The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017660	Escherichia coli KO11FL, complete sequence	5021812	197062	270411	5021812	protease,tRNA,transposase,plate	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_001346129.1|197062_198415_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|198444_200877_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|200998_201484_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|201487_202513_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|202617_203073_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|203076_203865_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|203864_205013_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|205009_205606_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|205642_209125_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|209137_210097_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021030.1|210195_212337_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|212393_212783_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|212847_214146_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|214194_214455_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|214441_214642_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|214807_215353_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|215349_215772_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|215785_216496_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001297208.1|216650_217475_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|217528_219247_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|219357_220065_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|220061_220466_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|220583_221399_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|221438_222092_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|222084_223116_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|223303_223879_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997038.1|229637_230441_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_000648576.1|230437_231352_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|231592_232393_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211687.1|232470_233241_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|233288_234647_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|234718_235474_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298887.1|235507_236230_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|236226_236694_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|236758_237490_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|238029_238815_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|238951_239431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|239440_240355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|240398_240881_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|240904_242257_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_122986077.1|242267_245702_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240545.1|245810_247223_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|247227_247971_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614350.1|247967_250775_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.9	1.2e-80
WP_000343298.1|250783_251545_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246449.1|251549_252881_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|252883_253408_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|253404_254685_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|254709_255792_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|255755_257606_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|257609_258023_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|258029_259505_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|259555_259780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037395.1|259814_260315_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|261012_261531_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001297813.1|261563_261701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000103316.1|261740_263882_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001350059.1|263957_268007_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.4e-20
WP_001350058.1|267966_268404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420794.1|269274_270411_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_017660	Escherichia coli KO11FL, complete sequence	5021812	292364	328418	5021812	protease,tail,transposase,head,plate	Escherichia_phage(61.54%)	52	NA	NA
WP_000859525.1|292364_292760_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
WP_000514023.1|292914_293610_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	99.1	9.5e-133
WP_001300256.1|293560_293749_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	100.0	1.3e-31
WP_000905064.1|293843_294425_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	99.5	1.6e-104
WP_001112250.1|294454_295450_+	hypothetical protein	NA	A0A077SK37	Escherichia_phage	94.7	6.4e-183
WP_000972171.1|295452_295986_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	98.9	1.2e-95
WP_000972119.1|296014_296542_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	98.3	1.2e-92
WP_000499360.1|296544_298059_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	90.2	1.7e-259
WP_000301695.1|298058_298601_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	99.4	4.8e-100
WP_000331815.1|298591_299674_-|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	98.9	1.1e-204
WP_000130548.1|299674_300112_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	100.0	1.0e-79
WP_000442748.1|300108_300702_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	99.0	1.2e-107
WP_000072824.1|300689_301829_-|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	98.9	3.4e-212
WP_000461070.1|301821_303309_-	DNA circularization protein	NA	A0A0C4UR32	Shigella_phage	98.2	6.6e-240
WP_000147074.1|303313_305386_-	tape measure protein	NA	C9DGQ1	Escherichia_phage	96.4	3.8e-312
WP_000344073.1|305530_305965_-|tail	phage tail assembly protein	tail	C9DGP9	Escherichia_phage	97.9	3.8e-71
WP_000918402.1|305974_306331_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	94.9	4.2e-60
WP_001280310.1|306340_307828_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	99.6	1.3e-280
WP_000979227.1|307824_308031_-	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	98.5	1.4e-28
WP_000888926.1|308014_308563_-	DUF1834 family protein	NA	C9DGP5	Escherichia_phage	99.5	1.9e-104
WP_001104973.1|308562_308988_-	DUF1320 family protein	NA	C9DGP4	Escherichia_phage	97.2	8.8e-73
WP_000017158.1|308984_309395_-	hypothetical protein	NA	C9DGP3	Escherichia_phage	98.5	6.1e-63
WP_000637410.1|309461_310379_-|head	Mu-like prophage major head subunit gpT family protein	head	C9DGP2	Escherichia_phage	99.3	5.2e-179
WP_000716025.1|310375_311461_-|protease	phage protease	protease	C9DGP0	Escherichia_phage	98.3	5.2e-194
WP_001350023.1|311657_312128_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	99.4	3.8e-85
WP_001136431.1|312124_313444_-|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	98.2	1.5e-248
WP_000532638.1|313424_314963_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	99.0	1.5e-295
WP_001097325.1|314962_316618_-	hypothetical protein	NA	C9DGN5	Escherichia_phage	97.8	0.0e+00
WP_000375394.1|316625_317201_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	100.0	9.1e-97
