The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017731	Providencia stuartii MRSN 2154, complete sequence	4402109	414543	425766	4402109	plate,tail	Haemophilus_phage(44.44%)	13	NA	NA
WP_014656224.1|414543_415161_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	45.3	2.1e-35
WP_014656225.1|415160_416783_-|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	37.1	2.4e-30
WP_014656226.1|416769_417426_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	43.3	1.3e-35
WP_014656227.1|417418_418543_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	41.1	1.7e-78
WP_004920995.1|418526_418889_-	hypothetical protein	NA	A0A2H5BFY4	Vibrio_phage	38.3	2.5e-12
WP_014656228.1|418888_419545_-	hypothetical protein	NA	Q7Y5S7	Haemophilus_phage	50.7	2.1e-33
WP_004921005.1|419541_420366_-	hypothetical protein	NA	Q7Y5S8	Haemophilus_phage	48.4	8.5e-72
WP_014656229.1|420340_420679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014656230.1|420675_421407_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	34.0	4.3e-27
WP_014656231.1|421489_423274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014656233.1|423418_423811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004921015.1|423810_424245_-	DUF3277 family protein	NA	NA	NA	NA	NA
WP_014656234.1|424254_425766_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	40.4	4.4e-98
>prophage 2
NC_017731	Providencia stuartii MRSN 2154, complete sequence	4402109	932191	985019	4402109	tRNA,holin,integrase,terminase,portal,lysis,tail,head,protease,capsid	Proteus_phage(19.44%)	69	931980:932028	973294:973342
931980:932028	attL	AAATGGTACGCCCTACAGGGTTCGAACCTGTGACCTACGGCTTAGAAGG	NA	NA	NA	NA
WP_014656471.1|932191_933418_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.2	4.5e-37
WP_014656472.1|933573_933855_+	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	38.3	1.5e-12
WP_080574238.1|933902_934253_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014656474.1|934344_935670_-	hypothetical protein	NA	A0A1S6KUV1	Providencia_phage	38.7	2.9e-53
WP_014656475.1|935734_940045_-	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	49.6	8.4e-195
WP_014656476.1|940045_940444_-	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	47.7	3.4e-34
WP_014656477.1|940524_941403_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	37.3	8.6e-06
WP_014656478.1|941511_942093_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	49.2	1.4e-49
WP_014656479.1|942092_942689_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	55.6	1.7e-58
WP_014656480.1|942691_945772_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	29.3	9.0e-58
WP_014656481.1|945793_946021_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_014656482.1|946077_946470_-|tail	tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	47.5	4.8e-25
WP_014656483.1|946469_946952_-|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	70.1	5.2e-53
WP_014656484.1|947013_947346_-	hypothetical protein	NA	A0A1P8DTJ3	Proteus_phage	63.1	2.2e-34
WP_014656485.1|947342_947792_-	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	66.7	9.4e-49
WP_014656486.1|947784_948108_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	71.0	4.1e-38
WP_014656487.1|948117_948444_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	72.2	1.4e-38
WP_014656488.1|948443_948629_-	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	66.7	3.3e-08
WP_014656489.1|948676_949891_-|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	93.3	4.1e-208
WP_014656490.1|949902_950754_-|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	85.5	1.4e-133
WP_014656491.1|950759_952076_-|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	68.6	8.0e-173
WP_014656492.1|952075_953593_-|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	72.1	1.6e-212
WP_014656493.1|953602_954079_-|terminase	terminase	terminase	Q77WA1	Escherichia_phage	80.6	4.2e-63
WP_014656494.1|954200_954413_-	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	49.3	8.4e-08
WP_014656495.1|954414_954753_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	69.7	9.9e-43
WP_014656496.1|954749_955484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014656497.1|955738_955921_-	hypothetical protein	NA	O64364	Escherichia_phage	64.4	1.2e-10
WP_104873590.1|956618_956831_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_014656498.1|956832_957285_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.6	6.6e-26
WP_004918418.1|957286_957619_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	72.3	5.1e-36
