The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017047	Rahnella aquatilis HX2, complete sequence	4962173	650909	757788	4962173	plate,lysis,tail,tRNA,transposase	Erwinia_phage(25.0%)	91	NA	NA
WP_013576736.1|650909_652232_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_013573984.1|652354_653926_-	galactarate dehydratase	NA	NA	NA	NA	NA
WP_015689387.1|654477_655821_+	MFS transporter	NA	NA	NA	NA	NA
WP_013573986.1|655881_656652_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_013573987.1|656689_657574_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_013573988.1|657694_658834_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.5	6.9e-48
WP_015689388.1|658951_660259_+	amino acid deaminase	NA	NA	NA	NA	NA
WP_013573990.1|660306_663057_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.2	4.1e-54
WP_013573991.1|663120_664491_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.2	3.9e-37
WP_013573992.1|664500_666738_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_013573993.1|666816_667620_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_013573994.1|667968_669606_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	7.9e-154
WP_013573995.1|669681_670986_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.1	1.1e-126
WP_013575039.1|671107_672430_+|transposase	IS4-like element IS1271 family transposase	transposase	NA	NA	NA	NA
WP_173362080.1|672497_673298_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_013573998.1|673502_675056_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_173362081.1|675064_675751_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_013574000.1|675852_676524_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	35.8	1.2e-12
WP_013574001.1|676537_676897_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_013574002.1|677066_678071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013574003.1|678416_680219_+	NADPH-dependent assimilatory sulfite reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_013574004.1|680246_681983_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_013574005.1|682007_682745_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_013574006.1|682904_683942_-	aminopeptidase	NA	NA	NA	NA	NA
WP_013574007.1|684193_685618_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_013574008.1|685628_686537_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_013574009.1|686550_687978_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	4.6e-33
WP_013574010.1|687979_688603_+	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	39.1	1.1e-07
WP_173362082.1|688737_689043_+	DUF3561 family protein	NA	NA	NA	NA	NA
WP_013574012.1|689210_689531_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_013574013.1|689533_690253_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013574014.1|690252_690726_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_041673186.1|690748_691795_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_013574016.1|691775_692540_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.7	4.8e-69
WP_013574017.1|692529_693156_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	5.2e-37
WP_013574018.1|693398_694421_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.2	2.2e-05
WP_013574019.1|694472_695459_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.1	7.1e-33
WP_013574020.1|695557_698113_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	2.9e-25
WP_013574022.1|701308_702412_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_013574023.1|702573_703068_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.7	1.7e-27
WP_013574024.1|703175_704240_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	3.2e-111
WP_173362083.1|704483_705050_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_015689392.1|705188_707816_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.5	2.1e-79
WP_013574027.1|708072_708258_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_013574028.1|709289_709856_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_013574029.1|709852_710281_+	DedA family protein	NA	NA	NA	NA	NA
WP_013574030.1|710366_711938_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_013574031.1|712095_712611_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_013574032.1|712680_713970_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_015689394.1|713986_714778_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_013574034.1|714942_716304_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_015689395.1|716482_716731_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_013574036.1|716749_717298_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_015689396.1|717365_718139_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_013574038.1|718187_718535_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_013574039.1|718627_718807_-	ogr/Delta-like zinc finger family protein	NA	F1BUT0	Erwinia_phage	75.5	6.4e-17
WP_015689397.1|718871_719972_-|tail	tail protein	tail	Q6K1G4	Salmonella_virus	43.6	4.4e-84
WP_015689398.1|719974_720445_-|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	50.0	1.7e-37
WP_015689399.1|720441_722073_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	33.1	2.6e-11
WP_013574043.1|722065_722200_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	78.9	6.7e-11
