The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010282	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 chromosome, complete genome	4795842	968889	974702	4795842		Enterobacteria_phage(100.0%)	8	NA	NA
WP_000783706.1|968889_971223_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.5	0.0e+00
WP_000743153.1|971237_971558_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216598.1|971554_971782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980354.1|971778_972336_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	66.4	2.7e-29
WP_000556587.1|972332_972599_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_000194694.1|973139_973877_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	65.3	3.1e-81
WP_000984206.1|973873_974119_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	4.8e-31
WP_000210079.1|974135_974702_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.2	3.8e-55
>prophage 2
NZ_CP010282	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 chromosome, complete genome	4795842	1034852	1111591	4795842	terminase,transposase,head,integrase,protease,capsid,portal,lysis,tRNA,tail,holin	Salmonella_phage(36.84%)	89	1026933:1026949	1117438:1117454
1026933:1026949	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997365.1|1034852_1035890_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1036005_1036695_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1037013_1037397_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1037458_1038046_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001670786.1|1038148_1039048_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1039065_1040400_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083342.1|1040529_1041267_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989165.1|1041251_1042874_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1043137_1043302_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1043298_1043874_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1043905_1044556_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1044555_1045512_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589050.1|1045508_1045988_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007934.1|1046485_1047715_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	4.9e-233
WP_001670787.1|1047692_1047977_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1048017_1048257_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1048299_1049457_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017128.1|1049419_1052347_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_001539619.1|1052473_1052824_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1052845_1053004_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|1053460_1054123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|1054122_1054509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|1054501_1055341_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|1055399_1055795_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|1055894_1056137_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|1056096_1056471_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000024044.1|1056562_1057447_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801764.1|1057443_1058139_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|1058152_1058851_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|1058958_1059591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1059833_1060067_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1060183_1060432_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|1060466_1061069_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096562.1|1061277_1061889_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.5	1.8e-90
WP_000801757.1|1061885_1062026_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1062022_1062700_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1062972_1063536_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1064042_1064231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1064445_1065132_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1065407_1065737_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1065720_1066173_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1066190_1066643_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1066878_1067280_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|1067566_1068112_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1068083_1070015_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1069998_1070202_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1070198_1071779_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1071768_1073265_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1073277_1073625_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1073679_1074708_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1074765_1075125_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083294.1|1075135_1075519_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1075546_1076125_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1076173_1077304_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1077412_1077814_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1077821_1078568_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1078618_1079014_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1079010_1079349_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1079320_1082416_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1082418_1082748_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1082757_1083456_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1083462_1084200_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1084097_1084745_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1084806_1088169_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1088207_1088450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1088503_1090876_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1090872_1091697_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1091686_1092265_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1092361_1092589_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1092695_1092908_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1093660_1093780_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1094492_1094630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1095113_1096607_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1097011_1098811_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1098827_1099802_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1100075_1100756_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1100752_1101658_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1101669_1102398_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1102409_1103141_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986042.1|1103140_1103521_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1103632_1103893_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022472.1|1103930_1104857_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	1.8e-09
WP_001276364.1|1104972_1106169_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684023.1|1106190_1107108_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995694.1|1107146_1107995_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1108110_1109004_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1109014_1110376_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1110379_1111015_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134572.1|1111039_1111591_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1117438:1117454	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 3