WP_004918415.1|957605_957899_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_014656499.1|957895_958285_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_014656500.1|958434_958677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014656501.1|958680_958872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014656502.1|959674_960454_-	antitermination protein	NA	F1C595	Cronobacter_phage	49.6	5.8e-70
WP_014656503.1|960465_962358_-	toprim domain-containing protein	NA	Q5G8S8	Enterobacteria_phage	68.7	4.0e-266
WP_014656504.1|962403_963336_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	41.8	2.2e-31
WP_014656505.1|963357_963621_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	62.0	1.0e-15
WP_014656506.1|963746_964445_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	44.6	5.0e-49
WP_014656507.1|964724_965051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014656508.1|965218_965872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133177090.1|965843_966407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014656510.1|966581_967055_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014656511.1|967058_967298_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_014656512.1|967276_967600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014656513.1|967592_967832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014656514.1|967834_968086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014656515.1|968090_968501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148271186.1|968912_969122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014656518.1|969118_969334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014656519.1|969336_970146_+	Rha family transcriptional regulator	NA	F1C5A3	Cronobacter_phage	71.8	3.0e-61
WP_041705404.1|970214_970565_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_014656521.1|970564_971137_+	hypothetical protein	NA	A0A1B5FPB4	Escherichia_phage	46.6	1.8e-28
WP_014656522.1|971149_971377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014656523.1|971373_971622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014656524.1|971614_972391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014656525.1|972701_973019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041705407.1|973054_973207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004922311.1|973561_974419_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	3.8e-30
973294:973342	attR	AAATGGTACGCCCTACAGGGTTCGAACCTGTGACCTACGGCTTAGAAGG	NA	NA	NA	NA
WP_014656527.1|974436_974649_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004922316.1|975113_976256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014656528.1|976281_978882_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_102780750.1|978978_979632_-	molecular chaperone	NA	NA	NA	NA	NA
WP_036941264.1|979709_980438_-	molecular chaperone	NA	NA	NA	NA	NA
WP_014656531.1|980443_981040_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004922332.1|981056_981608_-	fimbrial protein	NA	NA	NA	NA	NA
WP_014656532.1|981591_982317_-	molecular chaperone	NA	NA	NA	NA	NA
WP_050979586.1|982387_982915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014656534.1|983630_985019_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.1	3.6e-46
>prophage 3
NC_017731	Providencia stuartii MRSN 2154, complete sequence	4402109	2798594	2870609	4402109	integrase,transposase	Escherichia_phage(37.5%)	58	2835745:2835763	2879600:2879618
WP_148271206.1|2798594_2799291_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	46.8	7.5e-61
WP_014657437.1|2801443_2801647_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014657438.1|2801837_2803190_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	48.3	4.9e-117
WP_014657439.1|2803285_2804074_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.7e-48
WP_158309813.1|2804120_2804342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657441.1|2805753_2806095_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014657442.1|2806160_2806691_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_014657443.1|2806767_2807304_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_193372048.1|2807428_2810074_+	outer membrane usher protein	NA	NA	NA	NA	NA
WP_014657445.1|2810126_2810903_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_114143467.1|2810980_2811559_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_014657447.1|2811568_2812108_+	fimbrial protein	NA	NA	NA	NA	NA
WP_014657448.1|2812123_2812621_+	fimbrial protein	NA	NA	NA	NA	NA
WP_014657449.1|2812631_2813129_+	fimbrial protein	NA	NA	NA	NA	NA
WP_014657450.1|2813125_2813650_+	fimbrial protein	NA	NA	NA	NA	NA