WP_013574044.1|722220_722508_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	60.9	4.3e-23
WP_015689401.1|722567_723077_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	67.8	2.0e-63
WP_013574046.1|723091_724261_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	80.5	8.4e-182
WP_013574047.1|724431_725391_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	68.5	1.7e-119
WP_013574048.1|725380_725995_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	70.9	1.7e-80
WP_013574049.1|725987_726896_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	73.5	1.5e-117
WP_013574050.1|726901_727252_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	63.8	9.9e-38
WP_013574051.1|727248_727890_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	60.4	6.4e-67
WP_013574052.1|727971_728433_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	43.3	1.1e-23
WP_013574053.1|728525_728954_-|lysis	lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	48.3	1.9e-06
WP_013574054.1|728954_729464_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	61.1	1.5e-55
WP_013574055.1|729444_729666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013574056.1|729656_729860_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	56.7	8.6e-18
WP_013574057.1|730071_730266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013574058.1|730414_732307_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	50.5	4.8e-179
WP_013574059.1|732400_732622_-	TraR/DksA C4-type zinc finger protein	NA	A0A1S6L007	Salmonella_phage	44.3	4.6e-09
WP_013574060.1|732621_732897_-	DUF5347 family protein	NA	NA	NA	NA	NA
WP_013574061.1|733029_733620_+	helix-turn-helix domain-containing protein	NA	Q6K1G0	Salmonella_virus	51.3	1.8e-52
WP_013574062.1|733908_734985_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.3	3.9e-85
WP_013574063.1|734991_736113_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_013574064.1|736190_737345_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_013574065.1|737655_738000_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_013574066.1|738281_739016_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_013574067.1|739146_740124_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_013574068.1|740123_740861_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_013574070.1|749506_750805_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.3	2.9e-42
WP_013574071.1|750994_752350_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_013574072.1|752434_755155_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013574073.1|755186_755891_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_013574074.1|756020_756440_-	thioredoxin TrxC	NA	A0A191VYI2	Roseobacter_phage	34.4	4.5e-13
WP_013574075.1|756684_757788_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
NC_017047	Rahnella aquatilis HX2, complete sequence	4962173	1527764	1627203	4962173	plate,head,lysis,tail,portal,integrase,capsid,terminase,tRNA,protease,transposase	Escherichia_phage(31.58%)	87	1539340:1539357	1578326:1578343
WP_013574769.1|1527764_1528085_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.1	1.1e-14
WP_013574770.1|1528112_1530395_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	6.7e-167
WP_002211347.1|1530616_1530835_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_015689576.1|1530928_1531663_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_015689577.1|1531714_1533436_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-18
WP_013574773.1|1533438_1535205_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.6	4.4e-25
WP_015689578.1|1535353_1536322_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.1	1.7e-63
WP_013574775.1|1537054_1537549_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_015689579.1|1537669_1541116_+	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	48.8	9.3e-88
1539340:1539357	attL	CGCTGCGGCCATGAAACT	NA	NA	NA	NA
WP_013574777.1|1541310_1541922_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_013574778.1|1541929_1543273_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.7	5.8e-78
WP_013574779.1|1543379_1544672_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	6.2e-93
WP_013573449.1|1544789_1545794_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013574780.1|1546224_1548681_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.3	2.1e-214
WP_013574781.1|1548757_1551205_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.3	5.4e-215
WP_013574782.1|1551216_1551834_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	1.3e-77
WP_013574783.1|1551835_1552693_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	NA	NA	NA	NA
WP_013574784.1|1552762_1553371_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.8	4.4e-25
WP_013574785.1|1553370_1553943_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_013574786.1|1554076_1555222_+	MFS transporter	NA	NA	NA	NA	NA
WP_015689580.1|1555327_1556068_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.8	9.5e-22
WP_015689581.1|1556165_1557152_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	76.5	6.7e-148
WP_013574789.1|1557254_1557554_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	70.7	3.9e-35
WP_015689582.1|1557660_1558035_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	65.5	8.4e-35
