The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016788	Corynebacterium diphtheriae HC04, complete sequence	2484332	651213	767536	2484332	protease,integrase,transposase	Staphylococcus_phage(28.57%)	100	658439:658467	760088:760107
WP_014309188.1|651213_652605_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_014309189.1|652685_653738_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_014306622.1|653749_654448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309190.1|654498_655002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309191.1|655174_658138_+	UPF0182 family protein	NA	NA	NA	NA	NA
658439:658467	attL	GGGTTAAGGGTCAAAAGGGGATGCGGACG	NA	NA	NA	NA
WP_010934530.1|658488_659868_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	7.9e-38
658439:658467	attL	GGGTTAAGGGTCAAAAGGGGATGCGGACG	NA	NA	NA	NA
WP_162470199.1|661558_661717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309197.1|661868_662720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014317689.1|663368_663611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014316483.1|663716_664298_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	3.8e-10
WP_014316482.1|664294_665308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158307707.1|665407_665563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309201.1|665510_666692_+	phosphotransferase	NA	NA	NA	NA	NA
WP_014309202.1|666688_667504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080563684.1|667445_668057_+	flavoprotein	NA	NA	NA	NA	NA
WP_044026475.1|669432_670068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309204.1|670142_670592_+	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_014309205.1|670618_670993_+	Fic family protein	NA	NA	NA	NA	NA
WP_080563474.1|670998_671163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309206.1|671560_671761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309207.1|671821_672979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309208.1|673205_673445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309209.1|673502_673718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080563713.1|674313_674475_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2P1CCU8	Gordonia_phage	59.5	8.6e-05
WP_014309217.1|678635_679331_-	sodium:glutamate symporter	NA	NA	NA	NA	NA
WP_014309218.1|679860_680871_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_014309219.1|680873_681830_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_014309220.1|682042_682372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309221.1|682596_683076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309222.1|683513_684995_+	methylmalonyl-CoA carboxytransferase subunit 5S	NA	NA	NA	NA	NA
WP_014309223.1|685007_686564_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_003850577.1|686577_686841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003850583.1|686865_687234_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_014309224.1|687436_688528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309225.1|688546_689335_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_014306634.1|689390_690206_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_050816678.1|690385_691543_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_080571694.1|691492_693037_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_003850596.1|693280_693970_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.7	1.2e-26
WP_003850598.1|693986_694889_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003850600.1|694993_695485_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	52.2	1.5e-36
WP_010934530.1|696075_697455_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	7.9e-38
696027:696055	attR	GGGTTAAGGGTCAAAAGGGGATGCGGACG	NA	NA	NA	NA
WP_014308103.1|697564_700498_+	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
696027:696055	attR	GGGTTAAGGGTCAAAAGGGGATGCGGACG	NA	NA	NA	NA
WP_010934533.1|702616_703495_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.4	6.6e-30
WP_010934534.1|703494_704292_+	lantibiotic ABC transporter permease	NA	NA	NA	NA	NA
WP_010934535.1|704457_704724_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013170013.1|705758_706040_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_044026255.1|706112_706916_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_010934538.1|707138_707480_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010934539.1|707513_708317_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014308107.1|708438_708669_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080571695.1|710021_710558_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	32.5	6.9e-06
WP_014308109.1|710612_710777_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_050816680.1|710827_711100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309234.1|717389_718598_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014308112.1|719347_720076_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_111933930.1|720123_720303_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014308113.1|720269_720668_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014308114.1|720672_721320_-	DUF3239 domain-containing protein	NA	NA	NA	NA	NA