WP_000606409.1|317212_317503_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	100.0	7.4e-47
WP_000364295.1|317499_317799_-	DUF2730 family protein	NA	C9DGN2	Escherichia_phage	100.0	5.8e-47
WP_001001316.1|317798_317993_-	hypothetical protein	NA	C9DGN1	Escherichia_phage	100.0	6.2e-34
WP_001350022.1|318151_318538_-	hypothetical protein	NA	C9DGN0	Escherichia_phage	97.7	2.2e-62
WP_000907405.1|318521_319037_-	lysozyme	NA	C9DGM9	Escherichia_phage	99.4	1.9e-93
WP_001163387.1|319131_319554_-	positive regulator of late transcription	NA	C9DGM8	Escherichia_phage	99.3	2.2e-76
WP_000004161.1|319695_320058_-	hypothetical protein	NA	C9DGM6	Escherichia_phage	99.2	4.1e-63
WP_000515807.1|320050_320269_-	hypothetical protein	NA	C9DGM5	Escherichia_phage	100.0	5.6e-39
WP_000133853.1|320346_320736_-	hypothetical protein	NA	A0A0C4UR27	Shigella_phage	98.4	2.3e-67
WP_000091782.1|320732_321284_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	96.7	1.2e-98
WP_000431116.1|321354_321621_+	hypothetical protein	NA	Q38493	Escherichia_phage	98.9	2.3e-39
WP_001058561.1|321559_321862_-	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	99.0	1.4e-48
WP_000429765.1|321863_322046_-	hypothetical protein	NA	A0A0C4UR26	Shigella_phage	83.3	1.4e-24
WP_000465551.1|322032_322563_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	97.2	6.4e-97
WP_000227260.1|322562_323093_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	95.5	4.2e-96
WP_001107930.1|323191_323716_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	100.0	1.5e-90
WP_001372708.1|323735_324023_-	hypothetical protein	NA	C9DGL7	Escherichia_phage	100.0	2.5e-47
WP_001101152.1|324035_324455_-	hypothetical protein	NA	C9DGL6	Escherichia_phage	95.7	8.7e-73
WP_001151288.1|324469_324733_-	hypothetical protein	NA	A0A0C4UQU1	Shigella_phage	96.6	2.5e-38
WP_000968312.1|324977_325205_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	100.0	3.2e-37
WP_001026710.1|325220_326159_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	98.1	1.3e-169
WP_000424754.1|326197_328189_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	C9DGL1	Escherichia_phage	93.5	0.0e+00
WP_000337186.1|328190_328418_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	66.7	4.8e-17
>prophage 3
NC_017660	Escherichia coli KO11FL, complete sequence	5021812	550822	649642	5021812	protease,head,capsid,portal,transposase,tail,holin,integrase,lysis,terminase,tRNA,plate	Escherichia_virus(39.22%)	99	614176:614222	646854:646900
WP_000187020.1|550822_551923_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|551962_552322_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|552321_552972_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|553302_554703_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|554685_555603_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230082.1|555869_557243_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001302318.1|557303_558080_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|558087_559092_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|559245_560397_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_001005603.1|560748_563400_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556280.1|563582_565316_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274624.1|565464_566316_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323849.1|566302_566644_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204101.1|566645_567524_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184821.1|567489_569787_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|569837_570158_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|570172_571252_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174083.1|571560_574062_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|574073_574736_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|574746_575850_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647882.1|576124_576742_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001297632.1|576768_577674_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001297636.1|577767_579948_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007523.1|580276_581167_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|581515_583948_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001350061.1|583950_585111_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|585387_585705_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000399648.1|585952_586933_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000797341.1|587167_587776_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_050544538.1|588682_588955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015021.1|589007_593180_-	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
WP_000710769.1|593339_593552_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001350069.1|593754_595953_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|596108_597134_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068834.1|597225_598185_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|598277_598808_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293343.1|598817_600149_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|600215_601142_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|601234_601720_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|601804_602050_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|602474_603320_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|603342_604851_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|604986_605997_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796320.1|606093_606840_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|606844_607273_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|607299_607599_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155254.1|607810_608251_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|608351_608951_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|609058_609826_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708994.1|609880_610636_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045689.1|610742_611732_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|612051_613014_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|613194_614097_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
614176:614222	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|614333_614552_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882968.1|614633_615797_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	98.4	1.3e-206
WP_000978900.1|615796_616276_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	100.0	5.1e-85
WP_001283070.1|616290_618738_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	100.0	0.0e+00
WP_000785970.1|618730_618850_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|618882_619158_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|619214_619733_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286683.1|619745_620936_-|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	99.7	8.1e-225
WP_000014362.1|621255_622155_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	100.0	6.2e-169
WP_001164149.1|622370_622898_-|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	98.3	5.6e-93
WP_000104720.1|622901_624911_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	99.6	0.0e+00
WP_001285313.1|624921_625452_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	1.3e-102
