The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017664	Escherichia coli W, complete sequence	4897452	197062	270411	4897452	transposase,protease,plate,tRNA	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_001346129.1|197062_198415_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|198444_200877_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|200998_201484_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|201487_202513_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|202617_203073_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|203076_203865_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|203864_205013_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|205009_205606_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|205642_209125_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|209137_210097_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021030.1|210195_212337_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|212393_212783_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|212847_214146_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|214194_214455_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|214441_214642_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|214807_215353_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|215349_215772_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|215785_216496_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001297208.1|216650_217475_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|217528_219247_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|219357_220065_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|220061_220466_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|220583_221399_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|221438_222092_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|222084_223116_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|223303_223879_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997038.1|229637_230441_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_000648576.1|230437_231352_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|231592_232393_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211687.1|232470_233241_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|233288_234647_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|234718_235474_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298887.1|235507_236230_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|236226_236694_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|236758_237490_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|238029_238815_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|238951_239431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|239440_240355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|240398_240881_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|240904_242257_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_122986077.1|242267_245702_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240545.1|245810_247223_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|247227_247971_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614350.1|247967_250775_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.9	1.2e-80
WP_000343298.1|250783_251545_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246449.1|251549_252881_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|252883_253408_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|253404_254685_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|254709_255792_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|255755_257606_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|257609_258023_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|258029_259505_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|259555_259780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037395.1|259814_260315_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|261012_261531_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103316.1|261740_263882_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001350059.1|263957_268007_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.4e-20
WP_001350058.1|267966_268404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420953.1|269274_270411_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_017664	Escherichia coli W, complete sequence	4897452	292364	332044	4897452	tail,protease,head,transposase,plate	Escherichia_phage(60.38%)	54	NA	NA
WP_000859525.1|292364_292760_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
WP_000514023.1|292914_293610_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	99.1	9.5e-133
WP_001300256.1|293560_293749_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	100.0	1.3e-31
WP_000905064.1|293843_294425_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	99.5	1.6e-104
WP_001112250.1|294454_295450_+	hypothetical protein	NA	A0A077SK37	Escherichia_phage	94.7	6.4e-183
WP_000972171.1|295452_295986_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	98.9	1.2e-95
WP_000972119.1|296014_296542_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	98.3	1.2e-92
WP_000499360.1|296544_298059_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	90.2	1.7e-259
WP_000301695.1|298058_298601_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	99.4	4.8e-100
WP_000331815.1|298591_299674_-|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	98.9	1.1e-204
WP_000130548.1|299674_300112_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	100.0	1.0e-79
WP_000442748.1|300108_300702_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	99.0	1.2e-107
WP_000072824.1|300689_301829_-|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	98.9	3.4e-212
WP_000461070.1|301821_303309_-	DNA circularization protein	NA	A0A0C4UR32	Shigella_phage	98.2	6.6e-240
WP_000147074.1|303313_305386_-	tape measure protein	NA	C9DGQ1	Escherichia_phage	96.4	3.8e-312
WP_000344073.1|305530_305965_-|tail	phage tail assembly protein	tail	C9DGP9	Escherichia_phage	97.9	3.8e-71
WP_000918402.1|305974_306331_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	94.9	4.2e-60
WP_001280310.1|306340_307828_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	99.6	1.3e-280
WP_000979227.1|307824_308031_-	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	98.5	1.4e-28
