The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018011	Alistipes finegoldii DSM 17242, complete sequence	3734239	525161	597173	3734239	tRNA,integrase,protease,transposase	unidentified_phage(20.0%)	54	531484:531498	599780:599794
WP_009316578.1|525161_526367_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	59.7	5.2e-62
WP_014774618.1|526466_526874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014774619.1|526887_531066_-	hypothetical protein	NA	A0A1B0WM17	Flavobacterium_phage	28.9	5.0e-27
WP_014774620.1|531200_531521_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
531484:531498	attL	TCGGGATGGCTTTTC	NA	NA	NA	NA
WP_155835686.1|531727_532081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014774622.1|532475_533072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042493141.1|533233_533863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014774625.1|533919_534180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014774626.1|534206_534458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014774627.1|534647_536060_-	replicative DNA helicase	NA	I6S783	Marinomonas_phage	34.4	1.5e-55
WP_014774628.1|536031_536898_-	DUF4373 domain-containing protein	NA	NA	NA	NA	NA
WP_014774630.1|537425_537785_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014774631.1|537902_538703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014774632.1|538709_539930_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_009597773.1|540571_541036_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	42.2	1.6e-11
WP_014774633.1|541043_541247_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_014774634.1|541230_541584_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014774635.1|542269_544018_-	SusD/RagB family nutrient-binding outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_018697414.1|544037_547070_-	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_009599008.1|547529_548270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014774638.1|548580_549549_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014774640.1|551133_552573_-	recombinase	NA	NA	NA	NA	NA
WP_009599012.1|552952_554176_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	32.7	2.9e-28
WP_155835626.1|554644_554815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014774641.1|555077_556679_+	indolepyruvate ferredoxin oxidoreductase	NA	NA	NA	NA	NA
WP_014774642.1|556760_557345_+	indolepyruvate oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_014774643.1|557344_558658_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_009597877.1|558662_559955_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_014774644.1|560111_560759_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_081488067.1|561053_563240_-	S46 family peptidase	NA	NA	NA	NA	NA
WP_014774646.1|563281_565234_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_014774647.1|565271_566861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014774648.1|566893_568393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009597840.1|568396_569626_-	DUF4876 domain-containing protein	NA	NA	NA	NA	NA
WP_014774649.1|569631_572460_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_009597793.1|572900_573590_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	2.2e-36
WP_014774651.1|573586_574843_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_009597828.1|574849_576109_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014774652.1|576134_577244_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_009597809.1|577250_578636_+	TolC family protein	NA	NA	NA	NA	NA
WP_014774653.1|579021_580683_+	putative transporter	NA	NA	NA	NA	NA
WP_014774654.1|580714_582145_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014774655.1|582410_582911_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_009597892.1|582897_584055_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_014774656.1|584283_586794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009597835.1|586798_588205_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_014774658.1|588209_589088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081488068.1|589147_590062_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014774660.1|590175_590946_+	ParA family protein	NA	Q7Y3Y6	Yersinia_phage	26.6	1.8e-15
WP_009597738.1|590958_591834_+	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHY8	Gordonia_phage	31.8	3.3e-13
WP_009597816.1|591837_592998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009597751.1|593001_594384_+	lytic transglycosylase domain-containing protein	NA	A0A0S2SXN2	Bacillus_phage	40.2	7.4e-12
WP_009597764.1|594385_595816_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_004328754.1|596033_597173_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	28.2	7.3e-13
599780:599794	attR	GAAAAGCCATCCCGA	NA	NA	NA	NA
>prophage 2
NC_018011	Alistipes finegoldii DSM 17242, complete sequence	3734239	1997214	2056510	3734239	tRNA,integrase,transposase	Tupanvirus(10.0%)	40	2011536:2011595	2056689:2056810
WP_009597231.1|1997214_1998699_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	39.0	8.6e-91
WP_014775528.1|1998901_1999819_+	cation transporter	NA	NA	NA	NA	NA
WP_009597243.1|2000158_2000743_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_022043830.1|2000807_2000957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014775529.1|2001050_2001452_+	VOC family protein	NA	NA	NA	NA	NA
