The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017623	Salmonella enterica subsp. enterica serovar Heidelberg str. B182, complete sequence	4750465	318380	365903	4750465	holin,tail,tRNA,plate	Burkholderia_phage(40.91%)	50	NA	NA
WP_000587739.1|318380_319022_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
WP_024132246.1|319600_320017_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000084336.1|320397_320853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151758.1|320849_321464_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368193.1|321470_323129_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_000359509.1|323131_323764_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000951734.1|323756_324872_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|324862_325222_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632053.1|325385_326933_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_000703633.1|326932_327862_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000593182.1|327858_328221_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|328548_329271_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|329280_330324_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|330311_330521_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271420.1|330520_331474_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|331473_333828_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|333924_334053_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|334012_334330_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907497.1|334381_334906_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_000729852.1|334905_336333_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|336322_336520_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|336516_336972_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777266.1|337131_337446_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|337458_338064_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|338066_338354_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|338932_339280_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_000136400.1|339412_340762_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790037.1|341106_342756_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001541297.1|343199_343442_+	outer membrane protein	NA	NA	NA	NA	NA
WP_022742863.1|343475_344144_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000977979.1|344140_344878_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750804.1|344877_346974_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982749.1|347115_347526_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252085.1|347691_348582_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000382573.1|348596_350141_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695415.1|350272_351463_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179176.1|351824_352934_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000973681.1|353022_354381_+	maltoporin	NA	NA	NA	NA	NA
WP_000782497.1|354544_355462_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019230.1|355642_356140_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|356153_357026_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|357124_359545_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002900.1|359715_360084_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|360192_360801_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001128112.1|360979_362305_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001575282.1|362301_362415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|362436_362646_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416271.1|362744_363260_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039342.1|363506_364817_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001182224.1|364904_365903_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 2
NC_017623	Salmonella enterica subsp. enterica serovar Heidelberg str. B182, complete sequence	4750465	1107614	1151211	4750465	integrase,lysis,coat,terminase,holin,portal,protease	Enterobacteria_phage(44.44%)	64	1111461:1111506	1150727:1150772
WP_001043660.1|1107614_1108667_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
WP_001285275.1|1108949_1110053_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893221.1|1110064_1111315_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
1111461:1111506	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_000051900.1|1111520_1112684_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|1112913_1113549_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277769.1|1113649_1113829_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_000208013.1|1113925_1114612_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
WP_000224223.1|1114622_1114886_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_001289978.1|1114887_1115373_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000812182.1|1115369_1115996_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001682200.1|1115992_1116157_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111313.1|1116167_1116464_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_000031375.1|1116794_1117412_-	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001163402.1|1117408_1117552_-	hypothetical protein	NA	A0A075B8I9	Enterobacteria_phage	100.0	3.2e-19
WP_000158027.1|1117541_1117730_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|1117710_1117869_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|1117954_1118266_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|1118413_1118617_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|1118616_1118853_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|1118889_1119084_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001066180.1|1119298_1119886_+	superinfection exclusion B family protein	NA	A0A075B8E6	Enterobacteria_phage	99.5	2.6e-91
WP_000216175.1|1119898_1120201_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001095984.1|1120554_1121205_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|1121285_1121471_+	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|1121577_1121856_+	lambda phage CII family protein	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|1121890_1122037_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|1122029_1122845_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|1122841_1124218_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|1124291_1124729_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|1124725_1124899_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|1124865_1125042_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|1125044_1125377_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|1125369_1125546_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|1125538_1126150_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|1126146_1126371_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149925.1|1126367_1126571_+	phage NinH family protein	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|1126551_1126731_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|1126727_1127351_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000286100.1|1127789_1127993_+|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000074137.1|1127970_1128468_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_001531485.1|1128556_1128994_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_001177703.1|1129206_1129893_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_000807785.1|1130195_1130438_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001278047.1|1130439_1130619_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000729925.1|1130642_1131131_+	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417849.1|1131108_1132608_+|terminase	terminase large subunit	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000774655.1|1132607_1134785_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.7	0.0e+00
