98.8	8.3e-36
WP_000542583.1|201191_201371_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	93.2	2.1e-23
WP_000190002.1|201394_201817_+	hypothetical protein	NA	Q716H4	Shigella_phage	99.3	3.6e-74
WP_000200777.1|201813_203229_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.2	3.2e-276
WP_001535486.1|203230_205429_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.3	0.0e+00
WP_000372591.1|205519_206413_+	hypothetical protein	NA	A0A088CPT0	Enterobacteria_phage	84.2	2.6e-114
WP_000013269.1|206431_207685_+	hypothetical protein	NA	A0A088CQ56	Enterobacteria_phage	98.3	1.0e-233
WP_001362792.1|207726_207915_+	hypothetical protein	NA	A5VW71	Enterobacteria_phage	100.0	2.9e-28
WP_001140510.1|207895_208357_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001122372.1|208366_209785_+	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	98.3	3.9e-274
WP_000774929.1|209788_210490_+	hypothetical protein	NA	C6ZR14	Salmonella_phage	92.3	4.7e-71
WP_000627705.1|210489_210945_+	DUF2824 family protein	NA	I1TEJ3	Salmonella_phage	98.7	4.4e-86
WP_000964873.1|210947_211640_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.7e-111
WP_000246943.1|211649_212945_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.0	2.1e-181
WP_001029850.1|212944_214936_+	hypothetical protein	NA	A0A1R3Y5Q1	Salmonella_virus	96.6	0.0e+00
WP_024143557.1|215220_217077_+|tail	tail protein	tail	S4TVJ1	Salmonella_phage	90.1	2.3e-274
217346:217370	attR	CTGCTTTTTTATACTAAGTTGAACG	NA	NA	NA	NA
>prophage 2
NZ_CP010280	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 chromosome, complete genome	4864348	341565	348879	4864348	protease	Dickeya_phage(16.67%)	7	NA	NA
WP_001201748.1|341565_342684_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.8e-08
WP_000125893.1|342680_344627_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|344756_344978_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|345301_345622_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|345652_347929_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|348142_348340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001670446.1|348501_348879_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	42.7	5.9e-20
>prophage 3
NZ_CP010280	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 chromosome, complete genome	4864348	399229	539909	4864348	protease,tRNA,integrase,portal,capsid,lysis,holin,terminase,tail	Salmonella_phage(50.98%)	159	497166:497225	539032:539109
WP_001154027.1|399229_400033_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|400025_401348_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060024.1|401328_402033_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572746.1|402032_406499_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925875.1|406843_408691_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|408950_409499_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|409526_410174_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|410235_411426_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977709.1|411610_412702_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117870.1|413308_414709_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762343.1|414909_415371_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544853.1|415687_416902_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893197.1|417147_418581_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191406.1|418661_419864_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|420058_421351_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|421395_421644_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|421684_421924_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|421966_423124_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|423086_425972_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|426098_426398_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|426419_426578_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|426570_426831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|426880_427291_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|427410_427650_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|427615_427990_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|428074_429058_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|429060_429810_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|429820_430168_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|430164_430476_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|430553_430844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|431135_431369_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|431480_431702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|431784_432387_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|432595_433207_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|433203_433350_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|433339_434137_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|434203_434521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|434694_434820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|434955_435405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|435765_436452_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|436727_437057_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|437040_437493_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|437510_437990_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|438197_438731_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|438687_440826_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|440822_441029_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|441025_442573_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|442496_444578_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|444668_444992_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|444984_445284_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|445264_445831_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|445827_446229_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|446240_446990_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|447035_447434_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|447430_447760_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|447839_450827_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|450823_451156_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|451254_451752_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|451868_452402_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|452491_453187_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|453196_453934_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|453831_454536_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000033415.1|454607_457958_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