The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015737	Clostridium sp. SY8519, complete genome	2835737	42392	92475	2835737	capsid,transposase,protease,integrase	Lactococcus_phage(16.67%)	51	58349:58392	92564:92607
WP_013975993.1|42392_43895_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	49.2	7.2e-93
WP_013975994.1|44129_46619_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_013975995.1|46757_47537_-	uridine phosphorylase	NA	NA	NA	NA	NA
WP_013975996.1|47716_48649_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	60.2	4.2e-91
WP_013975997.1|48917_49352_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_041727500.1|49451_50225_-	arginase family protein	NA	NA	NA	NA	NA
WP_041728015.1|50274_51069_-	anaerobic sulfite reductase subunit AsrB	NA	NA	NA	NA	NA
WP_013976000.1|51157_53026_-	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_013976001.1|53018_53657_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_013976002.1|53681_56483_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.5	2.7e-45
WP_013976003.1|56792_58214_-	MATE family efflux transporter	NA	NA	NA	NA	NA
58349:58392	attL	TGAGGCATCGGGGATTCGAACCCCGGACAACTTGATTAAAAGTC	NA	NA	NA	NA
WP_148267759.1|59348_59675_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_013976007.1|59677_59875_-	hypothetical protein	NA	Q4ZA73	Staphylococcus_virus	65.0	3.3e-14
WP_013976008.1|59938_60244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976009.1|60230_60434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976011.1|60878_61049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148267760.1|61045_61417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148267761.1|61490_61979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976014.1|62179_62371_-	D-alanine--D-alanine ligase	NA	Q6SED4	Lactobacillus_prophage	37.7	5.8e-08
WP_158309827.1|62367_62514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976016.1|62532_62742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976017.1|62773_63037_-	hypothetical protein	NA	A0A1P8BMG7	Lactococcus_phage	37.0	2.3e-07
WP_013976018.1|63064_63250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148267762.1|63612_64083_-	hypothetical protein	NA	A0A1P8BMG7	Lactococcus_phage	41.3	3.2e-15
WP_013976021.1|64073_64292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158309828.1|64304_65135_-|capsid	minor capsid protein	capsid	D7RWC7	Brochothrix_phage	39.0	1.5e-23
WP_013976023.1|65286_65922_-	phage scaffolding protein	NA	A0A0A7S0J5	Clostridium_phage	41.3	5.8e-28
WP_013976024.1|66375_66582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976025.1|67122_68289_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.9	2.2e-25
WP_013976028.1|68938_69232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976029.1|69275_69494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976030.1|69451_70231_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013976031.1|70487_71753_-	MFS transporter	NA	NA	NA	NA	NA
WP_013976034.1|72713_73823_-	butyrate kinase	NA	NA	NA	NA	NA
WP_013976035.1|73842_74847_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_013976036.1|75015_76542_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013976037.1|76672_77701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013976038.1|77754_78582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976039.1|78659_78950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976040.1|79184_80900_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_013976041.1|80911_81187_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_013976042.1|81199_82945_-	iron hydrogenase small subunit	NA	NA	NA	NA	NA
WP_013976043.1|83197_84004_-	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_013976044.1|84023_85106_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_013976045.1|85116_86412_-	thiolase family protein	NA	NA	NA	NA	NA
WP_013976046.1|86620_87523_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013976047.1|87659_88766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013976048.1|88958_90494_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013976049.1|90546_91347_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041727507.1|91324_92029_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	29.3	1.6e-15
WP_083834927.1|92301_92475_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIE1	Clostridium_phage	51.0	5.8e-07
92564:92607	attR	TGAGGCATCGGGGATTCGAACCCCGGACAACTTGATTAAAAGTC	NA	NA	NA	NA
>prophage 2
NC_015737	Clostridium sp. SY8519, complete genome	2835737	154435	174240	2835737	capsid,terminase,plate,portal	Clostridium_phage(70.59%)	23	NA	NA
WP_013976116.1|154435_155572_-|plate	baseplate J/gp47 family protein	plate	A0A0A8WFK0	Clostridium_phage	38.5	7.9e-60
WP_013976117.1|155564_155981_-	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	35.7	9.7e-16
WP_013976118.1|155982_156270_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_013976119.1|156259_158209_-	CHAP domain-containing protein	NA	X5JAJ3	Clostridium_phage	44.3	2.0e-66