WP_014657451.1|2813674_2814217_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_148271208.1|2814488_2815316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657455.1|2816461_2816764_+	acid-resistance protein	NA	NA	NA	NA	NA
WP_014657456.1|2817018_2817492_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_041705173.1|2818065_2818830_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	59.1	2.8e-77
WP_014657462.1|2820444_2822073_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_014657463.1|2822117_2822846_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014657464.1|2823080_2824115_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014657465.1|2824163_2824943_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_014657468.1|2826193_2826955_+	D-threitol dehydrogenase	NA	NA	NA	NA	NA
WP_014657469.1|2827116_2829126_-	transketolase	NA	NA	NA	NA	NA
WP_004263541.1|2829162_2829615_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_014657470.1|2829933_2831046_+	erythritol/L-threitol dehydrogenase	NA	NA	NA	NA	NA
WP_014657471.1|2831174_2832446_+	MFS transporter	NA	NA	NA	NA	NA
WP_014657472.1|2832457_2833459_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_014657473.1|2833469_2834123_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_004263559.1|2834281_2835244_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
2835745:2835763	attL	TCGAATTATTTAGAGTATA	NA	NA	NA	NA
WP_014657474.1|2835814_2836195_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_014657475.1|2836196_2837147_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014657476.1|2837323_2838712_+	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_008913922.1|2838723_2840193_+	xylulokinase	NA	NA	NA	NA	NA
WP_014657477.1|2840283_2841573_+	MFS transporter	NA	NA	NA	NA	NA
WP_158309814.1|2842671_2842827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014657485.1|2847281_2848262_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	80.9	4.0e-153
WP_014657486.1|2848594_2850544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657487.1|2850554_2850761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657488.1|2850757_2851795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657489.1|2851787_2852168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657490.1|2852168_2853920_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014657491.1|2854036_2854267_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_014657492.1|2854260_2855751_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_014657494.1|2856894_2857197_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014657495.1|2857319_2858066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657496.1|2858171_2858693_+	adhesin	NA	NA	NA	NA	NA
WP_014657497.1|2858837_2861249_+	TcfC E-set like domain-containing protein	NA	NA	NA	NA	NA
WP_014657498.1|2861248_2862496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657499.1|2862862_2863609_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.2	3.5e-24
WP_148271239.1|2865047_2865380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041705181.1|2865995_2866568_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_158309815.1|2866934_2867075_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014657504.1|2867892_2868477_-	antirestriction protein ArdA	NA	A0A0A8WIV6	Clostridium_phage	41.5	5.0e-26
WP_014656687.1|2868803_2869088_-	membrane protein	NA	NA	NA	NA	NA
WP_014657505.1|2869343_2870609_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	44.1	2.3e-84
2879600:2879618	attR	TCGAATTATTTAGAGTATA	NA	NA	NA	NA
>prophage 4
NC_017731	Providencia stuartii MRSN 2154, complete sequence	4402109	3253362	3263955	4402109		Mycobacterium_phage(25.0%)	11	NA	NA
WP_004917599.1|3253362_3254565_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	36.8	6.4e-28
WP_004917602.1|3255291_3256263_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.8	1.6e-133
WP_071821176.1|3256276_3258409_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.1	2.2e-212
WP_004917606.1|3258419_3258833_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.9	5.3e-14
WP_014657707.1|3258842_3259070_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	56.2	1.6e-17
WP_004917609.1|3259360_3259831_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2P1EL10	Moumouvirus	35.7	7.6e-17
WP_014657708.1|3260037_3260247_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	7.7e-22
WP_004917612.1|3260389_3261355_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_014657709.1|3261477_3262122_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004917614.1|3262382_3262646_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004917615.1|3262746_3263955_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	50.9	8.8e-110
