The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017027	Pasteurella multocida subsp. multocida str. HN06, complete sequence	2402218	39829	49964	2402218	integrase	Mannheimia_phage(18.18%)	17	33491:33506	54923:54938
33491:33506	attL	AAAAGTGCGGTGAGTT	NA	NA	NA	NA
WP_014390695.1|39829_41002_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	53.1	2.0e-111
WP_014390696.1|41377_41833_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	47.1	4.6e-27
WP_014390697.1|41877_42231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390698.1|42239_42728_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	40.8	1.8e-21
WP_014390699.1|42768_43671_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	47.5	2.2e-65
WP_014390700.1|43673_44057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390701.1|44135_44447_-	hypothetical protein	NA	X2CY11	Brucella_phage	43.4	7.3e-08
WP_014390702.1|44446_44968_-	MazG-like family protein	NA	Q708P2	Streptococcus_phage	35.1	2.6e-18
WP_014390703.1|45034_45487_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	54.6	8.9e-39
WP_014390704.1|45497_46199_-	ERF family protein	NA	A0A0A7RVW0	Clostridium_phage	42.6	1.2e-18
WP_014390705.1|46241_46892_-	ribonuclease H-like domain-containing protein	NA	X2CYL5	Brucella_phage	35.6	1.5e-23
WP_014390707.1|47064_47226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390708.1|47239_47476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390709.1|47447_47747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390710.1|47813_48125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390711.1|48186_48843_-	Bro-N domain-containing protein	NA	Q7Y5V4	Haemophilus_phage	67.5	2.0e-39
WP_014390712.1|49127_49964_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	51.4	1.3e-72
54923:54938	attR	AAAAGTGCGGTGAGTT	NA	NA	NA	NA
>prophage 2
NC_017027	Pasteurella multocida subsp. multocida str. HN06, complete sequence	2402218	53550	81788	2402218	terminase,tail	Mannheimia_phage(61.76%)	42	NA	NA
WP_014390718.1|53550_54228_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	29.8	3.2e-24
WP_014390719.1|54351_54549_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014390720.1|54598_55051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390721.1|55102_55786_+	phage antirepressor KilAC domain-containing protein	NA	D0UIL6	Aggregatibacter_phage	67.9	9.5e-77
WP_014390722.1|55782_56136_+	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_014390723.1|56137_57037_+	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.8	2.1e-31
WP_014390724.1|57036_57732_+	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.4	1.7e-33
WP_014390725.1|57724_58255_+	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	81.7	3.2e-88
WP_014390726.1|58263_58701_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	73.1	1.7e-58
WP_014390727.1|58860_59076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390728.1|59068_59671_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
WP_014390729.1|59670_60036_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	28.2	2.6e-09
WP_014390730.1|60111_60687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390731.1|60974_61592_+	KilA-N domain-containing protein	NA	S5FM84	Shigella_phage	42.6	1.3e-13
WP_157808540.1|61755_62031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390733.1|62393_62690_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	71.4	8.4e-14
WP_041423051.1|62686_63217_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	7.4e-45
WP_014667795.1|63189_63513_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_014390736.1|63734_64169_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
WP_016533497.1|64197_64380_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	3.8e-09
WP_014390737.1|64462_64960_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	70.7	7.4e-47
WP_014390738.1|64943_66170_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	77.0	2.1e-191
WP_014390739.1|66184_67630_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	56.5	1.0e-144
WP_014390740.1|67583_68555_+	hypothetical protein	NA	F1C5D8	Cronobacter_phage	41.0	1.6e-53
WP_014390741.1|68569_69916_+	DUF2213 domain-containing protein	NA	A0A0M3LQ78	Mannheimia_phage	57.2	2.6e-126
WP_014390742.1|69915_70350_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	75.0	1.1e-54
WP_014390743.1|70361_71360_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	74.4	1.6e-144
WP_014390744.1|71370_71667_+	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	73.9	3.2e-13
WP_014390745.1|71647_72016_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	42.1	4.7e-22
WP_014390746.1|72018_72363_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	57.9	3.0e-31
WP_014390747.1|72367_72739_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	51.2	1.3e-24
WP_014390748.1|72735_73107_+	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	39.0	1.4e-18
WP_014390749.1|73118_73601_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	62.0	2.0e-44
WP_014390750.1|73654_74326_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	42.4	2.6e-42