WP_013976120.1|158237_159068_-	LysM peptidoglycan-binding domain-containing protein	NA	X5J9Z8	Clostridium_phage	29.0	1.8e-16
WP_013976121.1|159067_161278_-	hypothetical protein	NA	H7BVH2	unidentified_phage	24.8	2.0e-35
WP_013976123.1|161460_161895_-	hypothetical protein	NA	X5JAB6	Clostridium_phage	37.5	1.5e-19
WP_013976124.1|162003_162489_-	hypothetical protein	NA	A0A0A8WJ62	Clostridium_phage	25.4	2.7e-09
WP_013976125.1|162510_163848_-	hypothetical protein	NA	X5JAJ1	Clostridium_phage	36.4	2.4e-76
WP_013976126.1|163844_164057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148267766.1|164098_164542_-	hypothetical protein	NA	A0A0A8WJT3	Clostridium_phage	30.7	2.6e-11
WP_013976128.1|164538_164973_-	HK97 gp10 family phage protein	NA	Q20DD1	Lactobacillus_phage	35.4	2.9e-15
WP_013976129.1|164977_165358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976130.1|165360_165720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976131.1|165785_166775_-	hypothetical protein	NA	A0A0A7RVZ1	Clostridium_phage	59.6	5.5e-110
WP_013976132.1|166809_167445_-	phage scaffolding protein	NA	A0A0A7S0J5	Clostridium_phage	44.3	7.3e-31
WP_041727518.1|167596_167851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976134.1|167945_168194_-	hypothetical protein	NA	C1KFI4	Lactobacillus_virus	55.0	2.5e-19
WP_013976135.1|168505_170035_-|capsid	minor capsid protein	capsid	X5JAI9	Clostridium_phage	46.2	2.1e-87
WP_013976136.1|170031_171546_-|portal	phage portal protein	portal	A0A0A7S0I9	Clostridium_phage	54.7	4.2e-141
WP_013976137.1|171560_173093_-|terminase	PBSX family phage terminase large subunit	terminase	S5MC58	Brevibacillus_phage	63.4	9.4e-141
WP_148267767.1|173223_173424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976139.1|173847_174240_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0C5AEN7	Bacteriophage	40.0	4.4e-18
>prophage 3
NC_015737	Clostridium sp. SY8519, complete genome	2835737	756406	766073	2835737	holin	Erysipelothrix_phage(33.33%)	8	NA	NA
WP_013976659.1|756406_758278_-	ribonuclease H-like domain-containing protein	NA	A0A0K2SUJ2	Clostridium_phage	34.9	4.5e-20
WP_013976660.1|758457_760035_-	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	54.4	4.6e-151
WP_013976661.1|760019_761753_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	45.5	4.1e-68
WP_013976662.1|761809_761974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976663.1|761963_762389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976664.1|762709_764029_-	CHAP domain-containing protein	NA	H7BV84	unidentified_phage	54.6	3.5e-59
WP_013976665.1|764029_764443_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	62.5	4.4e-45
WP_013976666.1|764459_766073_-	hypothetical protein	NA	A0A075KQI0	Lactobacillus_phage	40.0	5.4e-22
>prophage 4
NC_015737	Clostridium sp. SY8519, complete genome	2835737	803018	859656	2835737	transposase,tRNA,protease,integrase	Klosneuvirus(16.67%)	55	825429:825443	854768:854782
WP_013976699.1|803018_804944_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	39.8	1.0e-91
WP_013976700.1|805074_805548_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_013976701.1|805688_806645_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_013976702.1|806815_807583_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_013976703.1|807671_808022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976704.1|808111_809086_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_013976705.1|809261_810254_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_013976706.1|810273_811209_-	SPFH/Band 7/PHB domain protein	NA	A0A2K9KZA2	Tupanvirus	29.6	7.5e-16
WP_013976707.1|811241_811721_-	NfeD family protein	NA	NA	NA	NA	NA
WP_148267779.1|811807_813157_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_013976709.1|813370_814450_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_013976710.1|814551_816315_-	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_013976711.1|816345_817197_-	AmmeMemoRadiSam system radical SAM enzyme	NA	NA	NA	NA	NA
WP_013976712.1|817208_818525_-	AmmeMemoRadiSam system protein A	NA	NA	NA	NA	NA
WP_013976713.1|818562_818985_-	HIT family protein	NA	B5LJ12	Mycobacterium_phage	31.1	2.3e-09
WP_013976714.1|819072_819729_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_013976715.1|819794_821201_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_013976716.1|821222_821492_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_013976717.1|821498_821939_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_013976718.1|821968_822829_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_013976719.1|823121_824723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976720.1|824719_824899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976721.1|824955_826188_-	hypothetical protein	NA	NA	NA	NA	NA
825429:825443	attL	TCTTTGCTTTTCTTT	NA	NA	NA	NA
WP_013976722.1|826204_827011_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_013976723.1|826898_827264_-	type IV secretory pathway	NA	NA	NA	NA	NA
