The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010283	Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 chromosome, complete genome	4858179	294459	381319	4858179	integrase,holin,portal,capsid,tRNA,terminase,plate,lysis,head,tail	Salmonella_phage(36.71%)	101	321945:321968	350969:350992
WP_000785626.1|294459_294858_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031219.1|294860_295166_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877300.1|295207_295576_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917516.1|295720_296104_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422141.1|296107_296770_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|297219_298464_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098837.1|298718_299687_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	2.2e-39
WP_000617688.1|299957_300956_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951045.1|301044_301737_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|301888_302386_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000019993.1|302471_303608_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000121526.1|303688_305707_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|305877_307257_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_000094651.1|307686_309207_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
WP_000478471.1|309594_311160_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
WP_000983434.1|311156_311804_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213689.1|312035_312803_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|313060_314842_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|314831_315869_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568371.1|315872_316439_-	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.2	7.5e-19
WP_000514631.1|316455_317037_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|317180_317402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|317432_317936_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|317945_318173_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|318162_318588_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|318587_318989_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|319056_319290_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|319280_320141_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|320137_322159_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
321945:321968	attL	GGAGTTCTGTCAATAACTGTACGG	NA	NA	NA	NA
WP_000353141.1|322278_322485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|322458_322782_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|322778_323840_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|323836_325612_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|325772_326576_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|326637_327660_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|327663_328365_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_001680743.1|328461_328914_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_000084218.1|328910_329417_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|329413_330121_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|330117_331245_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|331241_331697_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|331706_332000_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|331996_332338_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|332337_332670_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_001670161.1|332641_332830_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000411339.1|332816_333074_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|333261_335232_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|335228_335558_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|335554_336739_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001828.1|336731_337319_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000084307.1|337328_339563_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_000861353.1|339575_340130_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000267957.1|340119_340845_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000200789.1|340816_341362_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000977530.1|341361_343065_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
WP_000340945.1|344462_344765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218395.1|345004_346042_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	97.1	1.1e-198
WP_001217271.1|346041_346620_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	63.0	3.5e-64
WP_000135597.1|346750_347014_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.7	3.3e-38
WP_000459332.1|347044_347554_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	6.2e-89
WP_000920168.1|347561_347789_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	2.1e-36
WP_000085639.1|347775_347976_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	98.5	2.3e-31
WP_001246236.1|348045_348273_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.6e-31
WP_000752604.1|348272_348497_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	100.0	6.5e-35
WP_153259982.1|348518_349112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077908944.1|349110_351357_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	93.9	0.0e+00
350969:350992	attR	GGAGTTCTGTCAATAACTGTACGG	NA	NA	NA	NA
WP_010835751.1|351501_351690_+	hypothetical protein	NA	A0A218M4I0	Erwinia_phage	91.5	2.8e-23
WP_000209110.1|352476_352749_-	hypothetical protein	NA	A0A0M4R4Y4	Salmonella_phage	76.4	3.4e-17
WP_000214157.1|352920_354138_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000517958.1|354189_355236_-|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	4.4e-190
WP_000156056.1|355235_357005_-|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	100.0	0.0e+00
WP_010835845.1|357170_358025_+|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	98.6	4.0e-157
WP_031625105.1|358101_359169_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.4	5.8e-198
WP_024141985.1|359172_359922_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	98.4	4.0e-129
WP_000214255.1|360015_360522_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_010835843.1|360521_360725_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	95.5	4.4e-30
WP_000134659.1|360728_361025_+|holin	phage holin family protein	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
WP_001144116.1|361011_361509_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_010835756.1|361505_361919_+|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	99.3	9.9e-45
WP_001394645.1|361890_362064_+	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_010835757.1|362026_362494_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	99.4	7.2e-84
WP_045187714.1|362486_362936_+	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	98.0	7.9e-72
WP_010835841.1|363004_363646_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	99.1	2.0e-113
WP_000127148.1|363642_363990_+	GPW/gp25 family protein	NA	S4TRW8	Salmonella_phage	100.0	2.5e-57
WP_001534894.1|363996_364905_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	99.7	5.7e-162
WP_010835760.1|364897_365428_+|tail	phage tail protein I	tail	S4TTA8	Salmonella_phage	100.0	3.5e-103
WP_045187718.1|365438_367553_+|tail	tail fiber protein	tail	Q6K1H2	Salmonella_virus	75.9	1.4e-232
WP_000122996.1|367565_368114_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	100.0	9.9e-101
WP_045187722.1|368248_369427_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	99.2	1.4e-221
WP_001207675.1|369442_369961_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001029726.1|370023_370359_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	100.0	1.4e-52
WP_085984508.1|370355_370511_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_023253866.1|370503_372945_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	92.4	0.0e+00
WP_000978862.1|372959_373445_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	100.0	3.6e-86
WP_010835765.1|373441_374611_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	97.4	5.6e-210
WP_000468307.1|374677_374896_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	9.5e-39
