The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017522	Mycobacterium tuberculosis CCDC5180, complete sequence	4405981	2929390	2967664	4405981	integrase,head,protease,capsid,terminase,tRNA	Mycobacterium_phage(33.33%)	45	2958193:2958220	2967817:2967844
WP_003413486.1|2929390_2931469_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2931577_2931805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413569.1|2933532_2934033_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2934049_2934490_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003902320.1|2934585_2935314_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2935298_2935652_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2935664_2936090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2936086_2936761_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2936838_2937660_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2937795_2938689_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2938691_2939510_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2939524_2940706_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2940764_2941196_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2941709_2942951_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085976157.1|2943365_2943623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2943969_2945094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2945095_2945635_+	archease	NA	NA	NA	NA	NA
WP_003413619.1|2947111_2947393_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2947537_2948023_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2948049_2948304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2948307_2950644_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2950672_2950915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2950915_2951593_+	chloramphenicol phosphotransferase CPT family protein	NA	NA	NA	NA	NA
WP_003413654.1|2951788_2952445_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2952607_2953054_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2953228_2953561_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2953680_2954040_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2954141_2954600_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2954736_2955117_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2955113_2956610_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2956844_2957036_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2958193:2958220	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2958326_2958758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2958754_2959753_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2959766_2960231_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2960218_2960470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2960640_2962080_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2962087_2962621_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003900541.1|2962773_2963265_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	9.4e-18
WP_003899414.1|2963431_2963755_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2963834_2964080_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2964076_2965504_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2965505_2965898_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2965894_2966155_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2966171_2966534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2966536_2967664_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2967817:2967844	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