WP_013574791.1|1558213_1558714_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	63.9	7.7e-60
WP_015689583.1|1558773_1559016_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	56.7	4.6e-10
WP_013574793.1|1559015_1559234_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	54.9	3.0e-16
WP_015689584.1|1559236_1559515_+	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	54.8	5.6e-20
WP_015689585.1|1559522_1561832_+	replication endonuclease	NA	M1SV59	Escherichia_phage	59.7	7.5e-259
WP_015689586.1|1561969_1563142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015689587.1|1564378_1565503_+	beta family protein	NA	A0A0U2S621	Escherichia_phage	63.3	2.1e-134
WP_015689588.1|1565462_1566041_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	65.1	7.3e-70
WP_015689589.1|1566490_1567504_-|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	70.0	2.4e-140
WP_015689590.1|1567505_1569275_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	77.5	1.2e-267
WP_015689591.1|1569439_1570285_+|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	64.9	6.4e-99
WP_015689592.1|1570329_1571430_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	68.6	3.7e-139
WP_015689593.1|1571432_1572179_+|terminase	terminase	terminase	A0A218M4L0	Erwinia_phage	55.8	2.2e-63
WP_041673199.1|1572286_1572769_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	63.5	3.4e-44
WP_015689595.1|1572768_1572972_+|tail	tail protein X	tail	M1RZ22	Escherichia_phage	76.1	2.6e-22
WP_015696635.1|1572974_1573184_+	hypothetical protein	NA	B6SD15	Bacteriophage	45.6	2.0e-06
WP_015689597.1|1573167_1573677_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	69.6	1.8e-64
WP_015689598.1|1573673_1574096_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	40.1	9.8e-16
WP_015689600.1|1574185_1574653_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	64.5	5.5e-52
WP_015689601.1|1574645_1575095_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	5.5e-49
WP_015689602.1|1575237_1576779_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_015689603.1|1576878_1577520_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	70.8	5.2e-77
WP_015689604.1|1577537_1577888_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	62.1	1.0e-34
WP_015689605.1|1577892_1578801_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	74.8	5.4e-120
1578326:1578343	attR	AGTTTCATGGCCGCAGCG	NA	NA	NA	NA
WP_015689606.1|1578793_1579324_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	77.1	1.1e-77
WP_015689608.1|1581652_1582171_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	40.8	3.0e-22
WP_167539523.1|1582323_1582467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015689609.1|1582613_1583801_+|tail	phage tail sheath protein	tail	A0A218M4J6	Erwinia_phage	83.3	2.5e-189
WP_015689610.1|1583812_1584331_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.2	1.8e-75
WP_015689611.1|1584385_1584682_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	64.0	1.2e-23
WP_015689612.1|1584714_1584837_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	82.1	1.9e-12
WP_015689613.1|1584826_1587280_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	64.3	8.9e-210
WP_015689614.1|1587293_1587758_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	65.5	1.0e-50
WP_015689615.1|1587754_1588918_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	75.8	1.9e-162
WP_015689616.1|1589000_1589219_+	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	62.5	6.2e-22
WP_013574828.1|1589635_1591918_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.9	1.1e-156
WP_015689617.1|1591993_1592851_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_015689618.1|1593349_1595113_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_013574831.1|1595438_1596524_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.1	4.4e-84
WP_013574832.1|1596628_1597912_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_013574833.1|1598108_1598807_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_015689619.1|1598963_1600637_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_013574835.1|1600697_1600982_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	7.1e-10
WP_013574836.1|1601253_1603500_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_013574837.1|1603538_1605287_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.4	1.3e-56
WP_013574838.1|1605283_1606273_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_013574839.1|1606622_1606832_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	68.8	4.7e-19
WP_013574840.1|1607093_1607306_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	42.6	3.0e-05
WP_013574841.1|1607401_1608625_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013574842.1|1609006_1609189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013574843.1|1609185_1609944_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013574844.1|1610139_1611033_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_013574845.1|1611034_1611814_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_013574846.1|1611969_1612755_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_013574847.1|1612751_1614074_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_013574848.1|1614054_1614786_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_013574849.1|1614782_1619231_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_013574850.1|1619592_1621443_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_013574851.1|1621622_1622174_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	4.9e-07