NZ_CP010282	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 chromosome, complete genome	4795842	1555479	1564650	4795842	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1555479_1556427_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1556410_1557142_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1557122_1557230_-	protein YohO	NA	NA	NA	NA	NA
WP_001240417.1|1557289_1558021_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1558243_1559929_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1559925_1560645_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1560691_1561159_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1561215_1561746_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1561917_1562376_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|1562616_1564650_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP010282	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 chromosome, complete genome	4795842	1632739	1643246	4795842		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111837.1|1632739_1634143_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981471.1|1634320_1635214_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1635590_1636676_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023659.1|1636675_1637575_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857530.1|1637622_1638501_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_000973714.1|1638501_1639053_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000018224.1|1639058_1640033_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1640048_1640822_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565902.1|1640826_1641906_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000126351.1|1641932_1643246_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 5
NZ_CP010282	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 chromosome, complete genome	4795842	1739773	1747024	4795842		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1739773_1740193_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457658.1|1740195_1741464_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000208509.1|1741918_1742131_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1742141_1742330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080660.1|1742587_1743784_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_000107431.1|1744433_1744745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377036.1|1744824_1745520_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	2.8e-07
WP_001157313.1|1745593_1747024_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP010282	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 chromosome, complete genome	4795842	2647006	2690827	4795842	integrase,protease,capsid,lysis,tail	Salmonella_phage(55.56%)	57	2647807:2647866	2689669:2689746
WP_000938182.1|2647006_2647687_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
2647807:2647866	attL	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTC	NA	NA	NA	NA
WP_000503667.1|2648398_2649046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001670723.1|2649088_2649286_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
WP_127913510.1|2649468_2649714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000033280.1|2649911_2650304_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
WP_000370530.1|2650413_2651022_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
WP_071786695.1|2651084_2651270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421108.1|2651518_2652037_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
WP_001670454.1|2652051_2653584_-	hypothetical protein	NA	S4TP62	Salmonella_phage	66.2	1.4e-128
WP_000049939.1|2653583_2654264_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
WP_001270641.1|2655459_2655813_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
WP_000301078.1|2655812_2656565_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
WP_000931859.1|2656683_2657139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819157.1|2657222_2657555_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
WP_000353826.1|2658921_2659497_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000990866.1|2659496_2661506_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
WP_000389049.1|2661683_2662136_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
WP_000535992.1|2662139_2662583_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	1.0e-55
WP_001135539.1|2662595_2663741_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	1.2e-164
WP_001670724.1|2663744_2664308_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_001121925.1|2664282_2664672_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.1e-68
WP_000008738.1|2664658_2665213_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.4e-94
WP_001125672.1|2665209_2665617_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	3.0e-70
WP_001040693.1|2665582_2665972_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	62.0	4.0e-32
WP_000627463.1|2666013_2666955_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	3.1e-179
WP_000128057.1|2666966_2667464_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873181.1|2667468_2668701_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.3	3.7e-228
WP_137911068.1|2668704_2669451_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	91.2	3.1e-97
WP_012512820.1|2669335_2670772_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	6.1e-275
WP_001130808.1|2670803_2672426_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_001118126.1|2672428_2673058_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	1.5e-108
WP_086374239.1|2673558_2674014_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.8	1.3e-53
WP_000951228.1|2674331_2674871_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	74.1	4.0e-78
WP_001525456.1|2674848_2675151_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000658037.1|2675353_2675542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640103.1|2675934_2676513_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
WP_000717784.1|2676509_2676803_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000090037.1|2676799_2677396_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000474096.1|2677464_2677656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129735.1|2677839_2678178_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_000180135.1|2678177_2678348_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
WP_001037052.1|2678344_2678947_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
WP_000918617.1|2678939_2679188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130738.1|2679191_2679872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000074839.1|2679909_2681298_-	DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
WP_000063056.1|2681294_2682275_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
WP_001195066.1|2682277_2682502_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_001643782.1|2682524_2682971_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
WP_023972394.1|2683376_2683832_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	4.6e-35
WP_000387662.1|2684516_2684840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192832.1|2684847_2685093_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_000158391.1|2685122_2687387_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.7	1.5e-102
WP_000205292.1|2687383_2687938_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
WP_000916251.1|2687940_2688123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196402.1|2688335_2688560_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533596.1|2688560_2689580_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000374046.1|2690167_2690827_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