000178849.1|457996_458239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|458292_460731_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|460730_461312_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001526469.1|461787_462756_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000334547.1|463403_464030_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|464098_464398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|464382_465069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|465339_465531_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193770.1|465957_468570_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000291723.1|468777_469788_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001670452.1|469953_470496_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224072.1|470492_471602_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|471700_473809_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|473821_475729_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|475743_476997_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433416.1|477001_478642_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|478638_479202_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|479457_479625_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|479724_480243_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156448.1|480311_482072_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|482257_482710_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001670727.1|482781_483834_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|484190_484700_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|484916_485522_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950876.1|485508_487662_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|487680_488127_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420513.1|488250_490305_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.1e-19
WP_000424187.1|490340_490799_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847732.1|490893_491556_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|491729_492143_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|492187_492505_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140482.1|492562_493774_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859429.1|493988_494537_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548080.1|494562_495342_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|495390_495672_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|495668_495998_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|496084_496744_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
497166:497225	attL	CCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCC	NA	NA	NA	NA
WP_000533596.1|497331_498351_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000196402.1|498351_498576_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000916251.1|498788_498971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000205292.1|498973_499528_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
WP_000158391.1|499524_501789_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.7	1.5e-102
WP_001192832.1|501818_502064_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_000387662.1|502071_502395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000467661.1|503079_503544_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	2.7e-35
WP_001643782.1|503940_504387_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
WP_001195066.1|504409_504634_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_000063056.1|504636_505617_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
WP_000074839.1|505613_507002_+	DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
WP_000130738.1|507039_507720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918617.1|507723_507972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001037052.1|507964_508567_+	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
WP_000180135.1|508563_508734_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
WP_001129735.1|508733_509072_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_000474096.1|509255_509447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000090037.1|509515_510112_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000717784.1|510108_510402_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000640103.1|510398_510977_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
WP_000658037.1|511369_511558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525456.1|511760_512063_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000951228.1|512040_512580_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	74.1	4.0e-78
WP_086374239.1|512897_513353_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.8	1.3e-53
WP_001118126.1|513853_514483_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	1.5e-108
WP_001130808.1|514485_516108_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_000113503.1|516107_517577_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.3e-280
WP_137911068.1|517461_518208_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	91.2	3.1e-97
WP_000873181.1|518211_519444_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.3	3.7e-228
WP_000128057.1|519448_519946_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000627463.1|519957_520899_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	3.1e-179
WP_001040693.1|520940_521330_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	62.0	4.0e-32
WP_001125672.1|521295_521703_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	3.0e-70
WP_000008738.1|521699_522254_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.4e-94
WP_001121925.1|522240_522630_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.1e-68
WP_001670724.1|522604_523168_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_001135539.1|523171_524317_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	1.2e-164
WP_000535992.1|524329_524773_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	1.0e-55
WP_000389049.1|524776_525229_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
WP_000990866.1|525406_527416_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
WP_000353826.1|527415_527991_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000155111.1|527990_528293_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000081749.1|528295_529363_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
WP_000819157.1|529359_529692_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
WP_000931859.1|529775_530231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000301078.1|530349_531102_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
WP_001270641.1|531101_531455_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