WP_000237776.1|375254_375761_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|375884_377732_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918864.1|377881_379627_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|379862_380078_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264391.1|380305_381319_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
>prophage 2
NZ_CP010283	Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 chromosome, complete genome	4858179	855041	860854	4858179		Enterobacteria_phage(100.0%)	8	NA	NA
WP_000783706.1|855041_857375_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.5	0.0e+00
WP_000743153.1|857389_857710_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216598.1|857706_857934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980354.1|857930_858488_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	66.4	2.7e-29
WP_000556587.1|858484_858751_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_000194694.1|859291_860029_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	65.3	3.1e-81
WP_000984206.1|860025_860271_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	4.8e-31
WP_000210079.1|860287_860854_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.2	3.8e-55
>prophage 3
NZ_CP010283	Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 chromosome, complete genome	4858179	921005	997751	4858179	transposase,integrase,holin,tail,portal,capsid,protease,terminase,lysis,head,tRNA	Salmonella_phage(36.84%)	89	913086:913102	1003598:1003614
913086:913102	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997365.1|921005_922043_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|922158_922848_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|923166_923550_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|923611_924199_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001670786.1|924301_925201_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|925218_926553_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083342.1|926682_927420_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989165.1|927404_929027_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|929290_929455_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|929451_930027_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|930058_930709_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|930708_931665_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589050.1|931661_932141_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007934.1|932638_933868_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	4.9e-233
WP_001670787.1|933845_934130_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|934170_934410_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|934452_935610_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017128.1|935572_938500_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_001539619.1|938626_938977_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|938998_939157_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|939613_940276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|940275_940662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|940654_941494_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|941552_941948_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|942047_942290_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|942249_942624_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000024044.1|942715_943600_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801764.1|943596_944292_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|944305_945004_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|945111_945744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|945986_946220_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|946336_946585_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|946619_947222_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096562.1|947430_948042_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.5	1.8e-90
WP_000801757.1|948038_948179_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|948175_948853_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|949125_949689_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|950195_950384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|950598_951285_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|951560_951890_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|951873_952326_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|952343_952796_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|953031_953433_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|953719_954265_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|954236_956168_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|956151_956355_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|956351_957932_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|957921_959418_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|959430_959778_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|959832_960861_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|960918_961278_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083294.1|961288_961672_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|961699_962278_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|962326_963457_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|963565_963967_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|963974_964721_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|964771_965167_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|965163_965502_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|965473_968569_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|968571_968901_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|968910_969609_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|969615_970353_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|970250_970898_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|970959_974322_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|974360_974603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|974656_977029_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|977025_977850_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|977839_978418_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|978514_978742_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|978848_979061_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|979813_979933_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|980645_980783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|981273_982767_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|983171_984971_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|984987_985962_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|986235_986916_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|986912_987818_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|987829_988558_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|988569_989301_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986042.1|989300_989681_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|989792_990053_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022472.1|990090_991017_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	1.8e-09
WP_001276364.1|991132_992329_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684023.1|992350_993268_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995694.1|993306_994155_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|994270_995164_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|995174_996536_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|996539_997175_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134572.1|997199_997751_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1003598:1003614	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 4
NZ_CP010283	Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 chromosome, complete genome	4858179	1441659	1450830	4858179	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1441659_1442607_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1442590_1443322_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1443302_1443410_-	protein YohO	NA	NA	NA	NA	NA