WP_001121482.1|625444_626353_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_000127163.1|626357_626705_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093706.1|626701_627337_-|plate	phage baseplate assembly protein V	plate	Q7Y4D8	Escherichia_virus	100.0	2.4e-106
WP_001001780.1|627403_627856_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917179.1|627848_628316_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	100.0	3.0e-82
WP_001119512.1|628278_628437_-	hypothetical protein	NA	M1RZ27	Escherichia_phage	100.0	2.6e-22
WP_000040682.1|628423_628849_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	100.0	7.7e-69
WP_000736609.1|628836_629262_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.9	3.8e-60
WP_001144093.1|629276_629774_-	glycoside hydrolase family 104 protein	NA	Q7Y4E4	Escherichia_virus	100.0	6.2e-94
WP_000123124.1|629773_630055_-|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|630058_630262_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988649.1|630261_630771_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	7.3e-90
WP_000203449.1|630870_631614_-|terminase	terminase endonuclease subunit	terminase	Q94MF3	Enterobacteria_phage	99.6	2.3e-124
WP_001248591.1|631617_632691_-|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	100.0	8.7e-202
WP_001085948.1|632749_633604_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156872.1|633777_635550_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038147.1|635549_636584_+|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	100.0	2.4e-201
WP_000368931.1|636999_638073_+	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_001350076.1|638077_639103_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	3.3e-198
WP_001143634.1|639099_640038_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_014640573.1|640486_640939_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	6.1e-80
WP_000268589.1|640938_643224_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	99.9	0.0e+00
WP_000027664.1|643213_643489_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113263.1|643485_643710_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_001277905.1|643709_644012_-	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	100.0	3.5e-47
WP_000557702.1|644011_644236_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	100.0	6.1e-33
WP_000217679.1|644299_644800_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_001350035.1|644796_644994_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	96.9	8.0e-29
WP_000453534.1|644969_645242_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192857.1|645394_645688_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000023383.1|645757_646738_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4C5	Escherichia_virus	100.0	1.0e-185
WP_001223800.1|646923_647424_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
646854:646900	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|647573_648272_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|648268_649642_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 4
NC_017660	Escherichia coli KO11FL, complete sequence	5021812	1979287	1986427	5021812		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1979287_1979926_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1979922_1981185_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1981181_1982090_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1982285_1983053_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|1983103_1983760_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272898.1|1983865_1986427_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 5
NC_017660	Escherichia coli KO11FL, complete sequence	5021812	2061098	2068862	5021812	transposase,integrase	Escherichia_phage(66.67%)	6	2052333:2052346	2069172:2069185
2052333:2052346	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_085947771.1|2061098_2062260_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000577254.1|2062412_2064131_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_000214990.1|2064132_2065881_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|2065952_2066369_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|2066407_2067637_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000162574.1|2068379_2068862_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
2069172:2069185	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 6
NC_017660	Escherichia coli KO11FL, complete sequence	5021812	2188900	2197233	5021812	transposase	Escherichia_phage(66.67%)	7	NA	NA
WP_001349975.1|2188900_2190367_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	1.8e-88
WP_000138282.1|2190435_2192013_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755173.1|2192107_2192647_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_001295476.1|2192662_2193181_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000076001.1|2193491_2193683_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|2193700_2193853_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_001339197.1|2196024_2197233_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 7
NC_017660	Escherichia coli KO11FL, complete sequence	5021812	2569300	2578741	5021812		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569367.1|2569300_2570227_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	9.7e-24
WP_000783120.1|2570231_2570963_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2570943_2571051_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|2571110_2571842_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|2572063_2573749_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2573745_2574465_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|2574511_2574982_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|2575021_2575483_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001349936.1|2575607_2577608_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001349937.1|2577604_2578741_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 8
NC_017660	Escherichia coli KO11FL, complete sequence	5021812	2591252	2654586	5021812	head,capsid,portal,integrase,tail,holin,lysis,terminase,tRNA,plate	Escherichia_phage(41.67%)	75	2618495:2618522	2649502:2649529
WP_001295427.1|2591252_2593286_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|2593417_2594527_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|2594789_2595071_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|2595363_2595906_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|2595986_2596661_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945468.1|2596676_2599157_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405707.1|2599172_2600207_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|2600288_2600627_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134569.1|2600845_2601670_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|2601790_2602063_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195605.1|2602285_2603074_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|2603070_2603871_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001297420.1|2603935_2604754_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000434038.1|2604805_2605552_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|2605525_2606491_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846224.1|2606487_2607492_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858498.1|2607488_2608766_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129568.1|2609022_2610075_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|2610384_2611239_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853892.1|2611267_2612530_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|2612539_2612992_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|2613022_2613307_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490714.1|2613310_2614666_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|2614713_2615754_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|2615853_2616633_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|2616714_2617614_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001352710.1|2618019_2618337_+	hypothetical protein	NA	NA	NA	NA	NA