WP_014390751.1|74402_74759_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_014390752.1|74834_75653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390754.1|75991_76816_+	phage antirepressor N-terminal domain-containing protein	NA	A0A0M3LR56	Mannheimia_phage	70.5	6.1e-46
WP_014390755.1|76867_79312_+|tail	phage tail length tape measure family protein	tail	A0A0M3LS54	Mannheimia_phage	48.5	1.1e-156
WP_014390756.1|79314_79644_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	37.1	3.2e-14
WP_014390758.1|79772_80477_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	63.9	1.0e-81
WP_041423052.1|80481_81225_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	59.2	3.7e-82
WP_014667799.1|81167_81788_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.1e-52
>prophage 3
NC_017027	Pasteurella multocida subsp. multocida str. HN06, complete sequence	2402218	747629	752835	2402218		Escherichia_phage(50.0%)	9	NA	NA
WP_014391088.1|747629_748154_-	phage antirepressor N-terminal domain-containing protein	NA	A0A0N7KZV8	Escherichia_phage	47.0	3.2e-24
WP_016534521.1|748527_748743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391089.1|748732_749026_-	hypothetical protein	NA	Q7Y5V9	Haemophilus_phage	52.7	1.5e-18
WP_014391090.1|749025_749730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391091.1|749668_750070_-	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	43.7	2.9e-17
WP_014391093.1|750300_750528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391094.1|750596_750803_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	51.6	5.5e-12
WP_014391095.1|750939_751575_+	hypothetical protein	NA	G9L676	Escherichia_phage	44.8	2.1e-41
WP_014391096.1|751689_752835_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	27.7	2.6e-18
>prophage 4
NC_017027	Pasteurella multocida subsp. multocida str. HN06, complete sequence	2402218	1141031	1150390	2402218		Sinorhizobium_phage(16.67%)	9	NA	NA
WP_014391290.1|1141031_1142306_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.4e-92
WP_005753554.1|1142346_1142964_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_005724298.1|1142963_1143851_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005724296.1|1143920_1144868_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.7	1.9e-43
WP_005756079.1|1144943_1146497_-	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
WP_010906540.1|1146731_1147523_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	4.4e-17
WP_005724066.1|1147531_1148317_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_014391292.1|1148394_1149375_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.3e-15
WP_005724063.1|1149391_1150390_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
>prophage 5
NC_017027	Pasteurella multocida subsp. multocida str. HN06, complete sequence	2402218	1482396	1524795	2402218	integrase,terminase,tail,portal,protease	Mannheimia_phage(27.27%)	59	1483549:1483599	1525541:1525591
WP_014391440.1|1482396_1483251_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.3	8.3e-30
1483549:1483599	attL	CTTCTAAGCCGTAGGTCATTGGTTCGAATCCAATAGGGCGTGCCATTAATT	NA	NA	NA	NA
WP_014391441.1|1483625_1484681_-|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	37.9	1.6e-62
WP_075271365.1|1484584_1484887_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014391442.1|1485070_1485793_-	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	52.5	3.3e-35
WP_014391443.1|1485803_1486025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391444.1|1486283_1486640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391445.1|1486648_1487146_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_014391447.1|1487280_1487880_-	hypothetical protein	NA	A0A218KC93	Bacillus_phage	37.6	4.6e-19
WP_014391448.1|1487930_1488719_-	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
WP_014391449.1|1488790_1489144_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	33.7	2.2e-05
WP_014391450.1|1489216_1489669_-	single-stranded DNA-binding protein	NA	A0A2I7RNY1	Vibrio_phage	62.1	1.7e-37
WP_014391451.1|1490315_1491269_-	recombinase RecT	NA	A0A0M3LNU3	Mannheimia_phage	72.8	1.2e-122
WP_014391452.1|1491270_1491558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041423119.1|1491570_1491807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391453.1|1491778_1492078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390710.1|1492144_1492456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391454.1|1492517_1493126_-	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	57.9	3.8e-29
WP_014391455.1|1493505_1494039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391456.1|1494128_1494392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391457.1|1494575_1494848_+	hypothetical protein	NA	A0A0M3LS55	Mannheimia_phage	78.9	5.5e-36
WP_014391458.1|1494840_1495029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391459.1|1495325_1495520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391460.1|1495500_1495671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391461.1|1495683_1495914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391463.1|1496913_1497309_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	77.8	2.2e-57