2689669:2689746	attR	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCGG	NA	NA	NA	NA
>prophage 7
NZ_CP010282	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 chromosome, complete genome	4795842	2704838	2766849	4795842	terminase,protease,portal,lysis,tail,holin	Salmonella_phage(48.98%)	68	NA	NA
WP_000156448.1|2704838_2706599_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2706667_2707186_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2707285_2707453_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2707708_2708272_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2708268_2709909_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2709913_2711167_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2711181_2713089_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2713101_2715210_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224072.1|2715308_2716418_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001670452.1|2716414_2716957_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2717122_2718133_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193770.1|2718340_2720953_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000497441.1|2721379_2721571_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2721841_2722528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2722512_2722812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2722880_2723507_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001526469.1|2724154_2725123_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000143167.1|2725598_2726180_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2726179_2728618_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2728671_2728914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541993.1|2728952_2729828_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000246065.1|2732373_2733078_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2732975_2733713_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2733722_2734418_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2734507_2735041_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2735157_2735655_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2735753_2736086_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2736082_2739070_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2739149_2739479_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_173673910.1|2739475_2739880_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	58.0	5.3e-27
WP_000132756.1|2739918_2740668_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2740679_2741081_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2741077_2741644_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2741624_2741924_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2741916_2742240_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2742330_2744412_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|2744335_2745883_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_099130706.1|2746000_2748217_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.5e-290
WP_000371784.1|2748176_2748710_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2748917_2749397_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2749414_2749867_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2749850_2750180_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2750455_2751142_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2751502_2751952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2752087_2752213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2752386_2752704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2752770_2753568_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2753557_2753704_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2753700_2754312_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929805.1|2754520_2755123_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2755205_2755427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2755538_2755772_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2756063_2756354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2756431_2756743_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2756739_2757087_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2757097_2757847_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2757849_2758833_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2758917_2759292_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2759257_2759497_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2759616_2760027_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014344008.1|2760076_2760337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2760329_2760488_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2760509_2760809_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017133.1|2760935_2763821_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|2763783_2764941_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2764983_2765223_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2765263_2765512_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2765556_2766849_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
>prophage 8
NZ_CP010282	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 chromosome, complete genome	4795842	2838029	2845343	4795842	protease	Ralstonia_phage(16.67%)	7	NA	NA
WP_001670446.1|2838029_2838407_+	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	42.7	5.9e-20
WP_001117984.1|2838568_2838766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2838979_2841256_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2841286_2841607_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2841930_2842152_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|2842281_2844228_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_001201748.1|2844224_2845343_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.8e-08
>prophage 9
NZ_CP010282	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 chromosome, complete genome	4795842	4197011	4241785	4795842	tRNA,tail,plate	Burkholderia_phage(40.91%)	46	NA	NA
WP_001182228.1|4197011_4198010_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|4198097_4199408_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4199654_4200170_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4200269_4200479_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4200500_4200614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128103.1|4200610_4201936_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4202114_4202723_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4202831_4203200_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4203370_4205791_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4205889_4206762_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4206775_4207273_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4207453_4208371_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973678.1|4208534_4209893_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4209981_4211091_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4211452_4212643_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382575.1|4212774_4214319_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4214333_4215224_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4215389_4215800_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750806.1|4215942_4218039_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4218038_4218776_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4218772_4219441_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4219474_4219717_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790036.1|4220160_4221810_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4222154_4223504_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4223634_4223982_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4224558_4224846_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4224848_4225454_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4225466_4225781_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000875314.1|4226391_4226589_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729849.1|4226578_4228006_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