WP_001197089.1|531455_532655_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
WP_000049939.1|532651_533332_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
WP_001670454.1|533331_534864_+	hypothetical protein	NA	S4TP62	Salmonella_phage	66.2	1.4e-128
WP_000421108.1|534878_535397_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
WP_071786695.1|535645_535831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370530.1|535893_536502_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
WP_000033280.1|536611_537004_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
WP_127913510.1|537201_537447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001670723.1|537629_537827_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
WP_000503667.1|537869_538517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938182.1|539228_539909_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
539032:539109	attR	CCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAGATTAAACAAGGGGTTA	NA	NA	NA	NA
>prophage 4
NZ_CP010280	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 chromosome, complete genome	4864348	1439927	1450577	4864348		Morganella_phage(25.0%)	12	NA	NA
WP_001157313.1|1439927_1441358_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377036.1|1441431_1442127_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	2.8e-07
WP_000107431.1|1442206_1442518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080660.1|1443167_1444364_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|1444621_1444810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|1444820_1445033_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457658.1|1445487_1446756_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000394197.1|1446758_1447178_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_001529333.1|1447304_1447466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598921.1|1447946_1448744_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001670523.1|1449115_1449406_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	50.9	1.0e-08
WP_001219019.1|1450052_1450577_+	peptidase	NA	G9L6C4	Escherichia_phage	77.7	1.3e-36
>prophage 5
NZ_CP010280	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 chromosome, complete genome	4864348	1545048	1554215	4864348		Enterobacteria_phage(42.86%)	9	NA	NA
WP_000565902.1|1545048_1546128_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000648783.1|1546132_1546906_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018224.1|1546921_1547896_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973714.1|1547901_1548453_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000857530.1|1548453_1549332_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_001023659.1|1549379_1550279_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697840.1|1550278_1551364_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981471.1|1551740_1552634_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111837.1|1552811_1554215_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 6
NZ_CP010280	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 chromosome, complete genome	4864348	1622306	1631477	4864348	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|1622306_1624340_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|1624580_1625039_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|1625210_1625741_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|1625797_1626265_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|1626311_1627031_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|1627027_1628713_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|1628935_1629667_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|1629726_1629834_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|1629814_1630546_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|1630529_1631477_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 7
NZ_CP010280	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 chromosome, complete genome	4864348	2044977	2146447	4864348	protease,tRNA,integrase,portal,transposase,capsid,lysis,holin,terminase,head,tail	Salmonella_phage(35.0%)	107	2071121:2071136	2141536:2141551
WP_000940030.1|2044977_2045709_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553474.1|2045827_2046631_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174939.1|2046775_2047654_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	6.0e-15
WP_000985200.1|2047835_2048879_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2048882_2049701_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2049711_2050725_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111025.1|2050725_2051712_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2051702_2052341_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982964.1|2052466_2053744_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2053738_2054878_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2055073_2056327_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2056651_2057842_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2058023_2059568_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2059928_2061260_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2061342_2063487_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2063542_2065003_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2065051_2065390_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2065466_2066804_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054239.1|2066800_2067565_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2067566_2068997_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_000970062.1|2069646_2073534_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	8.0e-128
2071121:2071136	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
WP_001667158.1|2073558_2073789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2073789_2075334_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134572.1|2075384_2075936_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2075960_2076596_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2076599_2077961_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2077971_2078865_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995694.1|2078980_2079829_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684023.1|2079867_2080785_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276364.1|2080806_2082003_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022472.1|2082118_2083045_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	1.8e-09