WP_013574852.1|1622225_1622873_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_013574853.1|1622958_1624149_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_121019630.1|1624390_1625500_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.0	5.3e-109
WP_013574855.1|1625802_1627203_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.9	1.4e-82
>prophage 3
NC_017047	Rahnella aquatilis HX2, complete sequence	4962173	1904435	1979915	4962173	lysis,tail,holin,integrase,terminase,protease	Enterobacteria_phage(21.74%)	82	1900835:1900852	1974689:1974706
1900835:1900852	attL	GTGACGCCATCAACCGTC	NA	NA	NA	NA
WP_015689710.1|1904435_1905581_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	45.9	3.9e-83
WP_015689711.1|1905561_1905819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167539526.1|1905862_1906027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015689712.1|1906626_1906914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015689713.1|1906910_1907213_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	53.8	2.3e-14
WP_015689714.1|1907376_1908024_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP50	Morganella_phage	59.0	2.2e-54
WP_015689715.1|1908130_1908328_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP24	Morganella_phage	59.7	4.6e-16
WP_015689716.1|1908353_1908860_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	62.3	1.9e-45
WP_015689717.1|1909044_1909221_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_015689718.1|1909217_1910228_+	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	74.8	5.6e-33
WP_015689719.1|1910224_1910767_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	64.2	1.6e-58
WP_015689721.1|1910915_1911290_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	57.9	1.7e-32
WP_041673087.1|1911304_1912000_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	54.2	5.0e-57
WP_015689723.1|1911996_1913010_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	40.4	1.8e-71
WP_015689724.1|1913026_1913380_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	66.4	1.1e-39
WP_167539527.1|1913609_1913777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167539528.1|1913809_1916962_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015689726.1|1917351_1917540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015689727.1|1917648_1918029_+|holin	phage holin family protein	holin	F1C592	Cronobacter_phage	55.5	1.2e-31
WP_015689728.1|1918015_1918303_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	37.4	1.5e-12
WP_015689729.1|1918299_1918926_+	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	63.2	4.2e-71
WP_041673210.1|1918963_1919470_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	35.3	8.2e-09
WP_167539529.1|1919480_1919654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013577788.1|1920648_1921137_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	80.2	4.1e-66
WP_015689731.1|1921136_1923239_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	72.6	2.7e-311
WP_015689732.1|1923235_1923454_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	67.1	1.6e-17
WP_015689733.1|1924977_1926936_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	73.9	1.3e-275
WP_015689734.1|1927020_1927347_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	60.7	5.1e-28
WP_015689735.1|1927339_1927615_+	hypothetical protein	NA	K7PH55	Enterobacterial_phage	53.8	1.3e-16
WP_014416515.1|1927625_1928180_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	59.9	4.1e-54
WP_015689736.1|1928176_1928581_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	61.4	3.7e-44
WP_015689737.1|1928588_1929326_+	Ig-like domain-containing protein	NA	M9NYX0	Enterobacteria_phage	68.9	1.2e-88
WP_015689738.1|1929336_1929744_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	43.5	5.2e-22
WP_015689739.1|1929764_1930079_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	55.3	6.0e-26
WP_193427807.1|1930263_1932390_+|tail	phage tail tape measure protein	tail	A0A2D1GPC9	Escherichia_phage	42.2	6.1e-138
WP_015689741.1|1932425_1932767_+|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	69.4	1.1e-41
WP_015689742.1|1932977_1933715_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	80.8	4.4e-120
WP_015689743.1|1933717_1934437_+	C40 family peptidase	NA	M9NZD8	Enterobacteria_phage	72.3	3.0e-105
WP_015689744.1|1934429_1935047_+|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	71.7	2.9e-77
WP_015689745.1|1935101_1938299_+	host specificity protein J	NA	E4WL39	Enterobacteria_phage	63.4	0.0e+00
WP_015689746.1|1938299_1938614_+	hypothetical protein	NA	E4WL40	Enterobacteria_phage	36.0	1.7e-09
WP_015689747.1|1938615_1939290_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	37.0	6.4e-25
WP_015689748.1|1939414_1939651_+	hypothetical protein	NA	Q38624	Escherichia_phage	61.8	2.5e-21
WP_015689749.1|1939709_1941221_+|tail	tail fiber domain-containing protein	tail	A0A1V0E5M2	Salmonella_phage	56.0	3.9e-38