WP_000907495.1|4228005_4228530_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4228581_4228899_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185656.1|4228858_4228987_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262484.1|4229083_4231438_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.8e-67
WP_000271429.1|4231437_4232391_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4232390_4232600_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818152.1|4232587_4233631_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
WP_000679396.1|4233640_4234363_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	2.3e-12
WP_000593184.1|4234686_4235049_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703634.1|4235045_4235975_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000632052.1|4235974_4237522_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	1.6e-50
WP_001093501.1|4237685_4238045_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951728.1|4238035_4239151_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	5.3e-101
WP_000359503.1|4239143_4239776_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000368212.1|4239778_4241260_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.6e-52
WP_001177098.1|4241269_4241785_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	40.7	1.3e-33
>prophage 10
NZ_CP010282	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 chromosome, complete genome	4795842	4360551	4426331	4795842	terminase,plate,protease,integrase,capsid,portal,lysis,head,tail	Salmonella_phage(41.86%)	76	4390407:4390453	4421385:4421431
WP_000208240.1|4360551_4361082_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|4361091_4362423_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139637.1|4362489_4363419_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|4363511_4363997_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|4364218_4364458_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|4364856_4365702_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|4365722_4367231_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|4367342_4368353_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796293.1|4368449_4369196_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155229.1|4369301_4369730_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802242.1|4369830_4370427_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|4370539_4371307_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088053.1|4371398_4372163_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|4372172_4372463_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774146.1|4372545_4373421_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|4373449_4374472_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|4374500_4375502_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911133.1|4375498_4376542_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167248.1|4376535_4378071_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|4378326_4379286_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|4379372_4380965_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173080.1|4380978_4381329_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001519915.1|4381827_4382550_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557881.1|4382612_4383653_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646510.1|4383662_4384622_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777320.1|4384632_4385967_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750762.1|4386229_4386985_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|4387085_4388075_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|4388278_4389241_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|4389425_4390328_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4390407:4390453	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000933379.1|4390614_4391031_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	52.3	1.8e-33
WP_000468311.1|4391065_4391284_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_000627818.1|4391361_4392531_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	95.6	1.4e-205
WP_000978869.1|4392527_4393013_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	94.4	5.9e-81
WP_000069524.1|4393024_4395466_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	93.1	0.0e+00
WP_085984508.1|4395458_4395614_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|4395610_4395946_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207676.1|4396008_4396527_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
WP_001279030.1|4396542_4397730_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
WP_000874698.1|4397864_4398434_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	3.0e-92
WP_000104695.1|4398433_4400176_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	97.1	1.5e-267
WP_001000070.1|4400186_4400717_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
WP_000246674.1|4400709_4401618_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	98.7	1.7e-158
WP_000127150.1|4401624_4401972_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_001093789.1|4401968_4402610_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.0	2.4e-98
WP_000273577.1|4402686_4404063_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_000997680.1|4404067_4404535_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.8	9.8e-49
WP_000277800.1|4404527_4404995_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.0	2.2e-56
WP_000849743.1|4405102_4405516_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	8.4e-36
WP_000524754.1|4406004_4406226_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001100637.1|4406216_4406420_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000177982.1|4406419_4406920_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_000224816.1|4407017_4407776_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	2.7e-80
WP_001224307.1|4407779_4408940_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.5	2.8e-129
WP_001074705.1|4408971_4409835_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	64.8	4.5e-100
WP_000214048.1|4409999_4411769_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	3.2e-286
WP_000039235.1|4411768_4412806_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.7	7.7e-163
WP_000551923.1|4413326_4413518_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	100.0	1.1e-27
WP_000042036.1|4413516_4413948_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	100.0	1.1e-75
WP_000680929.1|4414081_4415122_+	Fic family protein	NA	S4TP71	Salmonella_phage	100.0	6.3e-197
WP_000037667.1|4415118_4415316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257582.1|4415494_4417771_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	88.0	0.0e+00
WP_000027647.1|4417760_4418036_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	72.5	7.0e-31
WP_001113578.1|4418032_4418257_-	TraR/DksA C4-type zinc finger protein	NA	A0A0F7LDG9	Escherichia_phage	75.7	2.0e-23