WP_000433852.1|1134798_1135710_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|1135709_1137002_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|1137040_1137250_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|1137233_1137734_+	packaged DNA stabilization gp4 family protein	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|1137693_1139112_+	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|1139115_1139817_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|1139816_1140272_+	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000964902.1|1140274_1140967_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000246945.1|1140976_1142272_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_001029838.1|1142271_1144269_+	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000749288.1|1144359_1144845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023602519.1|1145247_1145535_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	67.8	1.9e-26
WP_000129930.1|1145637_1147641_+	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000671495.1|1147699_1149157_-	glucosyltransferase domain-containing protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000703640.1|1149146_1150079_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|1150075_1150438_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_001683918.1|1150935_1151211_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
1150727:1150772	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 3
NC_017623	Salmonella enterica subsp. enterica serovar Heidelberg str. B182, complete sequence	4750465	1755454	1763476	4750465	transposase,protease	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|1755454_1756573_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125890.1|1756569_1758516_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|1758645_1758867_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1759190_1759511_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1759541_1761818_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1762008_1762467_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001531374.1|1763098_1763476_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 4
NC_017623	Salmonella enterica subsp. enterica serovar Heidelberg str. B182, complete sequence	4750465	1814090	1912053	4750465	lysis,transposase,tail,terminase,holin,portal,tRNA,protease	Salmonella_phage(43.86%)	102	NA	NA
WP_001154025.1|1814090_1814894_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1814886_1816209_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1816189_1816894_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572753.1|1816893_1821360_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925883.1|1821704_1823525_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1823784_1824333_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1824360_1825008_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1825069_1826260_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1826444_1827536_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1828142_1829543_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1829743_1830205_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1830521_1831736_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893206.1|1831980_1833414_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191413.1|1833494_1834697_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|1834891_1836184_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|1836228_1836477_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001682304.1|1836517_1836757_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000189634.1|1836762_1837632_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_000187054.1|1837628_1838309_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000100830.1|1838305_1839091_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000995352.1|1839096_1839393_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000186242.1|1839483_1839684_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000373338.1|1839971_1840178_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000439725.1|1840642_1841068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1841110_1841506_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1841610_1841847_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_015675517.1|1841812_1842187_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_000024046.1|1842278_1843184_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
WP_000788826.1|1843180_1843882_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_023602525.1|1843926_1844328_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000215887.1|1844324_1844858_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_000224239.1|1844859_1845117_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
WP_000208143.1|1845127_1845529_+	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000877758.1|1845636_1846281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1846511_1846745_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1846861_1847110_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1847144_1847747_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096547.1|1847955_1848567_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|1848563_1848710_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1848699_1849497_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_000508329.1|1849663_1849882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658038.1|1850162_1850351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682303.1|1850553_1850856_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000301013.1|1850833_1851373_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_001080030.1|1851680_1852175_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.3	2.2e-59
WP_000371784.1|1852385_1852919_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989238.1|1852875_1855014_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000196190.1|1855010_1855217_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009205.1|1855213_1856761_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	63.8	1.1e-176
WP_077906133.1|1856684_1858763_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
WP_001107908.1|1858853_1859177_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1859169_1859469_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453192.1|1859449_1860016_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000196703.1|1860012_1860414_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132755.1|1860425_1861175_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478858.1|1861220_1861619_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1861615_1861945_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_065305406.1|1862024_1865012_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_000978295.1|1865008_1865341_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000410973.1|1865440_1865965_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	34.8	5.3e-19
WP_000877926.1|1866054_1866588_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1866677_1867373_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606356.1|1867382_1868120_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_020867839.1|1868017_1868722_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_000033414.1|1868793_1872144_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	69.3	0.0e+00