WP_015689750.1|1941284_1941674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148267121.1|1942880_1942979_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_015689751.1|1943577_1944000_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	54.4	1.5e-32
WP_015689752.1|1943999_1945265_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	72.0	5.1e-177
WP_015689755.1|1946060_1947206_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_049804359.1|1947654_1948128_-	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	35.7	5.3e-18
WP_015689757.1|1948151_1948505_-	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	49.1	4.2e-20
WP_013575146.1|1949106_1950120_-	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_015689758.1|1950234_1951710_+	MFS transporter	NA	NA	NA	NA	NA
WP_013575148.1|1951908_1952205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013575149.1|1952213_1952807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013575150.1|1952903_1954598_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	8.8e-15
WP_015689759.1|1954719_1956390_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.0	3.1e-12
WP_013575152.1|1956452_1957325_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_013575153.1|1957324_1958374_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	6.1e-06
WP_013575154.1|1958420_1958810_+	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	1.0e-06
WP_013575155.1|1958820_1959465_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_013575156.1|1959790_1960945_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_015689760.1|1960937_1963022_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_015689761.1|1963023_1963440_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_015689762.1|1963926_1964322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015689763.1|1964314_1965754_-	PAAR domain-containing protein	NA	A0A2H4JEI9	uncultured_Caudovirales_phage	27.1	1.3e-27
WP_015689764.1|1965766_1966444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015689765.1|1966919_1967372_-	flagellar export chaperone FlgN	NA	NA	NA	NA	NA
WP_013575161.1|1967421_1967724_-	anti-sigma-28 factor FlgM	NA	NA	NA	NA	NA
WP_013575162.1|1967883_1968666_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_013575163.1|1968779_1969190_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_013575164.1|1969196_1969601_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_013575165.1|1969612_1970317_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_013575166.1|1970394_1971639_+	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_013575167.1|1971673_1972429_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_013575168.1|1972450_1973233_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_071823641.1|1973360_1974065_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_013575170.1|1974075_1975182_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
1974689:1974706	attR	GTGACGCCATCAACCGTC	NA	NA	NA	NA
WP_013575171.1|1975181_1976132_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	Q9ZXE4	Bacillus_phage	37.2	4.5e-16
WP_013575172.1|1976272_1977925_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_013575173.1|1977952_1978915_+	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_013575174.1|1979219_1979915_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 4
NC_017047	Rahnella aquatilis HX2, complete sequence	4962173	3106679	3158744	4962173	tail,portal,capsid,terminase,tRNA,protease,transposase	Tupanvirus(22.22%)	51	NA	NA
WP_015690152.1|3106679_3109577_-|tail	tail fiber domain-containing protein	tail	H6X4Z1	Enterobacteria_phage	32.2	4.0e-07
WP_015690153.1|3109589_3109985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015690154.1|3109984_3110293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015690155.1|3110295_3112092_-|capsid	phage major capsid protein	capsid	Q6R4V3	Vibrio_virus	26.6	1.9e-31
WP_041673158.1|3112045_3113530_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	24.1	2.5e-21
WP_148271874.1|3113529_3114066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148271884.1|3114078_3115899_-|terminase	phage terminase large subunit family protein	terminase	D6PFE7	uncultured_phage	23.6	1.4e-26
WP_015690159.1|3116855_3117083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148271885.1|3117207_3117669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148271875.1|3118038_3118680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148271886.1|3118729_3119533_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_015690163.1|3119617_3119827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148271876.1|3119906_3120263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015690164.1|3120921_3122331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015690165.1|3122382_3122937_-	HNH endonuclease	NA	S6ANN8	Bacillus_phage	40.4	1.3e-10
WP_015690166.1|3122993_3123143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015690167.1|3123548_3123869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015690168.1|3123841_3125575_-	recombinase family protein	NA	G1D5I8	Mycobacterium_phage	22.8	2.1e-11
WP_013576118.1|3125851_3126331_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	37.9	4.4e-12
WP_015690171.1|3126485_3126875_-	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF	NA	NA	NA	NA	NA