WP_001196291.1|2083082_2083343_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_000986042.1|2083454_2083835_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2083834_2084566_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2084577_2085306_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2085317_2086223_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2086219_2086900_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2087173_2088148_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2088164_2089964_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2090368_2091862_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2092346_2092484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2093196_2093361_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2093940_2094006_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2094068_2094281_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2094387_2094615_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2094711_2095290_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2095279_2096104_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2096100_2098473_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2098526_2098769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2098807_2102170_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2102231_2102879_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2102776_2103514_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2103520_2104219_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2104228_2104558_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2104560_2107656_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2107627_2107966_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2107962_2108358_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2108408_2109155_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2109162_2109564_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2109672_2110803_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2110851_2111430_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2111457_2111841_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2111851_2112211_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2112268_2113297_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2113351_2113699_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2113711_2115208_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2115197_2116778_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2116774_2116978_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2116961_2118893_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2118864_2119410_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2119696_2120098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2120333_2120786_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2120803_2121256_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2121239_2121569_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2121844_2122531_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2122745_2122934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2123440_2124004_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2124276_2124954_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2124950_2125091_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096562.1|2125087_2125699_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.5	1.8e-90
WP_000929791.1|2125907_2126510_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2126544_2126793_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2126909_2127143_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2127385_2128018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2128125_2128824_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|2128837_2129533_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000024044.1|2129529_2130414_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_010835408.1|2130505_2130880_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2130839_2131082_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|2131181_2131577_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|2131635_2132475_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2132467_2132854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2132853_2133516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2133972_2134131_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2134152_2134503_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017128.1|2134629_2137557_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_077248255.1|2137519_2138677_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2138719_2138959_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2138999_2139284_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007934.1|2139261_2140491_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	4.9e-233
WP_000589050.1|2140988_2141468_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2141464_2142421_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
2141536:2141551	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
WP_001168374.1|2142420_2143071_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2143102_2143678_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2143674_2143839_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989165.1|2144102_2145725_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083342.1|2145709_2146447_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP010280	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 chromosome, complete genome	4864348	2151086	2209700	4864348	tRNA,integrase,portal,capsid,holin,lysis,terminase,plate,head,tail	Salmonella_phage(56.25%)	63	2146906:2146922	2200311:2200327
2146906:2146922	attL	TACCGGCGGCGTGGCCT	NA	NA	NA	NA
WP_000997365.1|2151086_2152124_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2152327_2152747_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183641.1|2152819_2153500_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082646.1|2153553_2156214_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2156328_2157684_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264478.1|2157728_2158052_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807818.1|2158048_2159350_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_000985653.1|2159453_2159909_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235092.1|2165983_2168557_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000992639.1|2168686_2169418_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2169414_2170395_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2170526_2171264_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2171535_2171874_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2171977_2172025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200080.1|2172124_2173285_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000632386.1|2173245_2174154_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225194.1|2174211_2175333_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2175342_2176413_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212380.1|2176852_2177371_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2177363_2178584_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_039518707.1|2178836_2179886_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	90.8	3.7e-189