WP_001240417.1|1443469_1444201_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1444423_1446109_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1446105_1446825_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1446871_1447339_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1447395_1447926_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1448097_1448556_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|1448796_1450830_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP010283	Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 chromosome, complete genome	4858179	1518921	1529428	4858179		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111837.1|1518921_1520325_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981471.1|1520502_1521396_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1521772_1522858_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023659.1|1522857_1523757_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857530.1|1523804_1524683_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_000973714.1|1524683_1525235_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000018224.1|1525240_1526215_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1526230_1527004_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565902.1|1527008_1528088_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000126351.1|1528114_1529428_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 6
NZ_CP010283	Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 chromosome, complete genome	4858179	1625958	1633209	4858179		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1625958_1626378_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457658.1|1626380_1627649_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000208509.1|1628103_1628316_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1628326_1628515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080660.1|1628772_1629969_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_000107431.1|1630618_1630930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377036.1|1631009_1631705_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	2.8e-07
WP_001157313.1|1631778_1633209_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP010283	Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 chromosome, complete genome	4858179	2533227	2653078	4858179	integrase,holin,portal,capsid,protease,terminase,plate,lysis,tail	Salmonella_phage(52.53%)	145	2534028:2534087	2575894:2575971
WP_000938182.1|2533227_2533908_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
2534028:2534087	attL	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTC	NA	NA	NA	NA
WP_000503667.1|2534619_2535267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001670723.1|2535309_2535507_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
WP_127913510.1|2535689_2535935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000033280.1|2536132_2536525_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
WP_000370530.1|2536634_2537243_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
WP_071786695.1|2537305_2537491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421108.1|2537739_2538258_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
WP_001670454.1|2538272_2539805_-	hypothetical protein	NA	S4TP62	Salmonella_phage	66.2	1.4e-128
WP_000049939.1|2539804_2540485_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
WP_001197089.1|2540481_2541681_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
WP_001270641.1|2541681_2542035_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
WP_000301078.1|2542034_2542787_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
WP_000931859.1|2542905_2543361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819157.1|2543444_2543777_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
WP_000081749.1|2543773_2544841_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
WP_000155111.1|2544843_2545146_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000353826.1|2545145_2545721_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000990866.1|2545720_2547730_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
WP_000389049.1|2547907_2548360_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
WP_000535992.1|2548363_2548807_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	1.0e-55
WP_001135539.1|2548819_2549965_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	1.2e-164
WP_001670724.1|2549968_2550532_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_001121925.1|2550506_2550896_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.1e-68
WP_000008738.1|2550882_2551437_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.4e-94
WP_001125672.1|2551433_2551841_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	3.0e-70
WP_001040693.1|2551806_2552196_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	62.0	4.0e-32
WP_000627463.1|2552237_2553179_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	3.1e-179
WP_000128057.1|2553190_2553688_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873181.1|2553692_2554925_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.3	3.7e-228
WP_137911068.1|2554928_2555675_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	91.2	3.1e-97
WP_000113503.1|2555559_2557029_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.3e-280
WP_001130808.1|2557028_2558651_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_001118126.1|2558653_2559283_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	1.5e-108
WP_086374239.1|2559783_2560239_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.8	1.3e-53
WP_000951228.1|2560556_2561096_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	74.1	4.0e-78
WP_001525456.1|2561073_2561376_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000658037.1|2561578_2561767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640103.1|2562159_2562738_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
WP_000717784.1|2562734_2563028_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000090037.1|2563024_2563621_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000474096.1|2563689_2563881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129735.1|2564064_2564403_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_000180135.1|2564402_2564573_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
WP_001037052.1|2564569_2565172_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
WP_000918617.1|2565164_2565413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130738.1|2565416_2566097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000074839.1|2566134_2567523_-	DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
WP_000063056.1|2567519_2568500_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
WP_001195066.1|2568502_2568727_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_001643782.1|2568749_2569196_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
WP_023972394.1|2569601_2570057_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	4.6e-35
WP_000387662.1|2570741_2571065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192832.1|2571072_2571318_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_000158391.1|2571347_2573612_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.7	1.5e-102
WP_000205292.1|2573608_2574163_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
WP_000916251.1|2574165_2574348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196402.1|2574560_2574785_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533596.1|2574785_2575805_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000374046.1|2576392_2577052_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
2575894:2575971	attR	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCGG	NA	NA	NA	NA
WP_000904446.1|2577138_2577468_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2577464_2577746_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2577794_2578574_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859429.1|2578599_2579148_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140482.1|2579362_2580574_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2580631_2580949_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2580993_2581407_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847732.1|2581580_2582243_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2582337_2582796_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420513.1|2582831_2584886_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.1e-19