2618495:2618522	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|2618601_2619615_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|2619730_2620030_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|2620151_2620427_+	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|2620437_2620608_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217680.1|2620604_2621105_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_000557703.1|2621168_2621393_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277968.1|2621392_2621692_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	4.2e-45
WP_001113270.1|2621694_2621919_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027664.1|2621915_2622191_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268602.1|2622180_2624457_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_000744812.1|2625621_2627055_+	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	30.1	3.9e-40
WP_001350078.1|2627047_2627620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038162.1|2627678_2628707_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.2e-197
WP_000156872.1|2628706_2630479_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085948.1|2630652_2631507_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_001248584.1|2631565_2632639_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	7.4e-201
WP_000203430.1|2632642_2633386_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	96.0	2.3e-121
WP_001350080.1|2633485_2633995_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	2.1e-89
WP_000846399.1|2633994_2634198_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|2634201_2634483_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144178.1|2634482_2634980_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_000736570.1|2634994_2635420_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	2.9e-60
WP_000040687.1|2635407_2635833_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	8.0e-66
WP_072134039.1|2635804_2635978_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	6.8e-24
WP_000917165.1|2635940_2636408_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	3.3e-81
WP_001001782.1|2636400_2636853_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
WP_001093712.1|2636919_2637555_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	6.5e-112
WP_000127163.1|2637551_2637899_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121496.1|2637903_2638812_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.8e-161
WP_001285315.1|2638804_2639416_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.0	1.1e-116
WP_000216987.1|2639412_2640696_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	64.6	6.6e-156
WP_000805553.1|2640695_2641289_+|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	63.0	1.3e-58
WP_000049773.1|2641260_2641701_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	61.9	2.7e-48
WP_000905100.1|2642146_2642740_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
WP_001286686.1|2642799_2643990_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_001251408.1|2644002_2644521_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|2644577_2644853_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|2644885_2645005_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069967.1|2644997_2647445_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	98.8	0.0e+00
WP_000978889.1|2647459_2647939_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000882938.1|2647938_2649102_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000468308.1|2649182_2649401_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|2649673_2651035_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2649502:2649529	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|2651137_2651434_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|2651435_2651732_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|2651940_2652273_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137869.1|2652463_2653186_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000675150.1|2653182_2654586_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 9
NC_017660	Escherichia coli KO11FL, complete sequence	5021812	3141071	3211440	5021812	protease,capsid,portal,transposase,integrase,tail,lysis,terminase,head	Enterobacteria_phage(43.64%)	85	3161091:3161150	3180541:3181870
WP_001260855.1|3141071_3141893_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|3141992_3142076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|3142168_3142504_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|3142900_3144154_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019544.1|3144260_3145154_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|3145288_3146509_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|3146633_3147329_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071524606.1|3147281_3148574_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|3148732_3149347_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|3149389_3150244_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|3150245_3150863_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|3150873_3153297_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041685.1|3153357_3155784_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
WP_001295396.1|3155982_3156288_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|3156395_3157106_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|3157108_3157669_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|3157703_3158045_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|3158179_3158506_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|3158711_3159926_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836076.1|3159937_3160957_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	1.3e-16
WP_023352561.1|3161014_3161095_+	hypothetical protein	NA	NA	NA	NA	NA
3161091:3161150	attL	TCTGAGAGATCCCCTCATAATTTCCCCAAAGCGTAACCATGTGTGAATAAATTTTGAGCT	NA	NA	NA	NA
WP_001339197.1|3161104_3162313_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000876956.1|3162482_3163763_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	5.6e-155