WP_000382814.1|2179907_2180471_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_039518706.1|2180470_2181313_-	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	70.4	1.7e-112
WP_001278193.1|2181426_2181780_+	hypothetical protein	NA	Q6K1F9	Salmonella_virus	99.1	1.5e-57
WP_000883912.1|2181830_2182340_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	98.8	9.5e-90
WP_000916538.1|2182347_2182575_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	1.2e-36
WP_000085638.1|2182561_2182762_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	97.0	3.0e-31
WP_001246239.1|2182831_2183059_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	97.3	9.9e-31
WP_000752606.1|2183058_2183280_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	98.6	7.1e-34
WP_000027690.1|2183280_2183559_+	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	87.0	2.0e-41
WP_000238509.1|2183562_2184393_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	97.1	7.1e-159
WP_000170594.1|2184389_2186612_+	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	95.9	0.0e+00
WP_000232650.1|2186729_2186912_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
WP_001222154.1|2186915_2187149_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
WP_001245655.1|2187687_2187882_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	79.7	2.0e-19
WP_000044288.1|2188404_2189427_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	99.7	1.5e-198
WP_000795048.1|2189423_2190170_-	hypothetical protein	NA	Q6K1I9	Salmonella_virus	96.8	6.6e-140
WP_000156057.1|2190166_2191939_-|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.8	0.0e+00
WP_001085933.1|2192104_2192959_+|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	94.7	3.6e-150
WP_001247243.1|2193035_2194103_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
WP_000203472.1|2194106_2194856_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	98.4	1.5e-128
WP_000207472.1|2194949_2195456_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	98.8	2.9e-91
WP_000868400.1|2195455_2195659_+|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
WP_000134660.1|2195662_2195959_+|holin	holin	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
WP_001144116.1|2195945_2196443_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_000866101.1|2196439_2196853_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0M4R2N5	Salmonella_phage	97.8	1.2e-45
WP_001394645.1|2196824_2196998_+	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_001169074.1|2196960_2197428_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
WP_001293102.1|2197420_2197870_+	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	94.6	7.4e-70
WP_001094747.1|2197938_2198580_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.7	5.5e-111
WP_000127176.1|2198576_2198924_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	96.5	1.0e-55
WP_000246672.1|2198930_2199839_+|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	98.3	7.7e-159
WP_001285354.1|2199831_2200362_+|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	97.2	1.5e-101
2200311:2200327	attR	TACCGGCGGCGTGGCCT	NA	NA	NA	NA
WP_000104703.1|2200372_2202349_+|tail	tail protein	tail	S4TP62	Salmonella_phage	99.4	0.0e+00
WP_000122996.1|2202361_2202910_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	100.0	9.9e-101
WP_001279028.1|2203044_2204223_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	99.5	2.9e-222
WP_001207677.1|2204238_2204757_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
WP_001029732.1|2204819_2205155_+|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	97.3	2.6e-51
WP_085984508.1|2205151_2205307_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_000069525.1|2205299_2207741_+|tail	phage tail tape measure protein	tail	A0A218M4J5	Erwinia_phage	85.5	1.5e-297
WP_000978867.1|2207754_2208240_+|tail	phage tail protein	tail	O80317	Escherichia_phage	93.8	1.7e-80
WP_000988227.1|2208236_2209406_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	95.9	2.6e-207
WP_000972010.1|2209481_2209700_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
>prophage 9
NZ_CP010280	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 chromosome, complete genome	4864348	2243379	2249192	4864348		Enterobacteria_phage(100.0%)	8	NA	NA
WP_000210079.1|2243379_2243946_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.2	3.8e-55
WP_000984206.1|2243962_2244208_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	4.8e-31
WP_000194694.1|2244204_2244942_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	65.3	3.1e-81
WP_000556587.1|2245482_2245749_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_000980354.1|2245745_2246303_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	66.4	2.7e-29
WP_001216598.1|2246299_2246527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743153.1|2246523_2246844_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783706.1|2246858_2249192_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.5	0.0e+00
>prophage 10
NZ_CP010280	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 chromosome, complete genome	4864348	3559308	3653406	4864348	protease,tRNA,integrase,portal,capsid,lysis,plate,terminase,head,tail	Salmonella_phage(40.0%)	107	3592526:3592572	3623505:3623551
WP_000560969.1|3559308_3559746_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|3559790_3560732_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259011.1|3560746_3561193_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558166.1|3561189_3561501_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_001127704.1|3561586_3562516_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001159630.1|3562733_3563045_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|3563045_3563336_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|3563382_3564312_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|3564308_3564944_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331364.1|3564940_3565843_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077248424.1|3565855_3568906_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_001059744.1|3569100_3569937_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710967.1|3570204_3571236_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000828039.1|3571418_3572519_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000527677.1|3572861_3573185_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|