WP_014391464.1|1497358_1498045_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.4	4.6e-71
WP_014391465.1|1498172_1498382_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	9.5e-12
WP_014391466.1|1498430_1498883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391467.1|1498940_1499201_+	Rha family transcriptional regulator	NA	D0UIL6	Aggregatibacter_phage	65.3	3.5e-16
WP_014391468.1|1499197_1500010_+	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	28.9	1.0e-13
WP_014391469.1|1500006_1500699_+	replication protein P	NA	I6PBN0	Cronobacter_phage	32.7	1.6e-18
WP_014391470.1|1500702_1501239_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
WP_014391471.1|1501228_1501687_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	3.4e-38
WP_014391472.1|1501760_1501976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391473.1|1501968_1502571_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	38.2	4.8e-32
WP_014391474.1|1502572_1503034_+	antitermination protein	NA	NA	NA	NA	NA
WP_014391475.1|1503360_1503621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041423122.1|1503617_1504148_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	48.0	4.7e-39
WP_079157976.1|1504120_1504444_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_014391478.1|1504653_1505022_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005720780.1|1505057_1505318_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014391479.1|1505607_1506081_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	58.7	1.7e-40
WP_014391480.1|1506084_1508193_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	66.8	2.5e-269
WP_014391481.1|1508189_1508411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041423124.1|1508407_1509946_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	56.2	6.7e-155
WP_014391483.1|1509881_1511888_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	53.1	8.4e-190
WP_005719720.1|1511959_1512286_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	38.9	4.6e-13
WP_014391484.1|1512278_1512572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391485.1|1512571_1513123_+|tail	phage tail protein	tail	K7PKQ5	Enterobacteria_phage	44.5	2.1e-26
WP_014391486.1|1513119_1513527_+|tail	tail protein	tail	NA	NA	NA	NA
WP_014391487.1|1513523_1514033_+|tail	tail fiber protein	tail	K7P6G8	Enterobacteria_phage	52.4	3.1e-40
WP_014391488.1|1514035_1514425_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_079157780.1|1514487_1514748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391490.1|1514734_1517128_+|tail	phage tail length tape measure family protein	tail	H6WRV7	Salmonella_phage	29.5	1.1e-23
WP_014391491.1|1517127_1517475_+|tail	phage tail protein	tail	I6RSL7	Salmonella_phage	39.6	4.0e-15
WP_014391492.1|1517763_1518477_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	64.4	2.1e-82
WP_041423126.1|1518481_1519225_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	59.2	2.8e-82
WP_014667799.1|1519167_1519788_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.1e-52
WP_014391494.1|1519791_1524795_+	DUF1983 domain-containing protein	NA	A0A0M3LQ61	Mannheimia_phage	38.6	3.6e-250
1525541:1525591	attR	CTTCTAAGCCGTAGGTCATTGGTTCGAATCCAATAGGGCGTGCCATTAATT	NA	NA	NA	NA
>prophage 6
NC_017027	Pasteurella multocida subsp. multocida str. HN06, complete sequence	2402218	2173000	2223171	2402218	terminase,tail,capsid,integrase	Mannheimia_phage(50.98%)	69	2172910:2172962	2228952:2229004
2172910:2172962	attL	GGTCTCCAAAACCGGGTGTTGGGAGTTCGAGCCTCTCCGCCCCTGCCATTATT	NA	NA	NA	NA
WP_041423178.1|2173000_2174089_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	38.4	3.3e-63
WP_015691046.1|2174422_2174893_-	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	44.4	1.2e-22
WP_015691047.1|2174896_2175193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391442.1|2175248_2175971_-	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	52.5	3.3e-35
WP_014391443.1|2175981_2176203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015691048.1|2176447_2177356_-	P63C domain-containing protein	NA	A0A0M4S6X1	Salmonella_phage	36.1	2.5e-40
WP_015691049.1|2177459_2177816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015691050.1|2177824_2178313_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	41.2	4.0e-21
WP_015691051.1|2178353_2179256_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	47.5	2.2e-65
WP_015691052.1|2179393_2179843_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	55.3	2.3e-39
WP_041423209.1|2179842_2180502_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	75.3	5.2e-96
WP_014391451.1|2180488_2181442_-	recombinase RecT	NA	A0A0M3LNU3	Mannheimia_phage	72.8	1.2e-122
WP_014391452.1|2181443_2181731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041423119.1|2181743_2181980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391453.1|2181951_2182251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390710.1|2182317_2182629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691055.1|2182737_2183562_-	NYN domain-containing protein	NA	A0A0R6PGY5	Moraxella_phage	38.7	3.5e-33