WP_000005552.1|3163797_3164049_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048348.1|3164121_3166599_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083297.1|3166691_3166883_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|3166879_3167068_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171942.1|3167635_3167854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3168013_3168169_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|3168335_3168743_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|3168826_3169057_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705358.1|3169040_3169562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054512.1|3169542_3170508_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_001151262.1|3170548_3170971_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001310834.1|3170967_3171324_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_000589005.1|3172990_3174304_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|3174740_3175073_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|3175275_3175581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|3175605_3175845_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|3175844_3176132_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|3176203_3176359_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|3176575_3176827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|3176893_3177172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265199.1|3177173_3178223_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_001047135.1|3178236_3178989_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|3179266_3179356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087756.1|3179410_3179623_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|3179923_3180139_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_001339197.1|3180554_3181763_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000839590.1|3182230_3182446_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
3180541:3181870	attR	TCTGAGAGATCCCCTCATAATTTCCCCAAAGCGTAACCATGTGTGAATAAATTTTGAGCTAGTAGGGTTGCAGCCACGAGTAAGTCTTCCCTTGTTATTGTGTAGCCAGAATGCCGCAAAACTTCCATGCCTAAGCGAACTGTTGAGAGTACGTTTCGATTTCTGACTGTGTTAGCCTGGAAGTGCTTGTCCCAACCTTGTTTCTGAGCATGAACGCCCGCAAGCCAACATGTTAGTTGAAGCATCAGGGCGATTAGCAGCATGATATCAAAACGCTCTGAGCTGCTCGTTCGGCTATGGCGTAGGCCTAGTCCGTAGGCAGGACTTTTCAAGTCTCGGAAGGTTTCTTCAATCTGCATTCGCTTCGAATAGATATTAACAAGTTGTTTGGGTGTTCGAATTTCAACAGGTAAGTTAGTTGCTAGAACCCATGGCTCCTTTGCCGACGCTGAGTAGATTTTAGGTGACGGGTGGTGACAATGAGTCCGTGTCGAGCGCTGATTTTTTCGGCCTTTAGAGCGAGATTTATACAATAGAATTTGGCATGAGATTGGATTGCTTTTAGTCAGCCTCTTATAGCCTAAAGTCTTTGAGTGACTAGATGACATATCATGTAAGTTGCTGATAGGTTTCCAGTTTTCCGCTCCTAGGTCTGCATATTGTACTTTTCCTCTTACTCGACTTAACCAGTACCAACCCAGCTTCTCAACGGATTTATACCATGGCACTTTAAAGCCAGCATCACTGACAATGAGCGGTGTGGTGTTACTCGGTAGAATGCTCGCAAGGTCGGCTAGAAATTGGTCATGAGCTTTCTTTGAACATTGCTCTGAAAGCGGGAACGCTTTCTCATAAAGAGTAACAGAACGACCGTGTAGTGCGACTGAAGCTCGCAATACCATAAGTCGTTTTTGCTCACGAATATCAGACCAGTCAACAAGTACAATGGGCATCGTATTGCCCGAACAGATAAAGCTAGCATGCCAACGGTATACAGCGAGTCGCTCTTTGTGGAGGTGACGATTACCTAACAATCGGTCGATTCGTTTGATGTTATGTTTTGTTCTCGCTTTGGTTGGCAGGTTACGGCCAAGTTCGGTAAGAGTGAGAGTTTTACAGTCAAGTAATGCGTGGCAAGCCAACGTTAAGCTGTTGAGTCGTTTTAAGTGTAATTCGGGGCAGAATTGGTAAAGAGAGTCGTGTAAAATATCGAGTTCGCACATCTTGTTGTCTGATTATTGATTTTTCGCGAAACCATTTGATCATATGACAAGATGTGTATCCACCTTAACTTAATGATTTTTACCAAAATCATTAGGGGATTCATCAG	NA	NA	NA	NA
WP_000189916.1|3182450_3182762_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|3182758_3183292_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|3183288_3183786_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|3184148_3184361_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|3184371_3184560_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|3184562_3184628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|3184707_3184863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|3185034_3185208_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|3185359_3185770_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|3185827_3186061_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453611.1|3186449_3186995_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001027259.1|3186969_3188895_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|3188891_3189098_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001349919.1|3189094_3190696_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
WP_000123305.1|3190676_3191996_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
WP_001295978.1|3192005_3192338_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063280.1|3192393_3193419_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158921.1|3193460_3193859_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	4.5e-63
WP_000753007.1|3193870_3194224_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000985119.1|3194235_3194814_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683105.1|3194810_3195206_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|3195213_3195954_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479150.1|3195969_3196392_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	1.3e-71
WP_000459457.1|3196373_3196808_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840335.1|3196800_3199362_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.3	0.0e+00
WP_000847360.1|3199358_3199688_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	9.6e-59
WP_001152622.1|3199687_3200386_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
WP_001349921.1|3200391_3201135_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	6.8e-145
WP_000090891.1|3201071_3201704_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000033679.1|3201764_3205178_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_001233072.1|3205248_3205848_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	9.7e-110
WP_000279140.1|3205912_3208987_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_000885611.1|3208986_3209562_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_077631333.1|3209659_3210133_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.6	9.6e-20
WP_001339197.1|3210231_3211440_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 10
NC_017660	Escherichia coli KO11FL, complete sequence	5021812	3276562	3370181	5021812	transposase,tail,holin,terminase,plate	Escherichia_phage(63.64%)	82	NA	NA
WP_001339197.1|3276562_3277771_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_014640612.1|3277767_3279183_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	9.0e-29
WP_000803659.1|3279239_3279458_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|3279489_3279873_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|3279892_3280327_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|3280538_3281204_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000210799.1|3281228_3282419_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000366463.1|3283760_3284642_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296740.1|3284742_3286131_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000257409.1|3286194_3287121_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191027.1|3287120_3287480_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000558032.1|3287618_3289037_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_000854624.1|3289263_3290715_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_001313828.1|3290921_3291836_+	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
WP_001286555.1|3291839_3292598_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558520.1|3292654_3292945_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774183.1|3292968_3293844_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000172479.1|3293870_3294893_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_001222721.1|3294904_3295897_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911148.1|3295896_3296925_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001194884.1|3296918_3298454_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