WP_001261222.1|2585009_2585456_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2585474_2587628_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2587614_2588220_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2588436_2588946_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|2589302_2590355_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2590426_2590879_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2591064_2592825_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2592893_2593412_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2593511_2593679_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2593934_2594498_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2594494_2596135_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2596139_2597393_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2597407_2599315_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2599327_2601436_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224072.1|2601534_2602644_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001670452.1|2602640_2603183_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2603348_2604359_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193770.1|2604566_2607179_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000497441.1|2607605_2607797_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2608067_2608754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2608738_2609038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2609106_2609733_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001526469.1|2610380_2611349_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000143167.1|2611824_2612406_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2612405_2614844_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2614897_2615140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541993.1|2615178_2616054_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000246065.1|2618600_2619305_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2619202_2619940_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2619949_2620645_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2620734_2621268_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2621384_2621882_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2621980_2622313_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2622309_2625297_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2625376_2625706_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2625702_2626101_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2626146_2626896_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2626907_2627309_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2627305_2627872_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2627852_2628152_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2628144_2628468_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2628558_2630640_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|2630563_2632111_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|2632107_2632314_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2632310_2634449_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2634405_2634939_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2635146_2635626_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2635643_2636096_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2636079_2636409_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2636684_2637371_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2637731_2638181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2638316_2638442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2638615_2638933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2638999_2639797_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2639786_2639933_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2639929_2640541_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929805.1|2640749_2641352_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2641434_2641656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2641767_2642001_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2642292_2642583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2642660_2642972_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2642968_2643316_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2643326_2644076_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2644078_2645062_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2645146_2645521_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2645486_2645726_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2645845_2646256_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014344008.1|2646305_2646566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2646558_2646717_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2646738_2647038_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017133.1|2647164_2650050_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|2650012_2651170_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2651212_2651452_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2651492_2651741_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2651785_2653078_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
>prophage 8
NZ_CP010283	Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 chromosome, complete genome	4858179	2724258	2731572	4858179	protease	Ralstonia_phage(16.67%)	7	NA	NA
WP_001670446.1|2724258_2724636_+	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	42.7	5.9e-20
WP_001117984.1|2724797_2724995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2725208_2727485_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2727515_2727836_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2728159_2728381_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|2728510_2730457_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_001201748.1|2730453_2731572_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.8e-08
>prophage 9
NZ_CP010283	Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 chromosome, complete genome	4858179	4083282	4128058	4858179	tail,plate,tRNA	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4083282_4084281_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|4084368_4085679_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4085925_4086441_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4086540_4086750_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4086771_4086885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128103.1|4086881_4088207_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4088385_4088994_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4089102_4089471_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4089641_4092062_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4092160_4093033_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4093046_4093544_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4093724_4094642_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973678.1|4094805_4096164_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4096252_4097362_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4097723_4098914_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382575.1|4099045_4100590_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4100604_4101495_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4101660_4102071_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750806.1|4102213_4104310_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4104309_4105047_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4105043_4105712_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4105745_4105988_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790036.1|4106431_4108081_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4108425_4109775_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4109905_4110253_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4110830_4111118_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4111120_4111726_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4111738_4112053_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4112212_4112668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4112664_4112862_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729849.1|4112851_4114279_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