WP_000178849.1|1872182_1872425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532020.1|1872478_1874854_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_031618324.1|1875354_1875675_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_000143158.1|1875664_1876246_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_000161705.1|1876442_1877165_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000343758.1|1877815_1879036_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_071531551.1|1879032_1879530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193784.1|1879964_1882577_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1882784_1883795_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1883960_1884503_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1884499_1885609_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|1885707_1887816_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1887828_1889736_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1889750_1891004_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_015675524.1|1891043_1892648_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1892644_1893208_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_015675525.1|1893463_1893631_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1893730_1894249_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1894317_1896078_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1896263_1896716_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1896788_1897841_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1898198_1898708_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1898924_1899530_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1899516_1901670_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1901688_1902135_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1902258_1904313_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1904348_1904807_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847716.1|1904901_1905564_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1905737_1906151_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1906195_1906513_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1906570_1907782_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|1907996_1908545_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1908570_1909350_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1909398_1909680_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1909676_1910006_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1910092_1910752_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938191.1|1911372_1912053_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 5
NC_017623	Salmonella enterica subsp. enterica serovar Heidelberg str. B182, complete sequence	4750465	2810129	2817380	4750465		Morganella_phage(33.33%)	7	NA	NA
WP_001157304.1|2810129_2811560_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_000377037.1|2811633_2812329_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001080662.1|2813370_2814567_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|2814823_2815012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2815022_2815235_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457664.1|2815689_2816958_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000394197.1|2816960_2817380_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
NC_017623	Salmonella enterica subsp. enterica serovar Heidelberg str. B182, complete sequence	4750465	2906741	2917247	4750465		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2906741_2908055_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2908081_2909161_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2909165_2909939_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2909935_2910928_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2910933_2911485_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2911485_2912364_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2912411_2913311_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2913310_2914396_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2914772_2915666_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111845.1|2915843_2917247_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 7
NC_017623	Salmonella enterica subsp. enterica serovar Heidelberg str. B182, complete sequence	4750465	2985526	2994697	4750465	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2985526_2987560_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2987800_2988259_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2988430_2988961_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2989017_2989485_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2989531_2990251_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2990247_2991933_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|2992155_2992887_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2992946_2993054_+	protein YohO	NA	NA	NA	NA	NA
WP_000824857.1|2993034_2993766_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|2993749_2994697_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
NC_017623	Salmonella enterica subsp. enterica serovar Heidelberg str. B182, complete sequence	4750465	3014105	3080501	4750465	holin,lysis,tail	Salmonella_phage(27.78%)	56	NA	NA
WP_000989295.1|3014105_3014801_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|3014954_3015839_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|3016015_3016735_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|3016731_3016977_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136394.1|3017182_3018424_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956097.1|3018417_3019653_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|3019727_3020738_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|3020753_3022274_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|3022407_3023406_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|3023905_3024928_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001520237.1|3025077_3026220_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|3026234_3026903_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|3027232_3028090_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|3028078_3028468_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001531764.1|3028472_3029840_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022910.1|3030056_3030944_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023802.1|3030976_3032299_+	MFS transporter	NA	NA	NA	NA	NA
WP_000535000.1|3034680_3036150_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548316.1|3036339_3037203_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137966.1|3037323_3038373_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873906.1|3038451_3039309_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	1.3e-22
WP_000854395.1|3039373_3041062_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|3041078_3042017_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|3042016_3043147_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|3043514_3044696_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213897.1|3044759_3045425_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|3045426_3045549_-	membrane protein	NA	NA	NA	NA	NA
WP_001523448.1|3045936_3046191_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|3046514_3047087_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169346.1|3047299_3048286_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|3048315_3049035_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|3049448_3050021_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957755.1|3050346_3051903_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561742.1|3052009_3053815_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001137747.1|3054919_3055945_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000222013.1|3055946_3057536_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	7.2e-19
WP_001094639.1|3057539_3057884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|3058274_3059465_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234834.1|3059492_3060188_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578130.1|3060339_3062100_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.4e-100
WP_000494192.1|3062224_3062509_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033443.1|3062616_3063237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|3063264_3064272_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|3064451_3064679_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|3064710_3066471_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|3066751_3067255_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|3067282_3067573_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|3067920_3069750_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|3069803_3070247_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|3070624_3071152_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_001120499.1|3072989_3073319_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_010989045.1|3074976_3075345_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|3075359_3076349_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|3076677_3079044_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|3079211_3079415_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|3079709_3080501_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
