The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017860	Prevotella intermedia 17 chromosome I, complete sequence	579647	372988	420918	579647	integrase,transposase,tRNA	Paenibacillus_phage(14.29%)	32	415583:415601	430817:430835
WP_014710207.1|372988_374206_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_014708581.1|374827_376207_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_014708582.1|376273_377173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014708584.1|377262_379425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014708586.1|379801_380605_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ36	Paenibacillus_phage	32.1	7.8e-30
WP_044047420.1|380727_383001_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_044047422.1|383085_383838_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_044047424.1|383873_384449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014708591.1|384827_386309_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	40.9	1.9e-98
WP_014708592.1|386579_387260_+	OmpA family protein	NA	NA	NA	NA	NA
WP_044047510.1|387751_388789_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_014708594.1|389075_391550_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_014708595.1|391667_392810_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_014708596.1|393050_393902_+	patatin family protein	NA	NA	NA	NA	NA
WP_014708597.1|394299_396399_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A060AN10	Cronobacter_phage	51.5	6.3e-180
WP_014708598.1|396520_396988_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	NA	NA	NA	NA
WP_014708600.1|397349_398642_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_044047427.1|399324_399978_-	rubrerythrin	NA	NA	NA	NA	NA
WP_014708603.1|401303_402497_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_014708604.1|403201_403666_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_014708605.1|403872_404664_-	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_014708607.1|404899_407146_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.9	8.9e-164
WP_014708608.1|408172_408484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014708609.1|408498_409398_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_044047513.1|409508_411005_-	helicase	NA	I3PUW5	Vibrio_phage	27.7	3.3e-37
WP_144439213.1|413251_413572_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_044047428.1|413674_414910_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	37.8	3.4e-24
415583:415601	attL	AACGTGAGTTCGATATAAG	NA	NA	NA	NA
WP_044047431.1|415603_416503_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014708614.1|417116_417431_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014708615.1|417418_417925_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_014708617.1|419561_419984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014708618.1|419991_420918_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	24.7	6.1e-18
430817:430835	attR	AACGTGAGTTCGATATAAG	NA	NA	NA	NA
>prophage 2
NC_017860	Prevotella intermedia 17 chromosome I, complete sequence	579647	430922	492449	579647	integrase,transposase,tRNA	Bacillus_phage(21.43%)	44	430815:430835	490155:490175
430815:430835	attL	ATAACGTGAGTTCGATATAAG	NA	NA	NA	NA
WP_014708626.1|430922_431822_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080574639.1|431818_432553_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	39.2	1.7e-26
WP_014708628.1|432739_433168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076169446.1|433188_433446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014708630.1|433798_434146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014708631.1|434801_436034_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	39.9	1.4e-33
WP_014708633.1|436515_437808_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014708634.1|437815_439369_+	ATP-binding protein	NA	E5E3R2	Burkholderia_phage	25.8	8.9e-14
WP_014708635.1|439721_441044_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_014708636.1|441162_441822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014708637.1|441843_442767_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_014708638.1|442763_443111_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_014708639.1|443215_444106_-	mobilization protein	NA	NA	NA	NA	NA
WP_014708640.1|444301_445339_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014708641.1|445335_445644_-	DUF3853 family protein	NA	NA	NA	NA	NA
WP_009163356.1|446001_446205_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014708642.1|446296_449617_+	SNF2 family helicase	NA	A0A2K5B2B9	Erysipelothrix_phage	22.8	5.7e-42
WP_014708644.1|452991_453921_-	class I SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_044047435.1|453902_454514_-	master DNA invertase Mpi family serine-type recombinase	NA	H2A0H0	Bacteroides_phage	74.9	5.7e-73
WP_014708647.1|455148_455940_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014708648.1|456514_458164_-	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	41.2	4.7e-45
WP_014708650.1|459765_460155_-	DUF3127 domain-containing protein	NA	NA	NA	NA	NA
WP_014708651.1|460439_461564_+	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	29.9	3.6e-33
WP_044047437.1|461635_462490_+	3'-5' exonuclease	NA	A0A1P8VWC8	Flavobacterium_phage	39.3	1.6e-36
WP_014708653.1|462492_463695_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.2	6.0e-34
WP_044047438.1|463669_464557_+	DUF4835 family protein	NA	NA	NA	NA	NA