WP_013576120.1|3126871_3127204_-	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE	NA	NA	NA	NA	NA
WP_013576121.1|3127200_3128871_-	lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase	NA	NA	NA	NA	NA
WP_013576122.1|3128870_3129770_-	4-deoxy-4-formamido-L-arabinose- phosphoundecaprenol deformylase	NA	NA	NA	NA	NA
WP_013576123.1|3129783_3131766_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	24.6	2.8e-20
WP_013576124.1|3131765_3132746_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	1.1e-33
WP_013576125.1|3132745_3133888_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.9	5.0e-30
WP_015690172.1|3134235_3134985_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	7.1e-09
WP_013576128.1|3135004_3135556_-	glutathione peroxidase	NA	A0A1S7DMQ0	Molluscum_contagiosum_virus	41.6	9.2e-14
WP_013576129.1|3135628_3136636_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_013576130.1|3136789_3137188_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_004089944.1|3137968_3138265_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
WP_013576132.1|3138269_3140657_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_013576133.1|3140671_3141655_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_106120997.1|3141829_3141874_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_013576134.1|3142004_3142361_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_013576135.1|3142403_3142601_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_013576136.1|3142696_3143248_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	5.8e-16
WP_013576137.1|3143251_3145180_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	5.7e-127
WP_013576138.1|3145469_3146150_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_153376299.1|3146173_3146785_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_013576140.1|3147131_3148001_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_013576141.1|3148106_3148655_-	YniB family protein	NA	NA	NA	NA	NA
WP_013576142.1|3148848_3149514_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_013576143.1|3149822_3150659_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_013576144.1|3150737_3151499_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	2.7e-16
WP_013576145.1|3151651_3152209_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	34.2	4.2e-06
WP_015690174.1|3152398_3153790_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_013576147.1|3153877_3154669_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_013576148.1|3154908_3156306_+	MFS transporter	NA	NA	NA	NA	NA
WP_013576149.1|3156362_3157244_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_013573449.1|3157739_3158744_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_017047	Rahnella aquatilis HX2, complete sequence	4962173	3990076	4013634	4962173	coat,protease,holin	Escherichia_phage(25.0%)	21	NA	NA
WP_112197499.1|3990076_3990343_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_013576908.1|3990607_3991549_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015690389.1|3991691_3992234_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	57.2	8.7e-57
WP_049804352.1|3992256_3992703_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015690391.1|3993150_3995232_+	chitinase	NA	Q4KT15	Chrysodeixis_chalcites_nucleopolyhedrovirus	27.8	2.9e-36
WP_015690392.1|3995293_3996190_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015690393.1|3996307_3997804_+	MFS transporter	NA	NA	NA	NA	NA
WP_015690394.1|3998218_3998779_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_013576915.1|3998841_3999360_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_013576916.1|3999368_3999914_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_015690395.1|3999933_4000731_+	molecular chaperone	NA	NA	NA	NA	NA
WP_015690396.1|4000749_4003197_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_015690397.1|4003193_4004162_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_013576920.1|4004218_4004698_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_013576921.1|4004807_4005461_-	DNA oxidative demethylase AlkB	NA	A0A0H3Y8P5	Apricot_vein_clearing_associated_virus	33.7	7.1e-05
WP_013576922.1|4005598_4006417_+	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_013576923.1|4006478_4007816_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_013576924.1|4007844_4009188_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_013576925.1|4009184_4010558_-	MFS transporter	NA	NA	NA	NA	NA
WP_013576926.1|4010784_4011945_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013576927.1|4012182_4013634_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.7	3.9e-27
>prophage 6
NC_017047	Rahnella aquatilis HX2, complete sequence	4962173	4034962	4075779	4962173	plate,lysis,tail,portal,integrase,capsid,terminase,tRNA,head	Erwinia_phage(46.88%)	48	4045203:4045227	4077555:4077579
WP_013576944.1|4034962_4035838_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_013576945.1|4035970_4037677_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	37.4	1.0e-26
WP_013576946.1|4037673_4038153_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_173362117.1|4038158_4039517_-	two-component system sensor histidine kinase QseC	NA	NA	NA	NA	NA
WP_013576948.1|4039540_4040227_-	response regulator	NA	NA	NA	NA	NA