WP_000154340.1|3298702_3299656_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113145.1|3299734_3301327_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001339197.1|3301875_3303084_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001349923.1|3303195_3308616_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.1	3.6e-142
WP_001296726.1|3308824_3309091_+	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001125454.1|3309090_3310413_+	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001296758.1|3311364_3311928_+	type 1 fimbrial major subunit FimA	NA	NA	NA	NA	NA
WP_001195166.1|3312288_3312999_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001349924.1|3313040_3315692_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000876770.1|3315705_3316236_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000825458.1|3316248_3316752_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000520679.1|3316811_3317726_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000726699.1|3318059_3320339_+	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_000543389.1|3320586_3320784_+	two-component system connector SafA	NA	NA	NA	NA	NA
WP_000060493.1|3320858_3321620_+	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
WP_001325798.1|3325030_3325360_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|3325364_3325550_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900978.1|3325546_3328186_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|3328393_3329383_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_014640614.1|3329493_3329916_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|3329912_3330179_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628153.1|3330452_3333977_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837906.1|3334343_3335477_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	57.7	2.3e-115
WP_001082294.1|3335617_3336052_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000701877.1|3336591_3337164_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.3	1.8e-76
WP_000117760.1|3337178_3340319_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	71.2	0.0e+00
WP_000902859.1|3340342_3340888_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	76.4	3.8e-76
WP_000600270.1|3340890_3342444_-	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	79.2	4.6e-228
WP_001199732.1|3342440_3343067_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.0	2.2e-120
WP_001349878.1|3343050_3344277_-|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	98.8	5.8e-226
WP_000733802.1|3344298_3344838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261334.1|3345228_3345576_-	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	94.8	4.1e-60
WP_000063616.1|3346272_3346986_-|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	96.6	1.8e-126
WP_001271172.1|3346985_3347993_-	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	96.1	1.2e-189
WP_000209259.1|3347992_3348259_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	94.3	2.7e-43
WP_000056323.1|3348255_3348924_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	98.6	4.3e-122
WP_000016439.1|3348927_3350916_-	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	94.4	0.0e+00
WP_000703979.1|3350979_3351597_-	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	98.0	4.2e-108
WP_000613371.1|3351593_3352025_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	2.8e-74
WP_000506600.1|3352048_3353386_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.2	1.0e-244
WP_001139506.1|3353385_3354330_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.4	2.2e-172
WP_000762302.1|3354316_3354757_-	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	98.6	2.2e-82
WP_000175376.1|3354753_3355194_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000780861.1|3355193_3355664_-	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	100.0	2.5e-84
WP_001272365.1|3355721_3356750_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.4	3.3e-190
WP_001349881.1|3356764_3357382_-	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	100.0	5.9e-118
WP_000059667.1|3357374_3358697_-	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.2	6.8e-188
WP_001018386.1|3358677_3359511_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.8	1.2e-153
WP_000807710.1|3359455_3360892_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	95.8	5.2e-266
WP_000089432.1|3362229_3363321_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	92.1	1.0e-144
WP_001307172.1|3363324_3363576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204039.1|3363511_3364444_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	7.1e-83
WP_001291099.1|3364436_3365225_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	41.1	2.5e-49
WP_133301706.1|3365629_3365812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014545.1|3365826_3366204_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	3.0e-64
WP_000950573.1|3366206_3366482_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	5.5e-44
WP_001349882.1|3366471_3366864_-|holin	holin	holin	Q8W636	Enterobacteria_phage	96.2	8.4e-54
WP_000640164.1|3368134_3368671_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.3e-68
WP_000228041.1|3368667_3368958_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	4.3e-47
WP_000940320.1|3368957_3369557_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000813259.1|3370025_3370181_-	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	96.1	5.5e-17
>prophage 11
NC_017660	Escherichia coli KO11FL, complete sequence	5021812	3374198	3390886	5021812	tRNA	Escherichia_phage(75.0%)	21	NA	NA
WP_001151237.1|3374198_3374621_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	7.4e-64
WP_000450660.1|3374636_3375398_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
WP_000788973.1|3375420_3376167_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000899746.1|3376173_3377031_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693802.1|3377043_3377466_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_001072342.1|3377462_3377717_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|3377796_3378216_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001169153.1|3378646_3378799_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000560220.1|3379219_3379441_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_001349883.1|3379440_3379611_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	6.7e-24
WP_001349884.1|3379685_3379961_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	6.3e-40
WP_000105152.1|3380062_3382663_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.8e-248
WP_000166319.1|3382655_3383465_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|3383521_3383716_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|3383708_3383918_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|3383996_3384212_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|3384213_3385449_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157422.1|3385500_3386436_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	4.5e-146
WP_000123740.1|3386564_3387938_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|3388415_3389399_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001307164.1|3389653_3390886_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 12
NC_017660	Escherichia coli KO11FL, complete sequence	5021812	3793973	3880696	5021812	transposase,tRNA	Bluetongue_virus(35.29%)	48	NA	NA
