The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010281	Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 chromosome, complete genome	4830769	286757	292570	4830769		Enterobacteria_phage(100.0%)	8	NA	NA
WP_000783706.1|286757_289091_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.5	0.0e+00
WP_000743153.1|289105_289426_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216598.1|289422_289650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980354.1|289646_290204_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	66.4	2.7e-29
WP_000556587.1|290200_290467_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_000194694.1|291007_291745_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	65.3	3.1e-81
WP_000984206.1|291741_291987_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	4.8e-31
WP_000210079.1|292003_292570_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.2	3.8e-55
>prophage 2
NZ_CP010281	Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 chromosome, complete genome	4830769	352721	429460	4830769	tRNA,head,portal,transposase,tail,holin,lysis,capsid,protease,terminase,integrase	Salmonella_phage(36.84%)	89	344802:344818	435307:435323
344802:344818	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997365.1|352721_353759_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|353874_354564_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|354882_355266_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|355327_355915_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000219174.1|356933_358268_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083342.1|358397_359135_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989165.1|359119_360742_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|361005_361170_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|361166_361742_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|361773_362424_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|362423_363380_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589050.1|363376_363856_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007934.1|364353_365583_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	4.9e-233
WP_001670787.1|365560_365845_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|365885_366125_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|366167_367325_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017128.1|367287_370215_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_001539619.1|370341_370692_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|370713_370872_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|371328_371991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|371990_372377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|372369_373209_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|373267_373663_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|373762_374005_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|373964_374339_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000024044.1|374430_375315_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801764.1|375311_376007_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|376020_376719_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|376826_377459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|377701_377935_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|378051_378300_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|378334_378937_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096562.1|379145_379757_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.5	1.8e-90
WP_000801757.1|379753_379894_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|379890_380568_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|380840_381404_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|381910_382099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|382313_383000_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|383275_383605_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|383588_384041_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|384058_384511_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|384746_385148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|385434_385980_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|385951_387883_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|387866_388070_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|388066_389647_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|389636_391133_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|391145_391493_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|391547_392576_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|392633_392993_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|393003_393387_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|393414_393993_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|394041_395172_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|395280_395682_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|395689_396436_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|396486_396882_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|396878_397217_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|397188_400284_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|400286_400616_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|400625_401324_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|401330_402068_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|401965_402613_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|402674_406037_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|406075_406318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|406371_408744_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|408740_409565_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|409554_410133_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|410229_410457_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|410563_410776_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|410838_410904_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001526383.1|411528_411648_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|412360_412498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|412982_414476_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|414880_416680_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|416696_417671_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|417944_418625_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|418621_419527_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|419538_420267_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|420278_421010_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986042.1|421009_421390_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|421501_421762_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022472.1|421799_422726_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	1.8e-09
WP_001276364.1|422841_424038_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684023.1|424059_424977_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995694.1|425015_425864_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|425979_426873_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|426883_428245_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|428248_428884_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134572.1|428908_429460_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
435307:435323	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 3
NZ_CP010281	Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 chromosome, complete genome	4830769	950621	961128	4830769		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111837.1|950621_952025_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981471.1|952202_953096_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|953472_954558_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023659.1|954557_955457_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857530.1|955504_956383_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_000973714.1|956383_956935_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000018224.1|956940_957915_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|957930_958704_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565902.1|958708_959788_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000126351.1|959814_961128_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 4
NZ_CP010281	Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 chromosome, complete genome	4830769	1054258	1064908	4830769		Morganella_phage(25.0%)	12	NA	NA
WP_001219019.1|1054258_1054783_-	peptidase	NA	G9L6C4	Escherichia_phage	77.7	1.3e-36
WP_001670523.1|1055429_1055720_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	50.9	1.0e-08