WP_000907495.1|4114278_4114803_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4114854_4115172_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185656.1|4115131_4115260_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262484.1|4115356_4117711_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.8e-67
WP_000271429.1|4117710_4118664_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4118663_4118873_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818152.1|4118860_4119904_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
WP_000679396.1|4119913_4120636_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	2.3e-12
WP_000593184.1|4120959_4121322_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703634.1|4121318_4122248_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000632052.1|4122247_4123795_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	1.6e-50
WP_001093501.1|4123958_4124318_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951728.1|4124308_4125424_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	5.3e-101
WP_000359503.1|4125416_4126049_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000368212.1|4126051_4127533_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.6e-52
WP_001177098.1|4127542_4128058_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	40.7	1.3e-33
>prophage 10
NZ_CP010283	Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 chromosome, complete genome	4858179	4246833	4312614	4858179	integrase,portal,capsid,protease,terminase,plate,lysis,head,tail	Salmonella_phage(40.91%)	77	4276689:4276735	4307668:4307714
WP_000208240.1|4246833_4247364_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|4247373_4248705_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139637.1|4248771_4249701_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|4249793_4250279_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|4250500_4250740_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|4251138_4251984_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|4252004_4253513_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|4253624_4254635_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796293.1|4254731_4255478_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155229.1|4255583_4256012_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802242.1|4256112_4256709_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|4256821_4257589_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088053.1|4257680_4258445_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|4258454_4258745_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774146.1|4258827_4259703_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|4259731_4260754_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|4260782_4261784_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911133.1|4261780_4262824_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167248.1|4262817_4264353_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|4264608_4265568_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|4265654_4267247_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173080.1|4267260_4267611_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001519915.1|4268109_4268832_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557881.1|4268894_4269935_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646510.1|4269944_4270904_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777320.1|4270914_4272249_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750762.1|4272511_4273267_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|4273367_4274357_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|4274560_4275523_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|4275707_4276610_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4276689:4276735	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000933379.1|4276896_4277313_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	52.3	1.8e-33
WP_000468311.1|4277347_4277566_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_000627818.1|4277643_4278813_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	95.6	1.4e-205
WP_000978869.1|4278809_4279295_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	94.4	5.9e-81
WP_000069524.1|4279306_4281748_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	93.1	0.0e+00
WP_085984508.1|4281740_4281896_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|4281892_4282228_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207676.1|4282290_4282809_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
WP_001279030.1|4282824_4284012_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
WP_000874698.1|4284146_4284716_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	3.0e-92
WP_000104695.1|4284715_4286458_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	97.1	1.5e-267
WP_001000070.1|4286468_4286999_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
WP_000246674.1|4286991_4287900_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	98.7	1.7e-158
WP_000127150.1|4287906_4288254_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_001093789.1|4288250_4288892_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.0	2.4e-98
WP_000273577.1|4288968_4290345_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_000997680.1|4290349_4290817_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.8	9.8e-49
WP_000277800.1|4290809_4291277_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.0	2.2e-56
WP_000849743.1|4291384_4291798_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	8.4e-36
WP_000534554.1|4291794_4292304_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_000524754.1|4292287_4292509_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001100637.1|4292499_4292703_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000177982.1|4292702_4293203_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_000224816.1|4293300_4294059_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	2.7e-80
WP_001224307.1|4294062_4295223_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.5	2.8e-129
WP_001074705.1|4295254_4296118_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	64.8	4.5e-100
WP_000214048.1|4296282_4298052_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	3.2e-286
WP_000039235.1|4298051_4299089_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.7	7.7e-163
WP_000551923.1|4299609_4299801_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	100.0	1.1e-27
WP_000042036.1|4299799_4300231_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	100.0	1.1e-75
WP_000680929.1|4300364_4301405_+	Fic family protein	NA	S4TP71	Salmonella_phage	100.0	6.3e-197
WP_000037667.1|4301401_4301599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257582.1|4301777_4304054_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	88.0	0.0e+00
WP_000027647.1|4304043_4304319_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	72.5	7.0e-31
WP_001113578.1|4304315_4304540_-	TraR/DksA C4-type zinc finger protein	NA	A0A0F7LDG9	Escherichia_phage	75.7	2.0e-23
WP_000557712.1|4304841_4305066_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	78.4	3.4e-23
WP_001670778.1|4305129_4305630_-	hypothetical protein	NA	M1SV55	Escherichia_phage	91.0	1.8e-85
WP_001583792.1|4305799_4306072_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	87.8	1.0e-42
WP_001099751.1|4306208_4306502_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	75.3	1.6e-36
WP_000985251.1|4306571_4307552_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	96.0	1.5e-179
WP_001233463.1|4307736_4308237_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4307668:4307714	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|4308387_4309086_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4309082_4310456_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000338672.1|4310503_4310707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133442.1|4310827_4311223_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000559230.1|4311234_4311924_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|4311993_4312614_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