WP_000888926.1|308014_308563_-	DUF1834 family protein	NA	C9DGP5	Escherichia_phage	99.5	1.9e-104
WP_001104973.1|308562_308988_-	DUF1320 family protein	NA	C9DGP4	Escherichia_phage	97.2	8.8e-73
WP_000017158.1|308984_309395_-	hypothetical protein	NA	C9DGP3	Escherichia_phage	98.5	6.1e-63
WP_000637410.1|309461_310379_-|head	Mu-like prophage major head subunit gpT family protein	head	C9DGP2	Escherichia_phage	99.3	5.2e-179
WP_000716025.1|310375_311461_-|protease	phage protease	protease	C9DGP0	Escherichia_phage	98.3	5.2e-194
WP_001350023.1|311657_312128_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	99.4	3.8e-85
WP_001136431.1|312124_313444_-|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	98.2	1.5e-248
WP_000532638.1|313424_314963_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	99.0	1.5e-295
WP_001097325.1|314962_316618_-	hypothetical protein	NA	C9DGN5	Escherichia_phage	97.8	0.0e+00
WP_000375394.1|316625_317201_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	100.0	9.1e-97
WP_000606409.1|317212_317503_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	100.0	7.4e-47
WP_000364295.1|317499_317799_-	DUF2730 family protein	NA	C9DGN2	Escherichia_phage	100.0	5.8e-47
WP_001001316.1|317798_317993_-	hypothetical protein	NA	C9DGN1	Escherichia_phage	100.0	6.2e-34
WP_001350022.1|318151_318538_-	hypothetical protein	NA	C9DGN0	Escherichia_phage	97.7	2.2e-62
WP_000907405.1|318521_319037_-	lysozyme	NA	C9DGM9	Escherichia_phage	99.4	1.9e-93
WP_001163387.1|319131_319554_-	positive regulator of late transcription	NA	C9DGM8	Escherichia_phage	99.3	2.2e-76
WP_000004161.1|319695_320058_-	hypothetical protein	NA	C9DGM6	Escherichia_phage	99.2	4.1e-63
WP_000515807.1|320050_320269_-	hypothetical protein	NA	C9DGM5	Escherichia_phage	100.0	5.6e-39
WP_000133853.1|320346_320736_-	hypothetical protein	NA	A0A0C4UR27	Shigella_phage	98.4	2.3e-67
WP_000091782.1|320732_321284_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	96.7	1.2e-98
WP_000431116.1|321354_321621_+	hypothetical protein	NA	Q38493	Escherichia_phage	98.9	2.3e-39
WP_001058561.1|321559_321862_-	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	99.0	1.4e-48
WP_000429765.1|321863_322046_-	hypothetical protein	NA	A0A0C4UR26	Shigella_phage	83.3	1.4e-24
WP_000465551.1|322032_322563_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	97.2	6.4e-97
WP_000227260.1|322562_323093_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	95.5	4.2e-96
WP_001107930.1|323191_323716_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	100.0	1.5e-90
WP_001372708.1|323735_324023_-	hypothetical protein	NA	C9DGL7	Escherichia_phage	100.0	2.5e-47
WP_001101152.1|324035_324455_-	hypothetical protein	NA	C9DGL6	Escherichia_phage	95.7	8.7e-73
WP_001151288.1|324469_324733_-	hypothetical protein	NA	A0A0C4UQU1	Shigella_phage	96.6	2.5e-38
WP_000968312.1|324977_325205_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	100.0	3.2e-37
WP_001026710.1|325220_326159_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	98.1	1.3e-169
WP_000424754.1|326197_328189_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	C9DGL1	Escherichia_phage	93.5	0.0e+00
WP_000337186.1|328190_328418_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	66.7	4.8e-17
WP_000840061.1|328587_329178_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001143092.1|329599_332044_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	42.6	1.6e-33
>prophage 3
NC_017664	Escherichia coli W, complete sequence	4897452	925668	993580	4897452	terminase,capsid,tail,head,transposase,integrase,lysis,plate,portal	Salmonella_phage(73.91%)	74	949803:949820	967880:967897
WP_000399648.1|925668_926649_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168797.1|926904_928170_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114244.1|928321_929137_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209359.1|929282_931715_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|931720_932620_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001350053.1|932750_933413_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	8.2e-25
WP_000829261.1|933488_934238_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397383.1|934237_935473_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|935676_936642_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001296993.1|936628_938500_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_000090130.1|938519_940058_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|940075_940996_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236037.1|940998_941910_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001307078.1|942087_944436_+	CHASE9 sensor domain-containing protein	NA	NA	NA	NA	NA
WP_000086910.1|944443_945772_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|945818_947144_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|947356_947740_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555030.1|947850_948966_+	aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
WP_001295292.1|948962_949589_-	glutathione S-transferase GstB	NA	NA	NA	NA	NA
949803:949820	attL	TATTTTTTTTGAATGGAT	NA	NA	NA	NA
WP_000195961.1|949835_951038_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450133.1|951084_951843_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|951900_952497_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180076.1|952781_954014_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480893.1|954054_954339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|954424_955240_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|955239_956448_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|956531_957068_+	DNA-binding transcriptional regulator RcdA	NA	NA	NA	NA	NA
WP_000290919.1|957172_958225_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.8	2.1e-107
WP_000350737.1|958305_959757_-	NTPase KAP	NA	R9TRQ8	Vibrio_phage	29.7	1.8e-45
WP_001350049.1|959757_960321_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.2	4.8e-34
WP_001069047.1|960467_960671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460867.1|960736_961246_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	86.4	1.0e-75