3573184_3573844_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_001517951.1|3573944_3574493_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619474.1|3574581_3574896_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009249.1|3574892_3576041_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179685.1|3576167_3576995_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211454.1|3577137_3578397_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000143957.1|3578393_3579863_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|3580150_3580987_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013290.1|3581139_3581988_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063541.1|3581984_3583019_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|3583637_3584321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566800.1|3584479_3585787_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|3585779_3586295_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000812816.1|3586313_3587297_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000122632.1|3587625_3588246_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_077906285.1|3588252_3589005_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133442.1|3589016_3589412_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000338672.1|3589532_3589736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580402.1|3589783_3591157_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|3591153_3591852_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|3592002_3592503_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
3592526:3592572	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985251.1|3592687_3593668_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	96.0	1.5e-179
WP_001099751.1|3593737_3594031_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	75.3	1.6e-36
WP_001583792.1|3594167_3594440_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	87.8	1.0e-42
WP_001670778.1|3594609_3595110_+	hypothetical protein	NA	M1SV55	Escherichia_phage	91.0	1.8e-85
WP_000557712.1|3595173_3595398_+	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	78.4	3.4e-23
WP_001113578.1|3595699_3595924_+	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	75.7	2.0e-23
WP_000027647.1|3595920_3596196_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	72.5	7.0e-31
WP_000257582.1|3596185_3598462_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	88.0	0.0e+00
WP_000037667.1|3598640_3598838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000680929.1|3598834_3599875_-	Fic family protein	NA	S4TP71	Salmonella_phage	100.0	6.3e-197
WP_000042036.1|3600008_3600440_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	100.0	1.1e-75
WP_000551923.1|3600438_3600630_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	100.0	1.1e-27
WP_000039235.1|3601150_3602188_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.7	7.7e-163
WP_000214048.1|3602187_3603957_-|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	3.2e-286
WP_001074705.1|3604121_3604985_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	64.8	4.5e-100
WP_001224307.1|3605016_3606177_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.5	2.8e-129
WP_000224816.1|3606180_3606939_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	2.7e-80
WP_000177982.1|3607036_3607537_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_001100637.1|3607536_3607740_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000524754.1|3607730_3607952_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_000534554.1|3607935_3608445_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_000849743.1|3608441_3608855_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	8.4e-36
WP_000277800.1|3608962_3609430_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.0	2.2e-56
WP_000997680.1|3609422_3609890_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.8	9.8e-49
WP_000273577.1|3609894_3611271_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_001093789.1|3611347_3611989_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.0	2.4e-98
WP_000127150.1|3611985_3612333_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_000246674.1|3612339_3613248_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	98.7	1.7e-158
WP_001000070.1|3613240_3613771_+|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
WP_000104695.1|3613781_3615524_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	97.1	1.5e-267
WP_000874698.1|3615523_3616093_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	3.0e-92
WP_001279030.1|3616227_3617415_+|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
WP_001207676.1|3617430_3617949_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
WP_001029727.1|3618011_3618347_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_085984508.1|3618343_3618499_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_000069524.1|3618491_3620933_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	93.1	0.0e+00
WP_000978869.1|3620944_3621430_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	94.4	5.9e-81
WP_000627818.1|3621426_3622596_+	phage late control D family protein	NA	S4TRX8	Salmonella_phage	95.6	1.4e-205
WP_000468311.1|3622673_3622892_+	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_000933379.1|3622926_3623343_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	52.3	1.8e-33
WP_001077320.1|3623629_3624532_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
3623505:3623551	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|3624716_3625679_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758711.1|3625882_3626872_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750762.1|3626972_3627728_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777320.1|3627990_3629325_+	MFS transporter	NA	NA	NA	NA	NA
WP_000646510.1|3629335_3630295_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557881.1|3630304_3631345_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001519915.1|3631407_3632130_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000621104.1|3632407_3632539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173080.1|3632628_3632979_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113085.1|3632992_3634585_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001283049.1|3634671_3635631_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167248.1|3635886_3637422_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_000911133.1|3637415_3638459_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981826.1|3638455_3639457_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090737.1|3639485_3640508_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774146.1|3640536_3641412_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001543603.1|3641494_3641785_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088053.1|3641794_3642559_+	epimerase	NA	NA	NA	NA	NA