WP_041727598.1|827415_830475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013976725.1|830467_831040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013976726.1|831791_832163_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_013976727.1|832120_833254_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_013976728.1|833147_833912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013976729.1|833948_834137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013976730.1|834313_835558_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.9	1.2e-45
WP_013976731.1|835671_835932_-	dehydrogenase	NA	NA	NA	NA	NA
WP_013976732.1|836132_836843_-	recombinase family protein	NA	NA	NA	NA	NA
WP_013976734.1|837016_837199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976735.1|837200_840554_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_013976736.1|840553_841588_-	Eco57I restriction-modification methylase domain-containing protein	NA	NA	NA	NA	NA
WP_013976737.1|841599_842526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976738.1|842841_843450_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148267844.1|843670_843865_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013976741.1|843981_844662_+	recombinase family protein	NA	NA	NA	NA	NA
WP_013976742.1|844658_846302_+	recombinase family protein	NA	A0A2I4R675	Erysipelothrix_phage	23.9	1.2e-24
WP_013976743.1|846451_846748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013976744.1|846879_847260_-	TnpV protein	NA	NA	NA	NA	NA
WP_013976745.1|847280_847688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041728358.1|847671_849177_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013976747.1|849166_850897_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_083834959.1|850915_852073_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013976749.1|852258_853056_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013976750.1|853717_854104_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_083835052.1|854229_854973_-	L-2-amino-thiazoline-4-carboxylic acid hydrolase	NA	NA	NA	NA	NA
854768:854782	attR	TCTTTGCTTTTCTTT	NA	NA	NA	NA
WP_002576323.1|855492_856242_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002576324.1|856234_857152_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.2	6.0e-42
WP_041728366.1|857332_857959_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041727604.1|858504_859656_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_015737	Clostridium sp. SY8519, complete genome	2835737	1342340	1380913	2835737	transposase,integrase	uncultured_virus(40.0%)	33	1379673:1379689	1381156:1381172
WP_013977179.1|1342340_1342664_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_013977182.1|1343160_1343859_-	MIP family channel protein	NA	NA	NA	NA	NA
WP_013977183.1|1344014_1344578_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041727588.1|1344756_1346187_+|transposase	ISLre2-like element ISClsp4 family transposase	transposase	NA	NA	NA	NA
WP_050979222.1|1346581_1347355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013977186.1|1347538_1353199_+	Cna B-type domain-containing protein	NA	NA	NA	NA	NA
WP_013977187.1|1353798_1355043_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.9	1.2e-45
WP_083834971.1|1355300_1355537_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_013977189.1|1355834_1356692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013977190.1|1357038_1358793_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013977195.1|1361485_1361839_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013977196.1|1361835_1362129_+	helix-turn-helix domain-containing protein	NA	A0A088CD40	Shigella_phage	40.4	1.4e-08
WP_148267792.1|1362231_1362564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013977198.1|1362656_1362797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013977199.1|1363165_1363654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013977200.1|1363644_1364190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013977201.1|1364192_1364930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070097172.1|1365049_1365682_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	47.9	1.0e-08
WP_083835060.1|1365875_1366016_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148267794.1|1366012_1366252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013977204.1|1366257_1366701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013977206.1|1367210_1367390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013977187.1|1367444_1368689_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.9	1.2e-45
WP_013977207.1|1369111_1369327_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_148267795.1|1371290_1371650_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013977211.1|1371636_1372029_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_013977213.1|1372870_1373239_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013977214.1|1373243_1374116_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_013977215.1|1374151_1374337_+	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_013977216.1|1375492_1375864_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_013977217.1|1375884_1379118_+	VaFE repeat-containing surface-anchored protein	NA	NA	NA	NA	NA