>prophage 5
NC_017731	Providencia stuartii MRSN 2154, complete sequence	4402109	3494659	3505355	4402109	tRNA,protease	Paramecium_bursaria_Chlorella_virus(16.67%)	10	NA	NA
WP_014657828.1|3494659_3495505_+	hypothetical protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	30.6	1.8e-21
WP_004918066.1|3495501_3496251_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014657829.1|3496394_3497333_+	DUF1177 domain-containing protein	NA	NA	NA	NA	NA
WP_004918068.1|3497436_3497688_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	1.3e-15
WP_004918070.1|3498071_3498392_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	48.4	1.7e-15
WP_004918072.1|3498422_3500708_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	8.4e-170
WP_004244560.1|3500774_3500993_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_014657830.1|3501133_3501835_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_014657831.1|3501843_3503586_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	24.9	5.9e-22
WP_014657832.1|3503588_3505355_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y302	Organic_Lake_phycodnavirus	32.8	1.4e-15
>prophage 6
NC_017731	Providencia stuartii MRSN 2154, complete sequence	4402109	3534845	3592457	4402109	holin,integrase,terminase,tail,transposase,capsid	Proteus_phage(19.57%)	78	3530940:3530954	3536883:3536897
3530940:3530954	attL	TAAATTAAATAAATT	NA	NA	NA	NA
WP_014657844.1|3534845_3535892_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	36.3	2.0e-57
WP_041705223.1|3536093_3536318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041705225.1|3536310_3536505_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	78.1	1.3e-23
WP_014657846.1|3536512_3537145_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	61.9	1.5e-63
3536883:3536897	attR	AATTTATTTAATTTA	NA	NA	NA	NA
WP_014657847.1|3537131_3537443_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	42.3	1.3e-09
WP_014657848.1|3537602_3537812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014657849.1|3537963_3538230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014657850.1|3538237_3538561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014657851.1|3538629_3538881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014657852.1|3538924_3539428_-	ASCH domain-containing protein	NA	A0A077SLQ8	Escherichia_phage	29.2	6.7e-11
WP_014657854.1|3539796_3540345_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.6	2.2e-47
WP_014657855.1|3540345_3541218_-	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	52.4	8.4e-62
WP_014657856.1|3541232_3541445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014657857.1|3541683_3541956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014657858.1|3542184_3542484_-	hypothetical protein	NA	A0A1P8DTE8	Proteus_phage	62.6	8.5e-22
WP_014657859.1|3542473_3542725_-	hypothetical protein	NA	A0A1P8DTG4	Proteus_phage	67.5	2.3e-20
WP_014657860.1|3542742_3542931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014657861.1|3542958_3543198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014657862.1|3543459_3543762_-	hypothetical protein	NA	M9P0E2	Enterobacteria_phage	61.2	8.0e-28
WP_014657863.1|3543764_3544040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014657865.1|3544844_3545861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004916513.1|3545943_3546285_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	59.3	1.8e-36
WP_041705227.1|3546561_3547215_-	LexA family transcriptional repressor	NA	A0A1P8DTH0	Proteus_phage	78.8	9.6e-103
WP_071821192.1|3547307_3547538_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	79.7	3.0e-27
WP_014657868.1|3547650_3547998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041705229.1|3548088_3548784_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	70.0	1.3e-81
WP_014657870.1|3548780_3549239_+	replication protein	NA	A0A1P8DTG2	Proteus_phage	97.5	6.0e-59
WP_014657873.1|3550379_3551288_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.6	9.6e-101
WP_014657874.1|3551313_3551505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657876.1|3551762_3551990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071821178.1|3551925_3552189_+	DUF551 domain-containing protein	NA	A0A076G5R4	Escherichia_phage	46.3	3.2e-09
WP_167537610.1|3552185_3552362_+	hypothetical protein	NA	A0A2H4A350	Salmonella_phage	50.9	2.9e-06
WP_014657879.1|3552358_3552643_+	hypothetical protein	NA	E5AGF1	Erwinia_phage	53.3	8.1e-22
WP_014657880.1|3552644_3553088_+	recombination protein NinB	NA	A0A1P8DTD8	Proteus_phage	79.5	2.2e-26