WP_013576949.1|4040385_4041180_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_013576950.1|4041194_4042049_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_013576951.1|4042157_4042538_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_013576952.1|4042681_4043452_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013576953.1|4043451_4044375_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.3	1.2e-21
WP_013576954.1|4044510_4045167_+	carbonate dehydratase	NA	NA	NA	NA	NA
4045203:4045227	attL	AAGGCACAAAAATGTGCCTTTTTTA	NA	NA	NA	NA
WP_015690409.1|4045315_4046323_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	58.2	3.8e-114
WP_015690410.1|4046398_4046698_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	70.7	8.7e-35
WP_015690411.1|4046818_4047091_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	70.3	1.7e-32
WP_015690412.1|4047101_4047266_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	49.0	6.1e-06
WP_041673243.1|4047306_4047600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015690414.1|4047666_4047849_+	DUF2732 family protein	NA	Q6K1F6	Salmonella_virus	51.7	3.2e-08
WP_015690415.1|4047848_4048073_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	47.9	1.3e-11
WP_015690416.1|4048152_4050321_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	54.3	4.0e-222
WP_015690417.1|4050408_4051437_-	DUF2806 domain-containing protein	NA	NA	NA	NA	NA
WP_015690418.1|4052111_4052690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015690419.1|4052872_4053904_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	79.4	6.7e-159
WP_015690420.1|4053905_4055672_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	77.9	4.1e-273
WP_015690421.1|4055816_4056668_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	61.8	3.3e-87
WP_015690422.1|4056716_4057781_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	73.7	1.6e-142
WP_015690423.1|4057792_4058449_+|terminase	small terminase subunit	terminase	F1BUQ7	Erwinia_phage	54.1	1.0e-56
WP_015690424.1|4058544_4059018_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	51.3	2.8e-35
WP_015690425.1|4059017_4059221_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	65.7	1.7e-18
WP_041673244.1|4059226_4059436_+	hypothetical protein	NA	F1BUQ4	Erwinia_phage	50.0	1.1e-07
WP_015690427.1|4059416_4059926_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	63.3	1.1e-53
WP_015690428.1|4059925_4060351_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	48.2	4.7e-26
WP_015690430.1|4060446_4060914_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	66.4	1.1e-52
WP_015690431.1|4060906_4061365_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	68.1	3.8e-45
WP_041673245.1|4061488_4061758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015690433.1|4062151_4062898_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_015690434.1|4063310_4063784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015690435.1|4063948_4064845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015690436.1|4065062_4065704_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	63.2	6.2e-70
WP_015690437.1|4065700_4066051_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	65.5	3.8e-37
WP_015690438.1|4066054_4066963_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	76.2	1.9e-120
WP_015690439.1|4066955_4067483_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	76.6	1.8e-75
WP_015690440.1|4067492_4070009_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	40.5	9.5e-74
WP_015690441.1|4070018_4070474_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	49.2	1.1e-25
WP_015690442.1|4070627_4071797_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	77.9	2.3e-179
WP_015690443.1|4071810_4072320_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	70.9	8.1e-65
WP_015690444.1|4072377_4072659_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	67.4	5.9e-25
WP_015690445.1|4072691_4072811_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	74.4	2.9e-10
WP_015690448.1|4075308_4075779_+|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	62.0	5.4e-47
4077555:4077579	attR	AAGGCACAAAAATGTGCCTTTTTTA	NA	NA	NA	NA
>prophage 1
NC_017060	Rahnella aquatilis HX2 plasmid PRA1, complete sequence	570951	72479	156407	570951	terminase,tail,protease,plate,integrase,lysis	Enterobacteria_phage(16.22%)	70	86218:86234	143032:143048
WP_014416504.1|72479_74609_-	hypothetical protein	NA	A0A291AXF7	Shigella_phage	49.3	6.5e-31
WP_014416505.1|74663_77735_-	kinase	NA	A0A286S259	Klebsiella_phage	65.9	0.0e+00
WP_014416506.1|77731_78112_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	77.6	1.7e-54
WP_014416507.1|78121_78604_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	78.8	6.9e-66
WP_014416508.1|78600_79065_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	53.3	8.2e-48
WP_014416509.1|79112_81542_-|tail	phage tail length tape measure family protein	tail	A0A192Y7S1	Enterobacteria_phage	47.9	2.7e-105
WP_041673380.1|81522_81828_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	56.9	1.6e-23
WP_014416511.1|81836_82259_-|tail	phage minor tail protein G	tail	K7P7M5	Enterobacteria_phage	28.9	6.4e-07
WP_014416514.1|83040_83445_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.4	2.4e-43
WP_014416515.1|83441_83996_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	59.9	4.1e-54