WP_013977218.1|1379359_1379563_+	hypothetical protein	NA	NA	NA	NA	NA
1379673:1379689	attL	CAGAAAGAAGGAATGAT	NA	NA	NA	NA
WP_013977219.1|1379692_1380913_+|integrase	site-specific integrase	integrase	H7BUX8	unidentified_phage	37.3	6.3e-71
WP_013977219.1|1379692_1380913_+|integrase	site-specific integrase	integrase	H7BUX8	unidentified_phage	37.3	6.3e-71
1381156:1381172	attR	CAGAAAGAAGGAATGAT	NA	NA	NA	NA
>prophage 6
NC_015737	Clostridium sp. SY8519, complete genome	2835737	2653106	2657842	2835737		uncultured_phage(33.33%)	7	NA	NA
WP_013978361.1|2653106_2654135_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A067ZJG7	Escherichia_phage	34.9	7.4e-49
WP_013978362.1|2654131_2654671_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_013978363.1|2654693_2655185_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	61.4	5.8e-44
WP_013978364.1|2655323_2656004_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1U9WRB5	Streptococcus_virus	52.9	8.0e-60
WP_013978365.1|2656122_2656707_-	GTP cyclohydrolase I FolE	NA	S4U0J3	uncultured_phage	53.6	2.3e-47
WP_013978366.1|2656710_2657388_-	putative 7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	43.6	1.7e-41
WP_013978367.1|2657422_2657842_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	31.6	6.3e-07
>prophage 7
NC_015737	Clostridium sp. SY8519, complete genome	2835737	2702616	2743829	2835737	transposase,integrase	Leptospira_phage(20.0%)	38	2719337:2719352	2726572:2726587
WP_013978411.1|2702616_2702988_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_173363206.1|2703225_2704449_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.3	8.0e-42
WP_013977274.1|2704588_2705971_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	30.8	5.1e-29
WP_013978414.1|2706170_2707604_-	adenylosuccinate lyase	NA	NA	NA	NA	NA
WP_013978415.1|2707705_2708587_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.2	2.7e-39
WP_013978416.1|2708656_2710204_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_041729178.1|2710293_2711043_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_013978418.1|2711093_2712299_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_013978420.1|2712568_2713582_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_013978421.1|2713783_2714587_+	histidinol-phosphatase HisJ family protein	NA	NA	NA	NA	NA
WP_083835036.1|2714778_2716647_-	fibronectin type III domain-containing protein	NA	A0A2K9V3I9	Faecalibacterium_phage	28.9	5.0e-11
WP_013978423.1|2716880_2717438_-	elongation factor P	NA	NA	NA	NA	NA
WP_013978424.1|2717517_2717973_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_013978425.1|2717969_2718569_-	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_013978426.1|2718568_2719033_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_013978427.1|2719055_2720156_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
2719337:2719352	attL	GGATCAGCTTCTCCAG	NA	NA	NA	NA
WP_013978428.1|2720264_2721395_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	27.5	3.7e-33
WP_041729184.1|2721525_2721735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013978430.1|2721769_2721970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050979245.1|2722365_2723226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148267823.1|2723258_2725703_-	type II restriction endonuclease subunit M	NA	NA	NA	NA	NA
WP_013978433.1|2725930_2727121_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.7	1.0e-46
2726572:2726587	attR	GGATCAGCTTCTCCAG	NA	NA	NA	NA
WP_013978434.1|2727715_2728318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013978435.1|2728310_2729282_-	hypothetical protein	NA	S5VKI3	Leptospira_phage	37.2	1.6e-56
WP_013978436.1|2729253_2729772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013978438.1|2730252_2730438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148267825.1|2730628_2731435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013978440.1|2731586_2731748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013978441.1|2731788_2732322_-	VanZ family protein	NA	NA	NA	NA	NA
WP_013978442.1|2732798_2734277_+	nucleotide sugar dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	50.5	5.2e-104
WP_013978443.1|2734455_2735835_-	ATP--cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
WP_041729192.1|2735954_2736716_-	YdcF family protein	NA	NA	NA	NA	NA
WP_013978445.1|2736740_2737094_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.8	3.6e-19
WP_148267876.1|2737394_2738528_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013978447.1|2738529_2740113_-	acyl CoA:acetate/3-ketoacid CoA transferase	NA	NA	NA	NA	NA
WP_013978448.1|2740226_2741504_-	MFS transporter	NA	NA	NA	NA	NA
WP_013978449.1|2741523_2742339_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_148267826.1|2742617_2743829_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	38.2	1.6e-39