WP_000956172.1|961253_961550_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000934004.1|961635_961884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963473.1|961965_962307_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244226.1|962374_962608_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000752613.1|962607_962835_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104176.1|962831_963689_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.1	5.2e-157
WP_000017523.1|963685_966100_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.1	0.0e+00
WP_001154431.1|966252_966441_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|966451_966685_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001059831.1|966877_967213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818977.1|967745_969527_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
967880:967897	attR	ATCCATTCAAAAAAAATA	NA	NA	NA	NA
WP_000520345.1|969567_970593_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.2	1.9e-169
WP_001098438.1|970592_972359_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216237.1|972501_973335_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742510.1|973351_974410_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000059191.1|974413_975064_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673523.1|975159_975624_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868174.1|975623_975827_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	3.0e-31
WP_000171568.1|975830_976046_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069915.1|976026_976539_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	1.8e-88
WP_000727853.1|976540_976918_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080936.1|976914_977343_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.0	4.6e-45
WP_001039935.1|977438_977870_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_000829153.1|977862_978309_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	80.3	1.9e-57
WP_000339827.1|978364_979234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993765.1|979356_979935_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	4.7e-93
WP_000177597.1|979931_980291_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000268312.1|980277_981186_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	2.3e-142
WP_001086814.1|981178_981784_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	7.5e-110
WP_000104786.1|981780_983172_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	77.9	5.1e-162
WP_085947772.1|983191_984405_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000378634.1|984585_985191_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.4	1.9e-97
WP_001145387.1|985190_985694_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	60.0	4.7e-49
WP_000905033.1|985724_986291_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_000046154.1|986433_987606_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_001207659.1|987615_988131_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281009.1|988185_988488_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|988502_988622_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282753.1|988614_991692_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980390.1|991688_992174_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.3e-67
WP_001011811.1|992170_993271_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.2	2.5e-175
WP_000972391.1|993361_993580_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
>prophage 4
NC_017664	Escherichia coli W, complete sequence	4897452	1491909	1548451	4897452	terminase,tail,holin,plate,tRNA	Escherichia_phage(75.44%)	64	NA	NA
WP_001307164.1|1491909_1493142_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1493396_1494380_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123740.1|1494857_1496231_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157422.1|1496359_1497295_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	4.5e-146
WP_000040852.1|1497346_1498582_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1498583_1498799_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1498877_1499087_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1499079_1499274_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1499330_1500140_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105152.1|1500132_1502733_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.8e-248
WP_001349884.1|1502834_1503110_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	6.3e-40
WP_001349883.1|1503184_1503355_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	6.7e-24
WP_000560220.1|1503354_1503576_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_001169153.1|1503996_1504149_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000233319.1|1504579_1504999_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1505078_1505333_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693802.1|1505329_1505752_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_000899746.1|1505764_1506622_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788973.1|1506628_1507375_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000450660.1|1507397_1508159_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
WP_001151237.1|1508174_1508597_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	7.4e-64
WP_000228824.1|1508780_1509908_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000569066.1|1509900_1511010_+	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_000064766.1|1511006_1511984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813259.1|1512614_1512770_+	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	96.1	5.5e-17
WP_000940320.1|1513238_1513838_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000228041.1|1513837_1514128_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	4.3e-47
WP_000640164.1|1514124_1514661_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.3e-68
WP_001349882.1|1515931_1516324_+|holin	holin	holin	Q8W636	Enterobacteria_phage	96.2	8.4e-54
WP_000950573.1|1516313_1516589_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	5.5e-44
WP_000014545.1|1516591_1516969_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	3.0e-64
WP_133301706.1|1516983_1517166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291099.1|1517570_1518359_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	41.1	2.5e-49
WP_001204039.1|1518351_1519284_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	7.1e-83