WP_000557712.1|4418558_4418783_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	78.4	3.4e-23
WP_001670778.1|4418846_4419347_-	hypothetical protein	NA	M1SV55	Escherichia_phage	91.0	1.8e-85
WP_001583792.1|4419516_4419789_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	87.8	1.0e-42
WP_001099751.1|4419925_4420219_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	75.3	1.6e-36
WP_000985251.1|4420288_4421269_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	96.0	1.5e-179
WP_001233463.1|4421453_4421954_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4421385:4421431	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|4422104_4422803_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4422799_4424173_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000338672.1|4424220_4424424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133442.1|4424544_4424940_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000559230.1|4424951_4425641_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|4425710_4426331_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 1
NZ_CP009563	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 plasmid pCVM21538, complete sequence	80098	0	43690	80098	transposase,integrase	Salmonella_phage(15.38%)	51	12645:12664	55107:55126
WP_001044210.1|632_773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|1258_1996_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|1992_2217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|2427_3921_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|3951_4836_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214123.1|5052_6267_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001255015.1|6294_6600_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804063.1|6866_8066_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|8171_8822_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|8853_9096_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000480968.1|9401_10238_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|10237_11041_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|11101_11917_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000338945.1|12223_12535_+	hypothetical protein	NA	NA	NA	NA	NA
12645:12664	attL	CTTTCACATGTGAAAGTTTG	NA	NA	NA	NA
WP_001151304.1|12708_13494_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|13497_14679_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|14727_15000_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000074431.1|15052_15688_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000939033.1|15779_15923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125904.1|16249_16627_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
WP_000044823.1|16619_16901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344149.1|16875_17550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326170.1|17617_18049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447539.1|18054_18366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000647188.1|18374_18875_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
WP_000936897.1|18878_20306_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000268552.1|20305_20962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464630.1|21017_21635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326171.1|21846_22146_+	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
WP_000467110.1|22236_22725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|24483_25188_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067858.1|25250_25955_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001276635.1|26164_27154_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087810.1|27150_27387_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000995361.1|27383_27749_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000761850.1|27860_28499_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_000149288.1|28513_30199_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
WP_000732290.1|30270_30546_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294666.1|30561_30912_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000414383.1|30983_31418_+	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_000427623.1|31517_32522_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000338626.1|32927_33044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868820.1|33164_33539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988731.1|33652_34378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001257735.1|34510_38764_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
WP_001326394.1|38735_39176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|39814_40417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|40686_40968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949433.1|41266_41803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|41805_42816_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000997323.1|42820_43690_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
55107:55126	attR	CAAACTTTCACATGTGAAAG	NA	NA	NA	NA
>prophage 2
NZ_CP009563	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 plasmid pCVM21538, complete sequence	80098	46859	48371	80098		Pseudoalteromonas_phage(100.0%)	1	NA	NA
WP_000811656.1|46859_48371_+	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
>prophage 3
NZ_CP009563	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 plasmid pCVM21538, complete sequence	80098	55699	59445	80098		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
WP_000356489.1|55699_55972_+	helix-turn-helix domain-containing protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
WP_000790610.1|55971_56505_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000891157.1|56515_57124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651490.1|57730_58150_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000919078.1|58151_58445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000077458.1|58461_59445_-	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
>prophage 4
NZ_CP009563	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 plasmid pCVM21538, complete sequence	80098	63348	64464	80098		unidentified_phage(100.0%)	1	NA	NA
WP_000946102.1|63348_64464_-	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	29.1	6.4e-46
>prophage 5
NZ_CP009563	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 plasmid pCVM21538, complete sequence	80098	68123	73960	80098		Wolbachia_phage(25.0%)	10	NA	NA
WP_000829616.1|68123_69083_+	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.0e-17
WP_000139698.1|69098_69959_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000591074.1|69992_70421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422768.1|70477_70837_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000919345.1|70836_71283_+	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_000210756.1|71279_71798_+	nitrite reductase	NA	NA	NA	NA	NA
WP_000972663.1|71797_72028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167032.1|72014_72872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236377.1|73102_73630_+	thermonuclease family protein	NA	O64020	Bacillus_phage	37.0	1.3e-09
WP_001043047.1|73687_73960_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
>prophage 6
NZ_CP009563	Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 plasmid pCVM21538, complete sequence	80098	77562	79470	80098	transposase	Pseudomonas_phage(50.0%)	3	NA	NA
WP_001273096.1|77562_78051_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	61.7	1.7e-51
WP_000062185.1|78053_78551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|78765_79470_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