WP_014657881.1|3553084_3553423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657882.1|3553419_3553632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657883.1|3553628_3553913_+	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	73.9	2.5e-31
WP_014657884.1|3553909_3554275_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A2H4J472	uncultured_Caudovirales_phage	59.7	1.5e-33
WP_050979651.1|3554611_3555115_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	38.8	1.3e-25
WP_014657887.1|3556063_3556312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158309816.1|3556498_3556939_+	DUF1327 domain-containing protein	NA	NA	NA	NA	NA
WP_041705233.1|3557004_3557184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004916437.1|3557342_3557660_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	58.1	1.2e-29
WP_014657888.1|3557652_3558069_+	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	58.7	5.5e-35
WP_004916433.1|3558065_3558425_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	43.7	4.0e-18
WP_148271242.1|3558625_3558841_+	hypothetical protein	NA	A0A2R4ALD8	Vibrio_phage	58.6	1.0e-13
WP_014657891.1|3559395_3559932_+	KilA-N domain-containing protein	NA	Q3LZN6	Bacteriophage	40.4	1.2e-21
WP_014657892.1|3559931_3560348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657893.1|3560802_3561204_+	DNA-packaging protein	NA	B6SD32	Bacteriophage	79.0	6.4e-41
WP_014657894.1|3561184_3562426_+|terminase	PBSX family phage terminase large subunit	terminase	H6WRS9	Salmonella_phage	76.9	1.8e-187
WP_014657895.1|3562435_3563803_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	67.5	5.0e-178
WP_014657896.1|3563783_3564893_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	54.1	9.9e-108
WP_014657897.1|3565258_3565981_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	55.7	8.0e-66
WP_014657898.1|3565984_3566977_+	hypothetical protein	NA	A0A2H4JIE6	uncultured_Caudovirales_phage	73.5	8.8e-140
WP_014657899.1|3567015_3567297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657900.1|3567302_3567686_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	53.5	5.8e-31
WP_004916412.1|3567687_3568050_+	hypothetical protein	NA	A0A0R6PH70	Moraxella_phage	41.5	2.5e-15
WP_004916411.1|3568049_3568436_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	41.9	1.8e-19
WP_014657901.1|3568432_3568828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657902.1|3568839_3569775_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	43.1	2.5e-59
WP_014657903.1|3569829_3570264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148271243.1|3570401_3570596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657905.1|3570745_3571402_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_014657906.1|3571537_3572401_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_041705235.1|3572415_3573045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657908.1|3573037_3573901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041705237.1|3576689_3577190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657914.1|3577295_3580649_+|tail	phage tail tape measure protein	tail	G1CSQ1	Cronobacter_virus	28.7	8.6e-38
WP_014657915.1|3580660_3580951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657916.1|3580921_3581170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014657917.1|3581314_3581659_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	48.2	7.2e-25
WP_014657918.1|3581655_3582399_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.4	3.2e-86
WP_014657919.1|3582395_3583106_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	67.8	4.6e-90
WP_014657920.1|3583102_3583708_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	59.0	3.4e-54
WP_014657921.1|3583760_3588584_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	54.8	9.4e-288
WP_014657922.1|3588648_3589980_+	hypothetical protein	NA	A0A1S6KUV1	Providencia_phage	42.2	6.6e-58
WP_014657923.1|3590057_3590318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014657924.1|3590516_3592457_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.1	8.8e-43
>prophage 7
NC_017731	Providencia stuartii MRSN 2154, complete sequence	4402109	3656324	3671504	4402109	integrase	Morganella_phage(40.0%)	20	3659114:3659127	3663875:3663888
WP_014657949.1|3656324_3658379_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.1e-16
WP_014657950.1|3658418_3658877_-	methylglyoxal synthase	NA	NA	NA	NA	NA
3659114:3659127	attL	TTTACTGATTTAGG	NA	NA	NA	NA
WP_014657951.1|3659138_3659552_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_004918224.1|3659622_3659943_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_004918226.1|3660150_3660444_+	acylphosphatase	NA	NA	NA	NA	NA