WP_000117881.1|3793973_3795374_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|3795975_3797064_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|3797248_3798439_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109487.1|3798660_3799308_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3799334_3799883_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925997.1|3800063_3801911_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572635.1|3802171_3806632_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|3806631_3807336_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|3807316_3808639_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001298300.1|3808635_3809421_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899599.1|3809556_3810336_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|3810312_3811206_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011590.1|3811359_3812106_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3812102_3812285_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056498.1|3812336_3813569_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570540.1|3813605_3814592_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|3814588_3816337_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705706.1|3816373_3818638_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3818844_3819129_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3819288_3820962_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3821072_3821756_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001349951.1|3821928_3822693_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000445231.1|3822861_3824145_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057149.1|3824215_3825304_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642849.1|3825502_3826195_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001297197.1|3826324_3828085_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_001339197.1|3828215_3829424_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000642546.1|3829828_3830686_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_000122735.1|3831247_3832954_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3833013_3834165_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3834640_3835300_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3839295_3840504_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3841295_3843002_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3843061_3844213_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3844688_3845348_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3849343_3850552_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3851343_3853050_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3853109_3854261_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3854736_3855396_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3859391_3860600_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3861391_3863098_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3863157_3864309_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3864784_3865444_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3869439_3870648_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3871439_3873146_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3873205_3874357_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3874832_3875492_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3879487_3880696_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 13
NC_017660	Escherichia coli KO11FL, complete sequence	5021812	3889535	4021368	5021812	transposase	Bluetongue_virus(51.85%)	53	NA	NA
WP_001339197.1|3889535_3890744_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3891535_3893242_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3893301_3894453_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3894928_3895588_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3899583_3900792_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3901583_3903290_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3903349_3904501_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3904976_3905636_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3909631_3910840_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3911631_3913338_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3913397_3914549_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3915024_3915684_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3919679_3920888_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3921679_3923386_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3923445_3924597_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3925072_3925732_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3929727_3930936_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3931727_3933434_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3933493_3934645_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3935120_3935780_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3939775_3940984_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3941775_3943482_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3943541_3944693_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3945168_3945828_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3949823_3951032_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3951823_3953530_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3953589_3954741_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3955216_3955876_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3959871_3961080_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3961871_3963578_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3963637_3964789_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3965264_3965924_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3969919_3971128_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3971919_3973626_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3973685_3974837_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3975312_3975972_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3979967_3981176_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3981967_3983674_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3983733_3984885_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3985360_3986020_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|3990015_3991224_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|3992015_3993722_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|3993781_3994933_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|3995408_3996068_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|4000063_4001272_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|4002063_4003770_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|4003829_4004981_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|4005456_4006116_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|4010111_4011320_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000122735.1|4012111_4013818_+	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_000168720.1|4013877_4015029_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000412211.1|4015504_4016164_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001339197.1|4020159_4021368_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 14
NC_017660	Escherichia coli KO11FL, complete sequence	5021812	4039093	4128373	5021812	protease,head,capsid,portal,tail,integrase,lysis,terminase,tRNA,plate	Salmonella_phage(58.62%)	91	4117649:4117666	4135726:4135743