WP_001307172.1|1519219_1519471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089432.1|1519474_1520566_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	92.1	1.0e-144
WP_000021163.1|1520555_1521884_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.9	8.4e-263
WP_000807710.1|1521902_1523339_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	95.8	5.2e-266
WP_001018386.1|1523283_1524117_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.8	1.2e-153
WP_000059667.1|1524097_1525420_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.2	6.8e-188
WP_001349881.1|1525412_1526030_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	100.0	5.9e-118
WP_001272365.1|1526044_1527073_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.4	3.3e-190
WP_000780861.1|1527130_1527601_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	100.0	2.5e-84
WP_000175376.1|1527600_1528041_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000762302.1|1528037_1528478_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	98.6	2.2e-82
WP_001139506.1|1528464_1529409_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.4	2.2e-172
WP_000506600.1|1529408_1530746_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.2	1.0e-244
WP_000613371.1|1530769_1531201_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	2.8e-74
WP_000703979.1|1531197_1531815_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	98.0	4.2e-108
WP_000016439.1|1531878_1533867_+	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	94.4	0.0e+00
WP_000056323.1|1533870_1534539_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	98.6	4.3e-122
WP_000209259.1|1534535_1534802_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	94.3	2.7e-43
WP_001271172.1|1534801_1535809_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	96.1	1.2e-189
WP_000063616.1|1535808_1536522_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	96.6	1.8e-126
WP_001261334.1|1537218_1537566_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	94.8	4.1e-60
WP_000733802.1|1537956_1538496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001349878.1|1538517_1539744_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	98.8	5.8e-226
WP_001199732.1|1539727_1540354_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.0	2.2e-120
WP_000600270.1|1540350_1541904_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	79.2	4.6e-228
WP_000902859.1|1541906_1542452_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	76.4	3.8e-76
WP_000117760.1|1542475_1545616_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	71.2	0.0e+00
WP_000701877.1|1545630_1546203_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.3	1.8e-76
WP_001082294.1|1546742_1547177_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837909.1|1547317_1548451_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 5
NC_017664	Escherichia coli W, complete sequence	4897452	1744966	1803352	4897452	terminase,capsid,tail,head,transposase,integrase,lysis,portal	Enterobacteria_phage(48.08%)	73	1775613:1775628	1808048:1808063
WP_000527779.1|1744966_1746427_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
WP_120795384.1|1748403_1748517_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1748585_1748819_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1749135_1749726_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1749823_1750399_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000279140.1|1750398_1753473_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001233072.1|1753537_1754137_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	9.7e-110
WP_000033679.1|1754207_1757621_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_000090891.1|1757681_1758314_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_001349921.1|1758250_1758994_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	6.8e-145
WP_001152622.1|1758999_1759698_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
WP_000847360.1|1759697_1760027_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	9.6e-59
WP_000840335.1|1760023_1762585_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.3	0.0e+00
WP_000459457.1|1762577_1763012_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479150.1|1762993_1763416_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	1.3e-71
WP_001349920.1|1763431_1764172_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|1764179_1764575_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000985119.1|1764571_1765150_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000753007.1|1765161_1765515_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000158921.1|1765526_1765925_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	4.5e-63
WP_000063280.1|1765966_1766992_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001295978.1|1767047_1767380_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123305.1|1767389_1768709_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
WP_001349919.1|1768689_1770291_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
WP_000198149.1|1770287_1770494_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027259.1|1770490_1772416_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453611.1|1772390_1772936_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|1773324_1773558_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1773615_1774026_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1774177_1774351_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1774522_1774678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1774757_1774823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1774825_1775014_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1775024_1775237_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1775599_1776097_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