WP_014390715.1|2183900_2184128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041423181.1|2184631_2185156_-	DUF2730 family protein	NA	A0A0M3LP99	Mannheimia_phage	60.4	1.3e-22
WP_014391463.1|2185127_2185523_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	77.8	2.2e-57
WP_014391464.1|2185572_2186259_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.4	4.6e-71
WP_014391465.1|2186386_2186596_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	9.5e-12
WP_014391466.1|2186644_2187097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391467.1|2187154_2187415_+	Rha family transcriptional regulator	NA	D0UIL6	Aggregatibacter_phage	65.3	3.5e-16
WP_015691057.1|2187499_2188318_+	hypothetical protein	NA	Q7Y5W1	Haemophilus_phage	58.2	5.6e-76
WP_015691058.1|2188314_2189679_+	AAA family ATPase	NA	A0A0M3LQC0	Mannheimia_phage	51.7	2.0e-126
WP_015691059.1|2189675_2190044_+	site-specific DNA-methyltransferase (adenine-specific)	NA	A0A0M3LPV8	Mannheimia_phage	87.4	5.3e-50
WP_015691060.1|2190053_2190404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691061.1|2190425_2190932_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	82.7	9.8e-79
WP_015691062.1|2191016_2191667_+	metallophosphoesterase	NA	K7P7V3	Enterobacteria_phage	55.3	1.4e-64
WP_015691063.1|2191740_2191953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691064.1|2192040_2192643_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	37.3	1.4e-31
WP_015691065.1|2192642_2193008_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	28.2	2.6e-09
WP_015691066.1|2193216_2193432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390733.1|2193809_2194106_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	71.4	8.4e-14
WP_041423051.1|2194102_2194633_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	7.4e-45
WP_014667795.1|2194605_2194929_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_014390736.1|2195150_2195585_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
WP_016533497.1|2195613_2195796_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	3.8e-09
WP_014390737.1|2195878_2196376_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	70.7	7.4e-47
WP_015691067.1|2196359_2197595_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LPI9	Mannheimia_phage	75.6	1.8e-190
WP_015691068.1|2197604_2199008_+	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	59.8	2.2e-152
WP_015691069.1|2198997_2200599_+|capsid	minor capsid protein	capsid	A0A0M3LQ07	Mannheimia_phage	52.1	2.5e-152
WP_015691070.1|2200601_2200820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691071.1|2200794_2201229_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	D0UIJ3	Aggregatibacter_phage	61.2	3.1e-41
WP_015691072.1|2201268_2201436_+	hypothetical protein	NA	A0A1L2C977	Pseudomonas_phage	51.0	1.2e-06
WP_015691073.1|2201564_2202335_+	hypothetical protein	NA	A0A1V0DY60	Dinoroseobacter_phage	36.2	1.5e-25
WP_015691074.1|2202352_2203510_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	43.3	8.3e-81
WP_015691075.1|2203566_2203803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691076.1|2203819_2204287_+	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	55.7	1.4e-34
WP_015691077.1|2204288_2204663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691078.1|2204664_2205066_+	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.4	2.1e-39
WP_015691079.1|2205065_2205458_+	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	46.2	5.5e-29
WP_015691080.1|2205470_2206487_+	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	73.1	4.0e-140
WP_005756587.1|2206560_2206965_+	hypothetical protein	NA	A0A0M3LPJ3	Mannheimia_phage	56.7	3.7e-36
WP_015691081.1|2206973_2207303_+	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	62.5	4.6e-29
WP_015691082.1|2207310_2207637_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	37.6	1.2e-16
WP_015691083.1|2207654_2210903_+	tape measure protein	NA	A0A0M3LS69	Mannheimia_phage	35.4	3.8e-91
WP_015691084.1|2210899_2211604_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	62.8	1.0e-81
WP_041423184.1|2211606_2212347_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	59.6	4.3e-83
WP_014667799.1|2212289_2212910_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.1e-52
WP_015691086.1|2212913_2217026_+|tail	phage tail protein	tail	A0A0M3LQG1	Mannheimia_phage	40.2	8.7e-234
WP_014390761.1|2217073_2217397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080574119.1|2217566_2218112_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_041423185.1|2218131_2219817_-	AlwI family type II restriction endonuclease	NA	A0A2K5B262	Erysipelothrix_phage	25.3	4.5e-19
WP_015691090.1|2219830_2220682_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	M4QMR9	Micromonas_pusilla_virus	39.9	9.1e-53
WP_015691091.1|2220685_2220892_-	helix-turn-helix domain-containing protein	NA	A0A2I7SC34	Paenibacillus_phage	40.7	1.7e-05
WP_015691092.1|2220978_2221386_-	DUF1870 family protein	NA	H9C180	Pectobacterium_phage	38.9	1.6e-10
WP_015691093.1|2221674_2223171_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	50.3	3.1e-56
2228952:2229004	attR	GGTCTCCAAAACCGGGTGTTGGGAGTTCGAGCCTCTCCGCCCCTGCCATTATT	NA	NA	NA	NA