WP_001216339.1|3642650_3643418_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802242.1|3643530_3644127_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155229.1|3644227_3644656_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796293.1|3644761_3645508_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250617.1|3645604_3646615_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136809.1|3646726_3648235_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084285.1|3648255_3649101_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|3649499_3649739_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|3649960_3650446_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139637.1|3650538_3651468_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|3651534_3652866_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|3652875_3653406_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 11
NZ_CP010280	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 chromosome, complete genome	4864348	3772175	3790328	4864348	plate,tail	Burkholderia_phage(45.0%)	23	NA	NA
WP_001177098.1|3772175_3772691_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	40.7	1.3e-33
WP_000368212.1|3772700_3774182_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.6e-52
WP_000359503.1|3774184_3774817_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000951728.1|3774809_3775925_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	5.3e-101
WP_001093501.1|3775915_3776275_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632052.1|3776438_3777986_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	1.6e-50
WP_000703634.1|3777985_3778915_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000593184.1|3778911_3779274_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000679396.1|3779597_3780320_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	2.3e-12
WP_000818152.1|3780329_3781373_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
WP_001269716.1|3781360_3781570_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271429.1|3781569_3782523_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262484.1|3782522_3784877_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.8e-67
WP_001185656.1|3784973_3785102_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003640.1|3785061_3785379_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907495.1|3785430_3785955_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729849.1|3785954_3787382_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
WP_000875314.1|3787371_3787569_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|3787565_3788021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|3788180_3788495_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|3788507_3789113_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|3789115_3789403_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|3789980_3790328_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP009566	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence	94725	0	3869	94725	integrase	Enterobacteria_phage(50.0%)	5	717:731	7957:7971
WP_001278818.1|58_475_-	recombinase	NA	NA	NA	NA	NA
WP_000688519.1|467_1448_-	Plasmid segregation protein parM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	7.7e-80
717:731	attL	TTCAGCATTATAAAT	NA	NA	NA	NA
WP_000048808.1|1861_2170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|2256_2901_-	ParA family protein	NA	NA	NA	NA	NA
WP_000016498.1|3080_3869_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.1e-55
7957:7971	attR	TTCAGCATTATAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP009566	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence	94725	9459	9993	94725		Morganella_phage(100.0%)	1	NA	NA
WP_001221666.1|9459_9993_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
>prophage 3
NZ_CP009566	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence	94725	18357	19206	94725		Vibrio_phage(100.0%)	1	NA	NA
WP_001057996.1|18357_19206_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	3.5e-28
>prophage 4
NZ_CP009566	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence	94725	22705	22969	94725		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001324596.1|22705_22969_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
>prophage 5
NZ_CP009566	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence	94725	39856	43917	94725	integrase	Pseudomonas_phage(50.0%)	4	37059:37071	41205:41217
37059:37071	attL	TTTTTGTCCAGCG	NA	NA	NA	NA
WP_001139957.1|39856_41011_+|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.3e-46
WP_001238939.1|41161_41986_+	hypothetical protein	NA	NA	NA	NA	NA
41205:41217	attR	CGCTGGACAAAAA	NA	NA	NA	NA
WP_000976351.1|42070_43273_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000977522.1|43332_43917_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	39.8	7.7e-11
>prophage 6
NZ_CP009566	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence	94725	47031	51440	94725		Wolbachia_phage(50.0%)	2	NA	NA
WP_000014583.1|47031_47583_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	1.5e-19
WP_001141527.1|47672_51440_+	DNA primase	NA	A0A1B0VML8	Pseudomonas_phage	29.4	1.3e-18
>prophage 7
NZ_CP009566	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence	94725	78566	86641	94725	transposase	Sodalis_phage(20.0%)	10	NA	NA
WP_000038332.1|78566_79457_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.8	1.7e-65
WP_001247862.1|79521_79788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218863.1|79881_80316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117622.1|81044_81545_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	27.3	4.2e-05
WP_000978012.1|82007_82604_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	61.9	3.1e-15
WP_001276261.1|82600_83320_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845904.1|83316_83751_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001145462.1|83805_85764_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.0	2.8e-20
WP_000005985.1|85822_86056_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001276114.1|86113_86641_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	9.3e-48
>prophage 8
NZ_CP009566	Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence	94725	90408	93478	94725		Vibrio_phage(33.33%)	5	NA	NA
WP_000086121.1|90408_91092_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	8.7e-30
WP_014640311.1|91167_91479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000273912.1|91475_92378_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618111.1|92795_93044_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	49.3	1.1e-14
WP_000109072.1|93040_93478_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