1775613:1775628	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|1776093_1776627_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1776623_1776935_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1776939_1777155_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1777908_1778124_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1778424_1778637_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1778691_1778781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|1779058_1779811_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|1779824_1780874_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|1780875_1781154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1781220_1781472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1781688_1781844_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1781915_1782203_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1782202_1782442_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1782466_1782772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1782974_1783307_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|1783743_1785057_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001310834.1|1786723_1787080_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|1787076_1787499_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|1787539_1788505_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|1788485_1789007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1788990_1789221_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1789304_1789712_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1789878_1790034_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1790193_1790412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1790979_1791168_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1791164_1791356_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048348.1|1791448_1793926_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|1793998_1794250_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876956.1|1794284_1795565_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	5.6e-155
WP_001360138.1|1795584_1795695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836076.1|1795752_1796772_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	1.3e-16
WP_001295394.1|1796783_1797998_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1798203_1798530_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1798664_1799006_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1799040_1799601_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1799603_1800314_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1800421_1800727_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041685.1|1800925_1803352_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
1808048:1808063	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 6
NC_017664	Escherichia coli W, complete sequence	4897452	2298169	2336041	4897452	terminase,capsid,tail,head,holin,integrase,lysis,plate,portal,tRNA	Escherichia_phage(44.44%)	50	2303227:2303254	2334234:2334261
WP_000675150.1|2298169_2299573_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|2299569_2300292_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|2300482_2300815_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2301023_2301320_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2301321_2301618_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2301720_2303082_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2303227:2303254	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2303354_2303573_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882938.1|2303653_2304817_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|2304816_2305296_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069967.1|2305310_2307758_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	98.8	0.0e+00
WP_000785970.1|2307750_2307870_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2307902_2308178_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2308234_2308753_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286686.1|2308765_2309956_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_000905100.1|2310015_2310609_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
WP_000049773.1|2311054_2311495_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	61.9	2.7e-48
WP_000805553.1|2311466_2312060_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	63.0	1.3e-58
WP_000216987.1|2312059_2313343_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	64.6	6.6e-156
WP_001285343.1|2313339_2313951_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121496.1|2313943_2314852_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.8e-161
WP_000127163.1|2314856_2315204_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093712.1|2315200_2315836_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	6.5e-112
WP_001001782.1|2315902_2316355_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
WP_000917165.1|2316347_2316815_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	3.3e-81
WP_072134039.1|2316777_2316951_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	6.8e-24
WP_000040687.1|2316922_2317348_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	8.0e-66
WP_000736570.1|2317335_2317761_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	2.9e-60
WP_001144178.1|2317775_2318273_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_000123123.1|2318272_2318554_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|2318557_2318761_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_001350080.1|2318760_2319270_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	2.1e-89
WP_000203430.1|2319369_2320113_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	96.0	2.3e-121
WP_001248584.1|2320116_2321190_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	7.4e-201
WP_001085948.1|2321248_2322103_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156872.1|2322276_2324049_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038162.1|2324048_2325077_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.2e-197
WP_001350078.1|2325135_2325708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000744812.1|2325700_2327134_-	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	30.1	3.9e-40
WP_000268602.1|2328298_2330575_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_000027664.1|2330564_2330840_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113270.1|2330836_2331061_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277968.1|2331063_2331363_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	4.2e-45
WP_000557703.1|2331362_2331587_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217680.1|2331650_2332151_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_001005162.1|2332147_2332318_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2332328_2332604_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2332725_2333025_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2333140_2334154_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001352710.1|2334418_2334736_-	hypothetical protein	NA	NA	NA	NA	NA