WP_000598921.1|1056091_1056889_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001529333.1|1057369_1057531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1057657_1058077_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457658.1|1058079_1059348_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000208509.1|1059802_1060015_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1060025_1060214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080660.1|1060471_1061668_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_000107431.1|1062317_1062629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377036.1|1062708_1063404_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	2.8e-07
WP_001157313.1|1063477_1064908_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP010281	Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 chromosome, complete genome	4830769	1967039	2010864	4830769	lysis,capsid,protease,tail,integrase	Salmonella_phage(58.33%)	60	1967840:1967899	2009706:2009783
WP_000938182.1|1967039_1967720_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
1967840:1967899	attL	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTC	NA	NA	NA	NA
WP_000503667.1|1968431_1969079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001670723.1|1969121_1969319_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
WP_127913510.1|1969501_1969747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000033280.1|1969944_1970337_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
WP_000370530.1|1970446_1971055_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
WP_071786695.1|1971117_1971303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421108.1|1971551_1972070_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
WP_001670454.1|1972084_1973617_-	hypothetical protein	NA	S4TP62	Salmonella_phage	66.2	1.4e-128
WP_000049939.1|1973616_1974297_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
WP_001197089.1|1974293_1975493_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
WP_001270641.1|1975493_1975847_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
WP_000301078.1|1975846_1976599_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
WP_000931859.1|1976717_1977173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819157.1|1977256_1977589_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
WP_000081749.1|1977585_1978653_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
WP_000155111.1|1978655_1978958_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000353826.1|1978957_1979533_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000990866.1|1979532_1981542_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
WP_000389049.1|1981719_1982172_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
WP_000535992.1|1982175_1982619_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	1.0e-55
WP_001135539.1|1982631_1983777_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	1.2e-164
WP_001670724.1|1983780_1984344_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_001121925.1|1984318_1984708_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.1e-68
WP_000008738.1|1984694_1985249_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.4e-94
WP_001125672.1|1985245_1985653_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	3.0e-70
WP_001040693.1|1985618_1986008_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	62.0	4.0e-32
WP_000627463.1|1986049_1986991_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	3.1e-179
WP_000128057.1|1987002_1987500_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873181.1|1987504_1988737_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.3	3.7e-228
WP_137911068.1|1988740_1989487_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	91.2	3.1e-97
WP_000113503.1|1989371_1990841_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.3e-280
WP_001130808.1|1990840_1992463_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_001118126.1|1992465_1993095_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	1.5e-108
WP_086374239.1|1993595_1994051_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.8	1.3e-53
WP_000951228.1|1994368_1994908_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	74.1	4.0e-78
WP_001525456.1|1994885_1995188_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000658037.1|1995390_1995579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640103.1|1995971_1996550_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
WP_000717784.1|1996546_1996840_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000090037.1|1996836_1997433_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000474096.1|1997501_1997693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129735.1|1997876_1998215_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_000180135.1|1998214_1998385_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
WP_001037052.1|1998381_1998984_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
WP_000918617.1|1998976_1999225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130738.1|1999228_1999909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000074839.1|1999946_2001335_-	DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
WP_000063056.1|2001331_2002312_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
WP_001195066.1|2002314_2002539_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_001643782.1|2002561_2003008_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
WP_000467661.1|2003404_2003869_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	2.7e-35
WP_000387662.1|2004553_2004877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192832.1|2004884_2005130_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_000158391.1|2005159_2007424_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.7	1.5e-102
WP_000205292.1|2007420_2007975_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
WP_000916251.1|2007977_2008160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196402.1|2008372_2008597_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533596.1|2008597_2009617_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000374046.1|2010204_2010864_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
2009706:2009783	attR	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCGG	NA	NA	NA	NA
>prophage 6
NZ_CP010281	Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 chromosome, complete genome	4830769	2024876	2086888	4830769	portal,holin,lysis,terminase,protease,tail,integrase	Salmonella_phage(48.0%)	69	2041098:2041112	2086923:2086937
WP_000156448.1|2024876_2026637_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2026705_2027224_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2027323_2027491_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2027746_2028310_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2028306_2029947_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2029951_2031205_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2031219_2033127_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2033139_2035248_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224072.1|2035346_2036456_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001670452.1|2036452_2036995_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2037160_2038171_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193770.1|2038378_2040991_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
2041098:2041112	attL	GCTACATTTTTATAA	NA	NA	NA	NA
WP_000497441.1|2041417_2041609_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2041879_2042566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2042550_2042850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2042918_2043545_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001526469.1|2044192_2045161_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000143167.1|2045636_2046218_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2046217_2048656_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2048709_2048952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139133709.1|2048990_2050559_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	63.9	7.2e-128
WP_000246065.1|2052411_2053116_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2053013_2053751_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2053760_2054456_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2054545_2055079_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2055195_2055693_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2055791_2056124_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2056120_2059108_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2059187_2059517_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_162494883.1|2059513_2059960_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	58.0	5.9e-27