WP_014708655.1|464568_466239_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_014708656.1|466253_467921_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_044047440.1|468481_469702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014708657.1|470773_472402_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_014708658.1|473718_473868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014708659.1|474435_476010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014708661.1|477022_477886_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_014708662.1|477978_479013_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.5	2.9e-69
WP_014708663.1|479025_479574_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	43.6	2.1e-18
WP_014708664.1|480721_480886_-	rubredoxin	NA	NA	NA	NA	NA
WP_014708665.1|480994_483382_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014708666.1|483597_484236_+	DUF4827 domain-containing protein	NA	NA	NA	NA	NA
WP_014708667.1|484302_485694_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	25.1	9.1e-26
WP_014708668.1|485704_486319_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014708669.1|486322_488104_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	6.0e-46
WP_014710038.1|488711_489929_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_044047441.1|490177_491077_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
490155:490175	attR	ATAACGTGAGTTCGATATAAG	NA	NA	NA	NA
WP_014708671.1|491231_492449_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	32.4	1.4e-41
>prophage 1
NC_017861	Prevotella intermedia 17 chromosome II, complete sequence	2119790	884498	935016	2119790	terminase,transposase,integrase,head	unidentified_phage(50.0%)	52	887613:887629	939371:939387
WP_014709427.1|884498_885398_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014709428.1|886497_886737_+	hypothetical protein	NA	NA	NA	NA	NA
887613:887629	attL	TTCGTCATAAATCACAT	NA	NA	NA	NA
WP_004339081.1|887772_888144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014709430.1|888153_890175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014709431.1|890306_891182_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014709432.1|891184_891418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014709433.1|891414_892050_+	ATPase AAA	NA	NA	NA	NA	NA
WP_014709434.1|892205_892436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014709435.1|892438_893032_+	RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014709436.1|893043_893343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044047724.1|893300_893768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014709438.1|893801_894365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014709439.1|894687_895245_+	phage morphogeneis protein	NA	NA	NA	NA	NA
WP_014709440.1|895241_895679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080574666.1|895881_897066_-|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	29.5	1.0e-09
WP_080574667.1|897188_898532_-	DUF935 family protein	NA	A0A219VH73	Ochrobactrum_phage	26.7	8.0e-11
WP_014709443.1|898537_898957_-	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_014709444.1|898970_899201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014709445.1|899275_900838_-	hypothetical protein	NA	H7BVH1	unidentified_phage	31.1	2.1e-55
WP_044047728.1|900847_901321_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_044047730.1|901517_902465_+	peptidase	NA	NA	NA	NA	NA
WP_144439203.1|902511_903564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044047732.1|903592_903871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044048102.1|903863_904328_+	lysozyme	NA	W8CPL1	Croceibacter_phage	47.7	5.3e-39
WP_014709451.1|905228_905735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044048105.1|906267_906465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014709454.1|906464_911102_+	tape measure protein	NA	H7BVG7	unidentified_phage	45.2	1.5e-287
WP_014709455.1|911103_911568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014709456.1|911591_914459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014709457.1|914471_915524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014709458.1|915590_917270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144439202.1|917303_917615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044047739.1|917796_918039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044047741.1|918108_918939_+	DNA methyltransferase	NA	H7BVG3	unidentified_phage	64.6	3.5e-97
WP_014709463.1|918964_919603_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_044047742.1|921999_922230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014709466.1|922274_923354_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_044047744.1|923337_923769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004373320.1|924120_924582_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_004342100.1|924586_925549_-	mobilization protein	NA	NA	NA	NA	NA
WP_155115514.1|925653_925794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014709470.1|925729_927166_-	virulence-associated protein E	NA	D3W0G0	Lactococcus_phage	31.3	7.5e-15
WP_014709472.1|927578_927869_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044047748.1|927865_928171_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014709474.1|928275_929181_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014709475.1|929300_929753_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_006949222.1|929766_930531_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_006949221.1|930548_931451_+	radical SAM mobile pair protein B	NA	NA	NA	NA	NA
WP_014709477.1|931671_932076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014709478.1|932072_932267_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_044047751.1|932558_933788_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.6	9.2e-22
WP_014709480.1|933813_935016_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
939371:939387	attR	TTCGTCATAAATCACAT	NA	NA	NA	NA