2334234:2334261	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2335141_2336041_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 7
NC_017664	Escherichia coli W, complete sequence	4897452	2374014	2383455	4897452		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001349937.1|2374014_2375151_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001349936.1|2375147_2377148_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001295429.1|2377272_2377734_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2377773_2378244_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2378290_2379010_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2379006_2380692_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2380913_2381645_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2381704_2381812_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2381792_2382524_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569367.1|2382528_2383455_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	9.7e-24
>prophage 8
NC_017664	Escherichia coli W, complete sequence	4897452	2583047	2658768	4897452	terminase,head,integrase,holin,coat,lysis,portal,tRNA	Enterobacteria_phage(50.82%)	90	2580252:2580268	2632131:2632147
2580252:2580268	attL	ATGCGCGACATCAAAAA	NA	NA	NA	NA
WP_001283590.1|2583047_2583860_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|2583859_2584873_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|2584938_2586075_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|2586173_2587169_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127762.1|2587165_2588344_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2588654_2589875_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683799.1|2590033_2592040_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2592160_2592439_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|2592472_2593021_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|2593020_2593830_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043819.1|2593829_2594654_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2594657_2595743_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001306448.1|2595777_2596710_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2596875_2597427_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001356216.1|2597548_2598421_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730291.1|2598407_2598932_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|2598928_2599399_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|2599395_2599944_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|2599918_2600671_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112828.1|2600690_2603333_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2603414_2603978_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|2604652_2605138_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425056.1|2605340_2607485_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|2607484_2608795_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|2608974_2609259_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2609630_2610971_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937836.1|2611335_2612394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2612575_2613331_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2613624_2614557_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958678.1|2614868_2616026_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	3.7e-222
WP_000575660.1|2616271_2617399_+	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	30.2	1.0e-19
WP_001280400.1|2617431_2619630_-|head	phage head-binding domain-containing protein	head	F8UBT4	Escherichia_phage	37.6	4.1e-105
WP_000287053.1|2619751_2620012_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	98.8	3.6e-37
WP_001029828.1|2620101_2622099_-	hypothetical protein	NA	Q716G2	Shigella_phage	95.9	0.0e+00
WP_000246948.1|2622098_2623487_-	phage DNA ejection protein	NA	A0A220NR03	Salmonella_phage	64.0	7.7e-150
WP_000964882.1|2623496_2624189_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000614044.1|2624191_2624647_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	1.1e-86
WP_000785560.1|2624646_2625495_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.2	3.8e-99
WP_001122413.1|2625494_2626913_-	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.9	1.0e-274
WP_001054835.1|2626912_2627413_-	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	98.2	1.2e-89
WP_001349928.1|2627390_2627645_-	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	95.5	1.1e-25
WP_001196941.1|2627689_2628985_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.1	4.7e-242
WP_000373008.1|2628984_2629896_-	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	6.3e-161
WP_000752844.1|2629909_2632075_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.7	0.0e+00
WP_000417851.1|2632075_2633575_-|terminase	terminase large subunit	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
2632131:2632147	attR	TTTTTGATGTCGCGCAT	NA	NA	NA	NA
WP_000729921.1|2633552_2634041_-	DNA-packaging protein	NA	G8EYI7	Enterobacteria_phage	99.4	4.1e-90
WP_000807791.1|2634120_2634363_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	2.9e-36
WP_001058931.1|2634611_2635097_-	GIY-YIG nuclease family protein	NA	C6ZR70	Salmonella_phage	100.0	8.5e-88
WP_001139680.1|2635300_2635453_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_000088943.1|2635440_2635908_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	6.1e-75
WP_000229392.1|2635904_2636381_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|2636364_2636688_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_029798719.1|2636798_2636981_+	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	95.0	1.5e-26
WP_001235461.1|2637121_2637745_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000994515.1|2637741_2637930_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001008199.1|2637926_2638289_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002243.1|2638285_2638576_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_000950973.1|2639289_2639466_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_000386657.1|2639465_2639825_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.8	1.2e-62
