The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017764	Pasteurella multocida subsp. multocida str. 3480, complete genome	2378127	38138	85693	2378127	tRNA,tail,integrase,terminase	Mannheimia_phage(48.84%)	63	39700:39745	88069:88114
WP_014667783.1|38138_39581_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
39700:39745	attL	CATGGCATGCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCA	NA	NA	NA	NA
WP_014390695.1|39849_41022_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	53.1	2.0e-111
WP_014390696.1|41397_41853_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	47.1	4.6e-27
WP_041423219.1|41897_42251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391445.1|42259_42757_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_014667784.1|42900_43803_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	47.8	1.5e-66
WP_014390700.1|43805_44189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390701.1|44267_44579_-	hypothetical protein	NA	X2CY11	Brucella_phage	43.4	7.3e-08
WP_014390702.1|44578_45100_-	hypothetical protein	NA	Q708P2	Streptococcus_phage	35.1	2.6e-18
WP_014667785.1|45166_45619_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	53.9	3.4e-38
WP_014390704.1|45629_46331_-	single-stranded DNA-binding protein	NA	A0A0A7RVW0	Clostridium_phage	42.6	1.2e-18
WP_014390705.1|46373_47024_-	ribonuclease H	NA	X2CYL5	Brucella_phage	35.6	1.5e-23
WP_014667786.1|47371_47608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390709.1|47579_47879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390710.1|47945_48257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390711.1|48318_48975_-	hypothetical protein	NA	Q7Y5V4	Haemophilus_phage	67.5	2.0e-39
WP_014390712.1|49259_50096_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	51.4	1.3e-72
WP_014390713.1|50206_50584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391100.1|50558_50750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390715.1|51312_51540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390716.1|52048_52873_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_014390717.1|52869_53607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391464.1|53682_54369_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.4	4.6e-71
WP_005720263.1|54496_54706_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
WP_014391466.1|54754_55207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014667788.1|55265_55967_+	phage antirepressor protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	9.2e-35
WP_014390722.1|55963_56317_+	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_014390723.1|56318_57218_+	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.8	2.1e-31
WP_014390724.1|57217_57913_+	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.4	1.7e-33
WP_014390725.1|57905_58436_+	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	81.7	3.2e-88
WP_014390726.1|58444_58882_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	73.1	1.7e-58
WP_014667790.1|59041_59257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014667791.1|59249_59852_+	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.7	3.7e-32
WP_014667792.1|59852_60314_+	antitermination protein	NA	NA	NA	NA	NA
WP_014667793.1|60439_61003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391475.1|61120_61381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014667794.1|61377_61908_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	9.7e-45
WP_014667795.1|61880_62204_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_014390736.1|62425_62860_-	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
WP_016533497.1|62888_63071_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	3.8e-09
WP_014390737.1|63153_63651_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	70.7	7.4e-47
WP_014667796.1|63634_64861_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	77.0	1.2e-191
WP_014390739.1|64875_66321_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	56.5	1.0e-144
WP_014390740.1|66274_67246_+	hypothetical protein	NA	F1C5D8	Cronobacter_phage	41.0	1.6e-53
WP_014390741.1|67260_68607_+	DUF2213 domain-containing protein	NA	A0A0M3LQ78	Mannheimia_phage	57.2	2.6e-126
WP_014390742.1|68606_69041_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	75.0	1.1e-54
WP_014390743.1|69052_70051_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	74.4	1.6e-144
WP_080573867.1|70061_70565_+	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	73.9	5.4e-13
WP_014390745.1|70545_70914_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	42.1	4.7e-22
WP_014390746.1|70916_71261_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	57.9	3.0e-31
WP_014390747.1|71265_71637_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	51.2	1.3e-24
WP_014390748.1|71633_72005_+	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	39.0	1.4e-18
WP_014390749.1|72016_72499_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	62.0	2.0e-44
WP_014390750.1|72552_73224_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	42.4	2.6e-42
WP_078801827.1|73282_73657_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_014390752.1|73732_74551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390754.1|74889_75714_+	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	70.5	6.1e-46
WP_014390755.1|75765_78210_+|tail	tail length tape measure protein	tail	A0A0M3LS54	Mannheimia_phage	48.5	1.1e-156
WP_014390756.1|78212_78542_+	Gifsy-1 prophage VmtM	NA	S5MW28	Escherichia_phage	37.1	3.2e-14
WP_014390758.1|78670_79375_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	63.9	1.0e-81
WP_014667798.1|79379_80123_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	60.0	3.0e-84
WP_014667799.1|80065_80686_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.1e-52
WP_014667800.1|80689_85693_+|tail	phage tail protein	tail	A0A0M3LQ61	Mannheimia_phage	39.0	6.6e-252
88069:88114	attR	CATGGCATGCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCA	NA	NA	NA	NA
>prophage 2
NC_017764	Pasteurella multocida subsp. multocida str. 3480, complete genome	2378127	658996	665822	2378127		Escherichia_phage(37.5%)	12	NA	NA
WP_014391096.1|658996_660142_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	27.7	2.6e-18
WP_014391095.1|660256_660892_-	hypothetical protein	NA	G9L676	Escherichia_phage	44.8	2.1e-41
WP_014391094.1|661028_661235_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	51.6	5.5e-12