WP_014775530.1|2001448_2001823_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_009597194.1|2002101_2002686_-	membrane protein	NA	NA	NA	NA	NA
WP_014775531.1|2002999_2004124_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014775532.1|2009217_2009463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039939967.1|2009593_2010670_+	choloylglycine hydrolase family protein	NA	A0A1J0F9I3	Only_Syngen_Nebraska_virus	28.3	4.7e-22
2011536:2011595	attL	CGGTTCGGGGAATCGGTCGAAGCCTTTGCAAAATGATGATATACAGTCGGTTTTCCTCTT	NA	NA	NA	NA
WP_130064584.1|2011709_2011916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014775536.1|2012145_2012415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014775538.1|2012887_2013871_+	virulence protein RhuM/Fic/DOC family protein	NA	Q9JMN3	Wolbachia_phage	40.5	6.7e-23
WP_014774638.1|2014847_2015816_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014775541.1|2016560_2018114_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	30.8	2.1e-47
WP_014775542.1|2018119_2019232_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_155835650.1|2019228_2019540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009316578.1|2019696_2020902_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	59.7	5.2e-62
WP_155835651.1|2020953_2021193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014775543.1|2021195_2022188_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	28.9	5.9e-35
WP_141417694.1|2022255_2022915_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_014775544.1|2022992_2024276_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_014775545.1|2024283_2027325_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.4	5.2e-66
WP_014774945.1|2027751_2028759_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_009596716.1|2029206_2029725_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_014775546.1|2030000_2030414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014775547.1|2030410_2031301_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.0	3.1e-27
WP_014775548.1|2031568_2031988_+	mobilization protein	NA	NA	NA	NA	NA
WP_014775549.1|2034692_2036003_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_014775550.1|2035999_2038621_+	transglutaminase	NA	NA	NA	NA	NA
WP_014775551.1|2038630_2039362_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_155835703.1|2039984_2042192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014775554.1|2042253_2044185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014775555.1|2044370_2047553_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042493479.1|2047588_2049235_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_014775557.1|2049278_2051819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014775558.1|2051916_2053905_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	28.2	5.1e-14
WP_014775559.1|2053919_2054384_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_014775561.1|2054836_2055238_+	RteC protein	NA	NA	NA	NA	NA
WP_014775562.1|2055289_2056510_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	30.3	1.7e-28
2056689:2056810	attR	CGGTTCGGGGAATCGGTCGAAGCCTTTGCAAAATGATGATATACAGTCGGTTTTCCTCTTTTTGCGCCGGACGGGCAACAAAAAAGGAGCCTCGGAAAAAGGCTCCTTTGTGCGGATAAAGG	NA	NA	NA	NA
>prophage 3
NC_018011	Alistipes finegoldii DSM 17242, complete sequence	3734239	2674895	2746341	3734239	tRNA,integrase,transposase	Burkholderia_virus(40.0%)	47	2675490:2675505	2748021:2748036
WP_014775965.1|2674895_2675312_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_009596052.1|2675312_2676863_-	bifunctional response regulator/alkaline phosphatase family protein	NA	NA	NA	NA	NA
2675490:2675505	attL	CACGTCTTCGGGCTTG	NA	NA	NA	NA
WP_009596092.1|2677338_2677611_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_009596110.1|2678096_2679647_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_014775967.1|2679651_2682978_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014775968.1|2682974_2683715_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_042493642.1|2683797_2685063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014775970.1|2685179_2686514_+	enzyme of heme biosynthesis	NA	NA	NA	NA	NA
WP_052312792.1|2686517_2687393_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_014775972.1|2687396_2688659_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_009596114.1|2688749_2690783_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_014775973.1|2690887_2692030_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_009596087.1|2692303_2694442_-	methylmalonyl-CoA mutase	NA	NA	NA	NA	NA
WP_009596057.1|2694444_2696295_-	methylmalonyl-CoA mutase	NA	NA	NA	NA	NA
WP_014775974.1|2696900_2699057_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_042493645.1|2699185_2699617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014775976.1|2699885_2700734_+	ATPase	NA	NA	NA	NA	NA
WP_014775977.1|2700696_2701512_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_014775978.1|2701492_2703304_+	menaquinone biosynthesis decarboxylase	NA	NA	NA	NA	NA
WP_014774638.1|2704194_2705163_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_009596091.1|2705739_2705931_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014775980.1|2706352_2709076_-	substrate-binding domain-containing protein	NA	W8CYM9	Bacillus_phage	28.9	2.9e-07
WP_009596055.1|2709093_2709591_-	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_167537971.1|2709661_2710072_-	DUF4185 domain-containing protein	NA	NA	NA	NA	NA