WP_001254255.1|2639827_2640004_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000153270.1|2640000_2640528_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810178.1|2640524_2640971_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	93.2	3.4e-75
WP_000131504.1|2641365_2642802_-	AAA family ATPase	NA	K7P7N4	Enterobacteria_phage	99.4	4.4e-273
WP_000065676.1|2642791_2643691_-	hypothetical protein	NA	K7PH26	Enterobacteria_phage	99.7	6.1e-164
WP_000166207.1|2643683_2643830_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438534.1|2643862_2644159_-	hypothetical protein	NA	G9L678	Escherichia_phage	98.0	2.0e-47
WP_000067727.1|2644268_2644484_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_179077806.1|2644595_2645255_+	helix-turn-helix domain-containing protein	NA	A0A0N7BTS4	Escherichia_phage	96.8	2.2e-123
WP_000216180.1|2645608_2645917_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	65.7	8.2e-28
WP_000804697.1|2645919_2646198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000392415.1|2646255_2646621_+	hypothetical protein	NA	A0A192Y658	Salmonella_phage	99.2	1.1e-58
WP_000657742.1|2646673_2647003_+	hypothetical protein	NA	A0A088CPT8	Enterobacteria_phage	72.9	1.9e-14
WP_000865176.1|2647002_2647191_+	hypothetical protein	NA	A0A0B7MKW0	Enterobacteria_phage	59.3	3.8e-12
WP_001183768.1|2647376_2647547_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	98.2	3.9e-24
WP_000365276.1|2647801_2648509_+	recombinase	NA	K7PKU3	Enterobacteria_phage	99.1	5.0e-137
WP_000168259.1|2648509_2649025_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	88.3	1.3e-65
WP_001016190.1|2649033_2649582_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	97.8	3.6e-103
WP_001111278.1|2649598_2649892_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214452.1|2649902_2650067_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_000812168.1|2650063_2650582_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	64.2	6.6e-54
WP_001065198.1|2650578_2651223_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	98.1	1.1e-130
WP_000151160.1|2651219_2651819_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	94.1	3.8e-45
WP_000206740.1|2651820_2652510_+	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	79.1	4.1e-96
WP_000002088.1|2652502_2652787_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	92.6	9.4e-47
WP_000152200.1|2652829_2653630_+	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	98.5	1.7e-157
WP_001281185.1|2653687_2654032_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	95.6	6.5e-58
WP_001163428.1|2654155_2654356_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001197025.1|2654885_2656133_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274885.1|2656204_2657119_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|2657334_2658768_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 9
NC_017664	Escherichia coli W, complete sequence	4897452	2922405	2930169	4897452	transposase,integrase	Escherichia_phage(66.67%)	6	2920193:2920206	2927306:2927319
2920193:2920206	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|2922405_2922888_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|2923630_2924860_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|2924898_2925315_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|2925386_2927135_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000577254.1|2927136_2928855_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
2927306:2927319	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_085947771.1|2929006_2930169_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 10
NC_017664	Escherichia coli W, complete sequence	4897452	3003502	3010642	4897452		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|3003502_3006064_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|3006169_3006826_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|3006876_3007644_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3007839_3008748_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3008744_3010007_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3010003_3010642_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 11
NC_017664	Escherichia coli W, complete sequence	4897452	4297660	4389269	4897452	terminase,capsid,tail,protease,head,transposase,integrase,holin,lysis,plate,portal,tRNA	Escherichia_virus(40.0%)	99	4328322:4328368	4361000:4361046
WP_000560983.1|4297660_4298098_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4298142_4299084_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|4299147_4300056_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|4300284_4300596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4300596_4300887_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|4301491_4301710_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|4301928_4302171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027702.1|4302500_4303430_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|4303426_4304062_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4304058_4304961_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|4304973_4308024_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753583.1|4308217_4309051_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001317404.1|4309203_4310244_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931314.1|4310293_4312042_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001019466.1|4312041_4313112_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446010.1|4313101_4314553_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|4314563_4315010_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|4315310_4315625_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179764.1|4315634_4316459_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211486.1|4316700_4317960_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144046.1|4317956_4319426_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217162.1|4319713_4320550_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001350036.1|4320533_4321472_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063504.1|4321468_4322503_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|4322787_4323408_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166050.1|4323667_4324651_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|4324799_4325474_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4325579_4326953_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4326949_4327648_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4327797_4328298_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4328322:4328368	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023383.1|4328483_4329464_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4C5	Escherichia_virus	100.0	1.0e-185