WP_014391093.1|661303_661531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391091.1|661762_662164_+	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	43.7	2.9e-17
WP_014391090.1|662102_662807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391089.1|662806_663100_+	hypothetical protein	NA	Q7Y5V9	Haemophilus_phage	52.7	1.5e-18
WP_016534521.1|663089_663305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391088.1|663678_664203_+	ATPase	NA	A0A0N7KZV8	Escherichia_phage	47.0	3.2e-24
WP_014391087.1|664238_664613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668018.1|665184_665427_+	phage protein	NA	A0A0M3LR56	Mannheimia_phage	52.6	1.3e-15
WP_014668019.1|665405_665822_+	hypothetical protein	NA	A0A192Y6V0	Salmonella_phage	55.7	3.2e-35
>prophage 3
NC_017764	Pasteurella multocida subsp. multocida str. 3480, complete genome	2378127	1151944	1161301	2378127		Sinorhizobium_phage(16.67%)	9	NA	NA
WP_014391290.1|1151944_1153219_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.4e-92
WP_005753554.1|1153259_1153877_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_005724298.1|1153876_1154764_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005724296.1|1154833_1155781_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.7	1.9e-43
WP_014668183.1|1155855_1157409_-	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
WP_010906540.1|1157643_1158435_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	4.4e-17
WP_005724066.1|1158443_1159229_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_014668184.1|1159305_1160286_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.3e-15
WP_005724063.1|1160302_1161301_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
>prophage 4
NC_017764	Pasteurella multocida subsp. multocida str. 3480, complete genome	2378127	1352759	1388552	2378127	tail,transposase,integrase	Pseudomonas_phage(54.84%)	47	1343908:1343923	1397686:1397701
1343908:1343923	attL	ATTGACCGCACTTTTA	NA	NA	NA	NA
WP_005755558.1|1352759_1353605_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	62.4	2.4e-101
WP_005755559.1|1353756_1354017_-	hypothetical protein	NA	B7SDP6	Haemophilus_phage	57.3	5.8e-19
WP_014668239.1|1354082_1356872_-|tail	phage tail protein	tail	A0A2D1GNP9	Pseudomonas_phage	46.2	3.1e-182
WP_014668240.1|1356871_1357072_-	hypothetical protein	NA	A0A2D2W288	Stenotrophomonas_phage	45.8	1.2e-08
WP_005755565.1|1357075_1357327_-	hypothetical protein	NA	A0A2D1GNV4	Pseudomonas_phage	59.2	4.6e-21
WP_014668241.1|1357343_1358153_-	DUF2163 domain-containing protein	NA	A0A2D1GNT2	Pseudomonas_phage	50.5	1.7e-77
WP_014668242.1|1358166_1359846_-	hypothetical protein	NA	J9STL4	Pseudomonas_phage	38.6	4.4e-91
WP_005755570.1|1359853_1360816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668243.1|1360817_1361810_-	hypothetical protein	NA	A0A2D1GMZ0	Marinobacter_phage	27.5	5.2e-23
WP_014668244.1|1361819_1365167_-	tape measure protein	NA	A0A2D1GNK1	Pseudomonas_phage	32.5	3.8e-118
WP_014668245.1|1365179_1365395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668246.1|1365604_1366030_-	hypothetical protein	NA	A0A2D1GNY5	Pseudomonas_phage	40.4	3.0e-20
WP_005755580.1|1366090_1366837_-	hypothetical protein	NA	A0A2D1GNQ7	Pseudomonas_phage	49.2	1.2e-59
WP_014668247.1|1366829_1367090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668248.1|1367086_1367533_-	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	30.9	1.5e-14
WP_005755584.1|1367532_1368039_-	DUF1320 domain-containing protein	NA	Q5ZQX5	Pseudomonas_phage	42.1	1.6e-28
WP_005755585.1|1368048_1368972_-	hypothetical protein	NA	A0A0S4L2T7	Pseudomonas_phage	60.7	1.8e-102
WP_014668249.1|1369032_1369398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668250.1|1369394_1370396_-	peptidase	NA	Q5ZQY0	Pseudomonas_phage	54.6	8.0e-40
WP_014668251.1|1370613_1371114_-	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	41.7	3.1e-32
WP_014668252.1|1371211_1372450_-	hypothetical protein	NA	J9STS2	Pseudomonas_phage	47.2	2.3e-105
WP_014668253.1|1372433_1373957_-	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	53.5	2.5e-149
WP_014668254.1|1373959_1375576_-	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	64.6	1.3e-185
WP_014668255.1|1375575_1376115_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	51.7	4.0e-46
WP_005755593.1|1376126_1376432_-	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	53.0	8.7e-22
WP_005755594.1|1376433_1376784_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	33.6	5.3e-07
WP_038641606.1|1376880_1377132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668258.1|1377311_1377911_-	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	55.7	2.7e-59
WP_014668259.1|1377912_1378284_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	53.2	2.6e-20
WP_014668260.1|1378525_1378765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668261.1|1378822_1379413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025248437.1|1379425_1379953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005755617.1|1379983_1380394_-	helix-turn-helix transcriptional regulator	NA	Q6QID2	Burkholderia_phage	39.4	8.9e-14
WP_025248436.1|1380570_1380798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005755620.1|1380862_1381099_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_014668263.1|1381178_1381364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005755623.1|1381376_1381691_+	hypothetical protein	NA	Q5ZR02	Pseudomonas_phage	41.1	5.8e-13
WP_014668264.1|1381701_1382646_+	hypothetical protein	NA	J9SND0	Pseudomonas_phage	31.5	2.3e-28
WP_014668265.1|1382657_1384427_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	46.5	1.8e-148
WP_014668266.1|1384438_1385617_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	54.8	4.6e-111
WP_014668267.1|1385619_1385943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005755632.1|1385952_1386174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032851712.1|1386148_1386403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005755634.1|1386422_1387043_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	60.2	1.2e-67
WP_005755637.1|1387212_1387440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668269.1|1387436_1387982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668270.1|1387991_1388552_+	hypothetical protein	NA	A0A0M3LP85	Mannheimia_phage	29.7	8.2e-18
1397686:1397701	attR	ATTGACCGCACTTTTA	NA	NA	NA	NA