WP_000886683.1|4039093_4040386_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067740.1|4040476_4041820_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_001295343.1|4041830_4042442_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077017.1|4042596_4046664_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	9.3e-87
WP_000228473.1|4046798_4047293_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|4047837_4048803_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|4048925_4050692_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|4050692_4052414_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241670.1|4052455_4053160_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4053444_4053663_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934053.1|4054347_4056624_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|4056654_4056975_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|4057297_4057522_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188194.1|4057594_4059541_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|4059537_4060653_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001400542.1|4060803_4061760_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|4061756_4063415_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|4063840_4064536_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|4065030_4065930_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|4066073_4067726_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|4067737_4068706_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815350.1|4068838_4070557_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000566372.1|4070593_4071595_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136525.1|4071605_4073036_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|4073134_4074148_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|4074144_4074975_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|4074971_4075295_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000027201.1|4076153_4076882_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	1.3e-28
WP_000756569.1|4076899_4077631_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|4077637_4078354_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|4078353_4079022_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|4079313_4080045_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_001149734.1|4080219_4081347_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
WP_000389260.1|4081387_4081876_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|4081935_4082781_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|4082777_4083731_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996018.1|4083740_4084874_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126084.1|4084968_4086081_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|4086431_4086908_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|4086995_4087898_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189121.1|4087958_4088681_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|4088664_4088952_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|4089111_4089369_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|4089398_4089776_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001024876.1|4090045_4091731_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|4091966_4092185_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011811.1|4092275_4093376_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.2	2.5e-175
WP_000980390.1|4093372_4093858_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.3e-67
WP_001282753.1|4093854_4096932_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000763311.1|4096924_4097044_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|4097058_4097361_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207659.1|4097415_4097931_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_000046154.1|4097940_4099113_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_000905033.1|4099255_4099822_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_001145387.1|4099852_4100356_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	60.0	4.7e-49
WP_000378634.1|4100355_4100961_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.4	1.9e-97
WP_000104786.1|4102373_4103765_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	77.9	5.1e-162
WP_001086814.1|4103761_4104367_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	7.5e-110
WP_000268312.1|4104359_4105268_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	2.3e-142
WP_000177597.1|4105254_4105614_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000993765.1|4105610_4106189_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	4.7e-93
WP_000339827.1|4106311_4107181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829153.1|4107236_4107683_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	80.3	1.9e-57
WP_001039935.1|4107675_4108107_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_001080936.1|4108202_4108631_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.0	4.6e-45
WP_000727853.1|4108627_4109005_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001069915.1|4109006_4109519_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	1.8e-88
WP_000171568.1|4109499_4109715_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868174.1|4109718_4109922_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	3.0e-31
WP_000673523.1|4109921_4110386_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000059191.1|4110481_4111132_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742510.1|4111135_4112194_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000216237.1|4112210_4113044_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_001098438.1|4113186_4114953_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000520345.1|4114952_4115978_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.2	1.9e-169
WP_000818977.1|4116018_4117800_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
4117649:4117666	attL	TATTTTTTTTGAATGGAT	NA	NA	NA	NA
WP_001059831.1|4118332_4118668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|4118860_4119094_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|4119104_4119293_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_000017523.1|4119445_4121860_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.1	0.0e+00
WP_000104176.1|4121856_4122714_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.1	5.2e-157
WP_000752613.1|4122710_4122938_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244226.1|4122937_4123171_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000963473.1|4123238_4123580_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000934004.1|4123661_4123910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956172.1|4123995_4124292_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460867.1|4124299_4124809_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	86.4	1.0e-75
WP_001069047.1|4124874_4125078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350049.1|4125224_4125788_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.2	4.8e-34
WP_000350737.1|4125788_4127240_+	NTPase KAP	NA	R9TRQ8	Vibrio_phage	29.7	1.8e-45
WP_000290919.1|4127320_4128373_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.8	2.1e-107
4135726:4135743	attR	ATCCATTCAAAAAAAATA	NA	NA	NA	NA