WP_001192857.1|4329533_4329827_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|4329979_4330252_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001350035.1|4330227_4330425_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	96.9	8.0e-29
WP_000217679.1|4330421_4330922_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000557702.1|4330985_4331210_+	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	100.0	6.1e-33
WP_001277905.1|4331209_4331512_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	100.0	3.5e-47
WP_001113263.1|4331511_4331736_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_000027664.1|4331732_4332008_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268589.1|4331997_4334283_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	99.9	0.0e+00
WP_014640573.1|4334282_4334735_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	6.1e-80
WP_000554771.1|4334734_4334941_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
WP_001143634.1|4335183_4336122_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_001350076.1|4336118_4337144_-	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	3.3e-198
WP_000368931.1|4337148_4338222_-	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_000038147.1|4338637_4339672_-|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	100.0	2.4e-201
WP_000156872.1|4339671_4341444_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085948.1|4341617_4342472_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_001248591.1|4342530_4343604_+|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	100.0	8.7e-202
WP_000203449.1|4343607_4344351_+|terminase	terminase endonuclease subunit	terminase	Q94MF3	Enterobacteria_phage	99.6	2.3e-124
WP_000988633.1|4344450_4344960_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|4344959_4345163_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|4345166_4345448_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144093.1|4345447_4345945_+	glycoside hydrolase family 104 protein	NA	Q7Y4E4	Escherichia_virus	100.0	6.2e-94
WP_000736609.1|4345959_4346385_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.9	3.8e-60
WP_000040682.1|4346372_4346798_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	100.0	7.7e-69
WP_000917179.1|4346905_4347373_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	100.0	3.0e-82
WP_001001780.1|4347365_4347818_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001093706.1|4347884_4348520_+|plate	phage baseplate assembly protein V	plate	Q7Y4D8	Escherichia_virus	100.0	2.4e-106
WP_000127163.1|4348516_4348864_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121482.1|4348868_4349777_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_001285313.1|4349769_4350300_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	1.3e-102
WP_000104720.1|4350310_4352320_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	99.6	0.0e+00
WP_001164149.1|4352323_4352851_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	98.3	5.6e-93
WP_000014362.1|4353066_4353966_+	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	100.0	6.2e-169
WP_001286683.1|4354285_4355476_+|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	99.7	8.1e-225
WP_001251408.1|4355488_4356007_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|4356063_4356339_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4356371_4356491_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001283070.1|4356483_4358931_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	100.0	0.0e+00
WP_000978900.1|4358945_4359425_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	100.0	5.1e-85
WP_000882968.1|4359424_4360588_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	98.4	1.3e-206
WP_000468308.1|4360669_4360888_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|4361124_4362027_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4361000:4361046	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4362207_4363170_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|4363489_4364479_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000708994.1|4364585_4365341_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4365395_4366163_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|4366270_4366870_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155254.1|4366970_4367411_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4367622_4367922_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|4367948_4368377_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|4368381_4369128_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4369224_4370235_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4370370_4371879_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4371901_4372747_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4373171_4373417_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4373501_4373987_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4374079_4375006_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|4375072_4376404_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4376413_4376944_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068834.1|4377036_4377996_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|4378087_4379113_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001350069.1|4379268_4381467_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|4381669_4381882_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000015032.1|4382041_4386214_+	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
WP_001323627.1|4386215_4386539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000797341.1|4387445_4388054_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399648.1|4388288_4389269_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