WP_004918228.1|3660456_3660786_-	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_014657953.1|3661220_3662432_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.5	4.1e-131
WP_104873369.1|3662644_3663472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657955.1|3663763_3663982_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	5.1e-08
3663875:3663888	attR	CCTAAATCAGTAAA	NA	NA	NA	NA
WP_014657956.1|3663981_3664377_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	57.8	7.3e-29
WP_014657957.1|3664391_3665225_+	antA/AntB antirepressor family protein	NA	A0A0H5BBY8	Pseudomonas_phage	38.0	1.8e-21
WP_014657958.1|3665221_3666163_+	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	53.1	1.7e-68
WP_014657959.1|3666159_3666339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657960.1|3666335_3666545_+	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	50.7	3.0e-10
WP_014657961.1|3666541_3666715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657962.1|3666714_3666909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014657963.1|3666908_3667505_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.6	3.2e-28
WP_014657964.1|3667519_3669892_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	37.4	5.5e-140
WP_014657965.1|3670271_3671009_+	competence protein CoiA-like family protein	NA	NA	NA	NA	NA
WP_014657966.1|3671051_3671504_+	ProQ/FinO family protein	NA	A0A1W6JPI6	Morganella_phage	60.6	3.6e-16
>prophage 8
NC_017731	Providencia stuartii MRSN 2154, complete sequence	4402109	3924509	3945528	4402109	holin,integrase,lysis,terminase	Pectobacterium_phage(42.86%)	32	3912877:3912894	3943845:3943862
3912877:3912894	attL	GCAGTGTGCAATTTCTTG	NA	NA	NA	NA
WP_014658107.1|3924509_3925490_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	65.3	1.1e-123
WP_014658108.1|3925534_3925753_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	52.2	4.4e-12
WP_014658109.1|3925736_3925922_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	50.9	6.2e-07
WP_014658110.1|3925995_3926166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014658111.1|3926329_3926929_-	HNH endonuclease	NA	M1PKJ5	Streptococcus_phage	37.0	2.3e-18
WP_014658112.1|3926925_3927165_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	64.5	4.0e-14
WP_014658113.1|3927190_3927370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014658116.1|3927914_3929963_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	37.5	1.5e-122
WP_014658117.1|3929975_3930311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014658118.1|3930813_3931512_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	49.1	3.5e-50
WP_014658119.1|3931618_3931864_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	49.3	3.9e-17
WP_014658120.1|3931911_3932367_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	6.0e-27
WP_014658122.1|3932609_3933554_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	59.8	2.7e-37
WP_014658123.1|3933543_3934962_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	64.2	1.5e-172
WP_041705276.1|3935015_3935186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014658124.1|3935188_3935425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050979653.1|3935427_3936225_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	49.2	6.1e-67
WP_014658126.1|3936242_3936584_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	54.1	8.2e-29
WP_014658127.1|3936612_3937182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014658128.1|3937414_3938437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014658129.1|3938597_3939191_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	58.7	1.8e-63
WP_014658130.1|3939202_3939517_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	70.8	4.1e-35
WP_014658131.1|3939561_3940341_+	antitermination protein	NA	F1C595	Cronobacter_phage	50.0	1.3e-69
WP_014658132.1|3940376_3940748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014658133.1|3941209_3941542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120752678.1|3941734_3941854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167537612.1|3942002_3942314_+|holin	holin	holin	F1C5D1	Cronobacter_phage	52.4	1.4e-22
WP_014658135.1|3942306_3942699_+	M15 family metallopeptidase	NA	A0A1P8DTE2	Proteus_phage	86.2	2.7e-44
WP_014658136.1|3942716_3943154_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	38.2	7.8e-16
WP_014658137.1|3943154_3943583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014658138.1|3943680_3944691_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	36.7	3.5e-35
3943845:3943862	attR	CAAGAAATTGCACACTGC	NA	NA	NA	NA
WP_014658139.1|3944829_3945528_+	hypothetical protein	NA	A9YWZ6	Burkholderia_phage	73.2	1.3e-97