WP_167537972.1|2710068_2711166_-	DUF4185 domain-containing protein	NA	NA	NA	NA	NA
WP_139022425.1|2711210_2712776_-	DUF4185 domain-containing protein	NA	NA	NA	NA	NA
WP_042493659.1|2712810_2714421_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_014775983.1|2717374_2718961_-	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_014775984.1|2718986_2719847_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_014775985.1|2719848_2721177_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_014775986.1|2721557_2722448_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	32.6	9.0e-27
WP_014774978.1|2722444_2722858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014774945.1|2723527_2724535_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_081488113.1|2725498_2725690_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	48.1	4.9e-07
WP_009596088.1|2726353_2727742_+	MFS transporter	NA	NA	NA	NA	NA
WP_014775988.1|2727788_2728352_+	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_009596067.1|2728531_2729533_+	DUF4974 domain-containing protein	NA	NA	NA	NA	NA
WP_014775989.1|2729573_2733161_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_009596108.1|2733187_2734693_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_009596084.1|2734716_2736786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009596113.1|2736808_2739004_+	lipoprotein	NA	NA	NA	NA	NA
WP_014775990.1|2739038_2739854_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_014775991.1|2739881_2740937_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009596121.1|2740954_2741935_+	endonuclease	NA	NA	NA	NA	NA
WP_014775992.1|2741966_2744000_+	transketolase	NA	NA	NA	NA	NA
WP_042493664.1|2744629_2744995_-|integrase	tyrosine-type recombinase/integrase	integrase	H7BUI8	unidentified_phage	50.0	1.1e-07
WP_014775993.1|2745111_2746341_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.4	4.9e-23
2748021:2748036	attR	CACGTCTTCGGGCTTG	NA	NA	NA	NA
>prophage 4
NC_018011	Alistipes finegoldii DSM 17242, complete sequence	3734239	2903224	2959464	3734239	tail,integrase,protease,transposase	Yellowstone_lake_phycodnavirus(22.22%)	51	2947271:2947325	2959631:2959685
WP_014776076.1|2903224_2904115_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.0	4.0e-27
WP_009598107.1|2904873_2905482_-|tail	tail fiber domain-containing protein	tail	A0A0P0YNI2	Yellowstone_lake_phycodnavirus	32.4	1.9e-07
WP_014776078.1|2905617_2907615_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_014776079.1|2907611_2908481_-	DUF4249 domain-containing protein	NA	NA	NA	NA	NA
WP_014776080.1|2908484_2908943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014776081.1|2909013_2910051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009596664.1|2910115_2910709_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_039939683.1|2910740_2911568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014776082.1|2911767_2912310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130064081.1|2912478_2912862_-	DUF3244 domain-containing protein	NA	NA	NA	NA	NA
WP_155835666.1|2913122_2914781_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014776085.1|2914862_2915351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014776086.1|2915363_2916293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014776087.1|2916543_2917122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014776089.1|2918265_2919180_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_014776090.1|2919223_2919997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009598564.1|2920015_2920870_+	Bro-N domain-containing protein	NA	NA	NA	NA	NA
WP_014776091.1|2921081_2921555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009598561.1|2921547_2922342_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_014776092.1|2922402_2924253_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	29.4	3.9e-16
WP_015546644.1|2924269_2924794_-|tail	tail fiber domain-containing protein	tail	A0A0P0YNI2	Yellowstone_lake_phycodnavirus	35.1	1.7e-09
WP_015546643.1|2925044_2925467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014776095.1|2925690_2927316_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014776096.1|2930424_2931780_+	DUF4099 domain-containing protein	NA	NA	NA	NA	NA
WP_014776097.1|2931784_2932027_+	DUF4099 domain-containing protein	NA	NA	NA	NA	NA
WP_009598551.1|2932184_2933207_+	DUF4906 domain-containing protein	NA	NA	NA	NA	NA
WP_042493722.1|2933269_2935849_+	DUF4906 domain-containing protein	NA	NA	NA	NA	NA
WP_009598547.1|2935869_2936424_+	DUF3575 domain-containing protein	NA	NA	NA	NA	NA
WP_014776099.1|2936431_2938261_+	DUF4906 domain-containing protein	NA	NA	NA	NA	NA
WP_014776100.1|2938276_2939911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022044090.1|2940007_2940793_+	radical SAM protein	NA	H7BVD6	unidentified_phage	35.0	1.5e-33
WP_009598549.1|2940797_2940962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009598546.1|2940996_2941617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014776101.1|2941677_2942493_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_009598560.1|2942514_2943399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009598553.1|2943408_2944677_-	Y-family DNA polymerase	NA	A0A1W6JNT0	Morganella_phage	42.6	8.7e-92
WP_014776103.1|2944676_2945117_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	O64339	Escherichia_phage	42.1	5.1e-07