WP_000132756.1|2059956_2060706_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2060717_2061119_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2061115_2061682_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2061662_2061962_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2061954_2062278_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2062368_2064450_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|2064373_2065921_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|2065917_2066124_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2066120_2068259_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2068215_2068749_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2068956_2069436_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2069453_2069906_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2069889_2070219_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2070494_2071181_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2071541_2071991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2072126_2072252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2072425_2072743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2072809_2073607_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2073596_2073743_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2073739_2074351_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929805.1|2074559_2075162_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2075244_2075466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2075577_2075811_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2076102_2076393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2076470_2076782_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2076778_2077126_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2077136_2077886_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2077888_2078872_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2078956_2079331_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2079296_2079536_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2079655_2080066_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014344008.1|2080115_2080376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2080368_2080527_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2080548_2080848_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017133.1|2080974_2083860_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|2083822_2084980_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2085022_2085262_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2085302_2085551_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2085595_2086888_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
2086923:2086937	attR	GCTACATTTTTATAA	NA	NA	NA	NA
>prophage 7
NZ_CP010281	Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 chromosome, complete genome	4830769	2158068	2165382	4830769	protease	Ralstonia_phage(16.67%)	7	NA	NA
WP_001670446.1|2158068_2158446_+	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	42.7	5.9e-20
WP_001117984.1|2158607_2158805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2159018_2161295_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2161325_2161646_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2161969_2162191_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|2162320_2164267_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_001201748.1|2164263_2165382_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.8e-08
>prophage 8
NZ_CP010281	Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 chromosome, complete genome	4830769	3488452	3562916	4830769	tRNA,tail,plate,transposase	Burkholderia_phage(33.33%)	64	NA	NA
WP_013815099.1|3488452_3489421_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_001081935.1|3500642_3501920_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001670706.1|3501916_3503236_-	TolC family protein	NA	NA	NA	NA	NA
WP_000875179.1|3503225_3504614_-	membrane protein	NA	NA	NA	NA	NA
WP_000389229.1|3504610_3505243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168322.1|3506283_3506814_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	88.9	3.9e-54
WP_000357724.1|3507061_3509887_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
WP_000432197.1|3510018_3510474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000146587.1|3510460_3510799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155663.1|3510799_3511156_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000270392.1|3511158_3511575_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_000724435.1|3511703_3512417_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_000486912.1|3512603_3513797_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_001147301.1|3513982_3515062_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	8.9e-29
WP_000918353.1|3515093_3516509_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235555.1|3516573_3517557_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891414.1|3517730_3517973_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_001182228.1|3518140_3519139_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|3519226_3520537_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|3520783_3521299_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|3521398_3521608_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|3521629_3521743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128103.1|3521739_3523065_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|3523243_3523852_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|3523960_3524329_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|3524499_3526920_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|3527018_3527891_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|3527904_3528402_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|3528582_3529500_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973678.1|3529663_3531022_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|3531110_3532220_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|3532581_3533772_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382575.1|3533903_3535448_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|3535462_3536353_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|3536518_3536929_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750806.1|3537071_3539168_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|3539167_3539905_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|3539901_3540570_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|3540603_3540846_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790036.1|3541289_3542939_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|3543283_3544633_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|3544763_3545111_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|3545688_3545976_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|3545978_3546584_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|3546596_3546911_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|3547070_3547526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|3547522_3547720_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729849.1|3547709_3549137_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
WP_000907495.1|3549136_3549661_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|3549712_3550030_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185656.1|3549989_3550118_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262484.1|3550214_3552569_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.8e-67
WP_000271429.1|3552568_3553522_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|3553521_3553731_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818152.1|3553718_3554762_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
WP_000679396.1|3554771_3555494_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	2.3e-12
WP_000593184.1|3555817_3556180_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703634.1|3556176_3557106_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000632052.1|3557105_3558653_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	1.6e-50
WP_001093501.1|3558816_3559176_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951728.1|3559166_3560282_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	5.3e-101
WP_000359503.1|3560274_3560907_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000368212.1|3560909_3562391_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.6e-52
WP_001177098.1|3562400_3562916_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	40.7	1.3e-33
>prophage 9
NZ_CP010281	Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 chromosome, complete genome	4830769	3681684	3747465	4830769	head,portal,lysis,terminase,capsid,protease,tail,integrase,plate	Salmonella_phage(40.91%)	78	3711540:3711586	3742519:3742565