WP_081481118.1|84006_84207_-	hypothetical protein	NA	K7PH55	Enterobacterial_phage	60.9	3.6e-08
WP_014416517.1|84802_86761_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	73.6	6.3e-275
86218:86234	attL	TACGTTTTGAATTAATG	NA	NA	NA	NA
WP_014416518.1|88286_88505_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	70.0	3.7e-19
WP_041673383.1|88501_90610_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	73.5	2.3e-299
WP_014416520.1|90599_91109_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	51.7	5.3e-40
WP_014416521.1|91673_92120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014416522.1|92446_92953_-|lysis	lysis protein	lysis	S4TP37	Salmonella_phage	32.7	1.3e-17
WP_014416523.1|92945_93476_-	lysozyme	NA	Q7Y3V3	Yersinia_phage	78.9	3.5e-79
WP_014416524.1|93477_93783_-	hypothetical protein	NA	O64361	Escherichia_phage	55.6	4.9e-25
WP_014416525.1|94387_94639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014416527.1|95340_95994_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_014416528.1|95996_97283_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	25.5	5.1e-15
WP_014416529.1|97385_97733_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	67.3	1.9e-41
WP_041673384.1|97747_98761_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	44.0	5.4e-76
WP_014416531.1|98757_98916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014416532.1|98912_99770_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	53.1	1.7e-86
WP_071823650.1|99766_100456_-	DNA replication protein	NA	A0A193GYX1	Enterobacter_phage	44.2	6.3e-44
WP_014416534.1|100452_101379_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.7	3.2e-75
WP_014416535.1|101368_101557_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	50.9	6.7e-09
WP_014416536.1|101740_102247_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	63.7	1.3e-46
WP_014416537.1|102272_102518_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	62.7	4.4e-16
WP_014416538.1|102615_103311_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	69.6	1.0e-86
WP_014416539.1|103471_103630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148271888.1|103607_103844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013577813.1|105308_105551_+	excisionase	NA	NA	NA	NA	NA
WP_014416540.1|105534_106659_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	51.7	4.0e-104
WP_013577816.1|108014_108203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014416542.1|108361_108775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013577817.1|109004_109784_+	(S)-acetoin forming diacetyl reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.5	1.5e-17
WP_013577818.1|109848_110715_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158307035.1|111135_112572_-	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013577820.1|113071_113239_+	YhfL family protein	NA	NA	NA	NA	NA
WP_013577821.1|113536_115678_-	5-histidylcysteine sulfoxide synthase	NA	NA	NA	NA	NA
WP_013577822.1|115824_116949_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	26.8	4.6e-28
WP_013577823.1|117355_118903_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	40.0	3.4e-37
WP_013577824.1|118975_120523_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	3.0e-09
WP_013577825.1|121368_121863_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_014416544.1|121894_123442_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_013577827.1|123457_124807_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_013577828.1|124803_125478_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_013577829.1|125479_127156_+	OmpA family protein	NA	NA	NA	NA	NA
WP_013577830.1|127188_127680_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_014416546.1|127842_130497_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.9	1.5e-93
WP_013577832.1|130493_132836_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	21.9	6.7e-13
WP_013577833.1|132950_133466_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_013577834.1|133482_136971_+	hypothetical protein	NA	H6SUH4	Campylobacter_virus	34.9	2.8e-07
WP_013577835.1|136986_137544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013577836.1|137559_138009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013577837.1|138036_138567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013577838.1|138628_138892_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	45.8	2.2e-05
WP_013577839.1|138894_140106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013577840.1|140102_143519_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
143032:143048	attR	TACGTTTTGAATTAATG	NA	NA	NA	NA
WP_014416547.1|143618_145388_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_013577842.1|145351_146434_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_013577843.1|146497_147040_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_014416548.1|151036_151876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014416549.1|152172_153222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013577848.1|153311_154151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013577849.1|154351_155956_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_013577850.1|155975_156407_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