WP_014776104.1|2945218_2945758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009598544.1|2945769_2946984_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.6	7.5e-24
2947271:2947325	attL	TGTACCCCCTCAGGGGCTCGAACCCTGGACCCCAACATTAAGAGTGTCGTGCTCT	NA	NA	NA	NA
WP_014776105.1|2948143_2948662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014776106.1|2948819_2950457_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_014776107.1|2950461_2951370_-	TonB family protein	NA	NA	NA	NA	NA
WP_014776108.1|2951520_2952003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042493731.1|2952390_2952669_-	hypothetical protein	NA	A0A0F7L3I4	uncultured_marine_virus	40.3	1.2e-06
WP_014776110.1|2952665_2953055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042494115.1|2953465_2954587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042493733.1|2954647_2955136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014776111.1|2955261_2956080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042493735.1|2956634_2957474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042494118.1|2957640_2958183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014776115.1|2958246_2959464_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2959631:2959685	attR	TGTACCCCCTCAGGGGCTCGAACCCTGGACCCCAACATTAAGAGTGTCGTGCTCT	NA	NA	NA	NA
>prophage 5
NC_018011	Alistipes finegoldii DSM 17242, complete sequence	3734239	3510595	3555291	3734239	tail,integrase,transposase	unidentified_phage(22.22%)	45	3523326:3523341	3563048:3563063
WP_014774638.1|3510595_3511564_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014776459.1|3511718_3512501_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_014776460.1|3512510_3513878_-	dipeptidase	NA	NA	NA	NA	NA
WP_014776461.1|3513890_3514331_-	copper resistance protein NlpE	NA	NA	NA	NA	NA
WP_014776462.1|3514341_3515733_-	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	24.1	3.1e-18
WP_014776463.1|3515847_3516726_+	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_009598983.1|3516765_3517890_+	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	25.8	6.2e-25
WP_014776464.1|3517901_3518669_+	3'-5' exonuclease	NA	A0A1B0WLV5	Flavobacterium_phage	41.1	6.3e-45
WP_014776465.1|3518665_3520501_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014776466.1|3520508_3521165_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_014776467.1|3521189_3521927_+	FAD synthetase	NA	NA	NA	NA	NA
WP_009598976.1|3521930_3522344_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014776468.1|3522497_3524561_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	30.6	1.2e-50
3523326:3523341	attL	CTCCTTCACCTTCTCC	NA	NA	NA	NA
WP_014776469.1|3524734_3525238_+	nitroreductase	NA	NA	NA	NA	NA
WP_155835717.1|3525397_3527239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009598944.1|3528201_3529086_+	DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_014776471.1|3529470_3530700_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	26.6	8.6e-20
WP_014774945.1|3531080_3532088_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_009596716.1|3532536_3533055_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_014775546.1|3533330_3533744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014775986.1|3533740_3534631_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	32.6	9.0e-27
WP_042493819.1|3535512_3535974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081488119.1|3535986_3536445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009598106.1|3536489_3536951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155835718.1|3537017_3538760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042494200.1|3538875_3539484_-|tail	tail fiber domain-containing protein	tail	A0A0P0YNI2	Yellowstone_lake_phycodnavirus	32.4	1.4e-07
WP_155835675.1|3539618_3541352_-	cobalamin receptor	NA	NA	NA	NA	NA
WP_167537974.1|3541353_3541698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014776477.1|3541716_3542172_+	beta-barrel fold lipoprotein	NA	NA	NA	NA	NA
WP_007756689.1|3542300_3543362_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014776478.1|3543657_3544887_+	DUF3575 domain-containing protein	NA	NA	NA	NA	NA
WP_014776479.1|3544883_3545804_+	DUF5119 domain-containing protein	NA	NA	NA	NA	NA
WP_042493827.1|3545847_3546963_+	fimbrillin family protein	NA	NA	NA	NA	NA
WP_004328504.1|3547151_3547409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004327465.1|3548461_3548791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004330042.1|3548794_3549751_+	hypothetical protein	NA	Q9JMN3	Wolbachia_phage	45.9	4.8e-26
WP_004330044.1|3549885_3550263_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_004330047.1|3551006_3551318_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009597325.1|3551360_3551684_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075965615.1|3551876_3552062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081443390.1|3552021_3552201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004320820.1|3552205_3552598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004330050.1|3552636_3553197_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_008778395.1|3553238_3553430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039940021.1|3554043_3555291_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	36.3	3.5e-29
3563048:3563063	attR	CTCCTTCACCTTCTCC	NA	NA	NA	NA