WP_000208240.1|3681684_3682215_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|3682224_3683556_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139637.1|3683622_3684552_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|3684644_3685130_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|3685351_3685591_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|3685989_3686835_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|3686855_3688364_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|3688475_3689486_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796293.1|3689582_3690329_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155229.1|3690434_3690863_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802243.1|3690963_3691560_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|3691672_3692440_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088053.1|3692531_3693296_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|3693305_3693596_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774146.1|3693678_3694554_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|3694582_3695605_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|3695633_3696635_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911133.1|3696631_3697675_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167248.1|3697668_3699204_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|3699459_3700419_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|3700505_3702098_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173080.1|3702111_3702462_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000621104.1|3702551_3702683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519915.1|3702960_3703683_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557881.1|3703745_3704786_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646510.1|3704795_3705755_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777320.1|3705765_3707100_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750762.1|3707362_3708118_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|3708218_3709208_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|3709411_3710374_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|3710558_3711461_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
3711540:3711586	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000933379.1|3711747_3712164_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	52.3	1.8e-33
WP_000468311.1|3712198_3712417_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_000627818.1|3712494_3713664_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	95.6	1.4e-205
WP_000978869.1|3713660_3714146_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	94.4	5.9e-81
WP_000069524.1|3714157_3716599_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	93.1	0.0e+00
WP_085984508.1|3716591_3716747_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|3716743_3717079_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207676.1|3717141_3717660_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
WP_001279030.1|3717675_3718863_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
WP_000874698.1|3718997_3719567_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	3.0e-92
WP_000104695.1|3719566_3721309_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	97.1	1.5e-267
WP_001000070.1|3721319_3721850_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
WP_000246674.1|3721842_3722751_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	98.7	1.7e-158
WP_000127150.1|3722757_3723105_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_001093789.1|3723101_3723743_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.0	2.4e-98
WP_000273577.1|3723819_3725196_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_000997680.1|3725200_3725668_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.8	9.8e-49
WP_000277800.1|3725660_3726128_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.0	2.2e-56
WP_000849743.1|3726235_3726649_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	8.4e-36
WP_000534554.1|3726645_3727155_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_000524754.1|3727138_3727360_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001100637.1|3727350_3727554_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000177982.1|3727553_3728054_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_000224816.1|3728151_3728910_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	2.7e-80
WP_001224307.1|3728913_3730074_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.5	2.8e-129
WP_001074705.1|3730105_3730969_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	64.8	4.5e-100
WP_000214048.1|3731133_3732903_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	3.2e-286
WP_000039235.1|3732902_3733940_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.7	7.7e-163
WP_000551923.1|3734460_3734652_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	100.0	1.1e-27
WP_000042036.1|3734650_3735082_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	100.0	1.1e-75
WP_000680929.1|3735215_3736256_+	Fic family protein	NA	S4TP71	Salmonella_phage	100.0	6.3e-197
WP_000037667.1|3736252_3736450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257582.1|3736628_3738905_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	88.0	0.0e+00
WP_000027647.1|3738894_3739170_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	72.5	7.0e-31
WP_001113578.1|3739166_3739391_-	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	75.7	2.0e-23
WP_000557712.1|3739692_3739917_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	78.4	3.4e-23
WP_001670778.1|3739980_3740481_-	hypothetical protein	NA	M1SV55	Escherichia_phage	91.0	1.8e-85
WP_001583792.1|3740650_3740923_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	87.8	1.0e-42
WP_001099751.1|3741059_3741353_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	75.3	1.6e-36
WP_000985251.1|3741422_3742403_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	96.0	1.5e-179
WP_001233463.1|3742587_3743088_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
3742519:3742565	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|3743238_3743937_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|3743933_3745307_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000338672.1|3745354_3745558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133442.1|3745678_3746074_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_077906285.1|3746085_3746838_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|3746844_3747465_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 10
NZ_CP010281	Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 chromosome, complete genome	4830769	4602619	4640590	4830769	head,portal,tail,holin,capsid,terminase,integrase	Cronobacter_phage(71.43%)	42	4596685:4596705	4646483:4646503
4596685:4596705	attL	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
WP_000478471.1|4602619_4604185_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
WP_000983434.1|4604181_4604829_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213689.1|4605060_4605828_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|4606085_4607867_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|4607856_4608894_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568371.1|4608897_4609464_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.2	7.5e-19
WP_000514631.1|4609480_4610062_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|4610205_4610427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|4610457_4610961_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|4610970_4611198_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|4611187_4611613_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|4611612_4612014_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|4612081_4612315_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|4612305_4613166_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|4613162_4615184_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_001552031.1|4615482_4615806_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|4615802_4616864_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|4616860_4618636_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|4618796_4619600_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|4619661_4620684_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|4620687_4621389_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000447487.1|4621449_4621938_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_000084218.1|4621934_4622441_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|4622437_4623145_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|4623141_4624269_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|4624265_4624721_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|4624730_4625024_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|4625020_4625362_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|4625361_4625694_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_000411339.1|4625840_4626098_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|4626285_4628256_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|4628252_4628582_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|4628578_4629763_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001828.1|4629755_4630343_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000084307.1|4630352_4632587_+|tail	tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_000861353.1|4632599_4633154_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000267957.1|4633143_4633869_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000200789.1|4633840_4634386_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_001680744.1|4634388_4636089_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
WP_000340945.1|4637486_4637789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|4638112_4638619_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|4638742_4640590_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
4646483:4646503	attR	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