WP_014308115.1|721324_722989_-	DEAD/DEAH box helicase	NA	A0A1D8BJ75	Sulfolobus_islandicus_filamentous_virus	23.3	9.6e-14
WP_014309235.1|723034_725353_-	helicase-associated domain-containing protein	NA	NA	NA	NA	NA
WP_014301577.1|725419_725608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934546.1|725816_726440_-	DUF3235 domain-containing protein	NA	A0A2D0ZMX2	Rhodococcus_phage	59.0	1.3e-27
WP_003850654.1|727120_727510_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_014301578.1|727616_728141_-	DUF2771 domain-containing protein	NA	NA	NA	NA	NA
WP_014309236.1|728127_728994_-	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_014309237.1|729033_729798_+	DUF3027 domain-containing protein	NA	NA	NA	NA	NA
WP_003850661.1|729971_731459_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.8	3.1e-40
WP_050816682.1|731538_732435_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_014303114.1|732431_733328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309239.1|733348_734398_-	DUF3071 domain-containing protein	NA	NA	NA	NA	NA
WP_014309241.1|734599_735730_-	phosphoserine transaminase	NA	NA	NA	NA	NA
WP_003850673.1|736418_737711_+	citrate synthase	NA	NA	NA	NA	NA
WP_003850674.1|737877_738237_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_014301581.1|738323_739829_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha/beta	NA	NA	NA	NA	NA
WP_014309242.1|739921_740794_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	3.6e-52
WP_014309243.1|740793_741570_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_014309244.1|741880_743089_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014301583.1|743617_743959_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_014309245.1|743962_745615_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_010934561.1|745741_746596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309246.1|746588_747497_-	DUF1906 domain-containing protein	NA	A0A2D1GEF2	Gordonia_phage	37.1	3.5e-26
WP_014309247.1|747625_748825_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_044026483.1|749082_749535_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_014309248.1|749546_750113_-	SocA family protein	NA	NA	NA	NA	NA
WP_014309249.1|750445_750721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309234.1|751562_752771_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014309250.1|752977_753916_-	tyrosine recombinase XerC	NA	NA	NA	NA	NA
WP_014309251.1|754027_755128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309252.1|755315_755642_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014309253.1|755924_756707_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_021335603.1|756733_757042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309254.1|757020_757689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309255.1|757780_758356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014309256.1|758819_759374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309258.1|761740_762847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309259.1|763056_764028_+	XamI family restriction endonuclease	NA	NA	NA	NA	NA
WP_014309260.1|764014_765574_+	Eco57I restriction-modification methylase domain-containing protein	NA	NA	NA	NA	NA
WP_177224418.1|765704_766091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014308372.1|766186_767536_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	36.1	5.2e-34
>prophage 2
NC_016788	Corynebacterium diphtheriae HC04, complete sequence	2484332	1796760	1812517	2484332	protease,integrase,transposase,tRNA	Agrobacterium_phage(40.0%)	12	1787948:1787963	1817076:1817091
1787948:1787963	attL	ACGACGGCCGCGACGA	NA	NA	NA	NA
WP_014308109.1|1796760_1796925_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158308777.1|1797129_1797516_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_014308107.1|1798868_1799099_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014309471.1|1800254_1800668_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_014308610.1|1800664_1802161_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014309472.1|1802157_1804866_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	37.4	2.1e-135
WP_014308612.1|1804960_1805941_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_014303750.1|1806423_1807176_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010935337.1|1807211_1808504_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.2	3.3e-131
WP_014309473.1|1808650_1811176_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	30.4	1.6e-65
WP_003852475.1|1811270_1811900_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	44.0	3.6e-38
WP_003852476.1|1811917_1812517_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	46.7	3.3e-41
1817076:1817091	attR	TCGTCGCGGCCGTCGT	NA	NA	NA	NA
>prophage 3
NC_016788	Corynebacterium diphtheriae HC04, complete sequence	2484332	1853507	1911548	2484332	protease,transposase	Bacillus_phage(18.18%)	45	NA	NA
WP_014308630.1|1853507_1854080_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_014309488.1|1854076_1855009_-	P1 family peptidase	NA	NA	NA	NA	NA
WP_014309489.1|1855008_1855545_-	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_003852614.1|1855561_1855903_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_014309490.1|1855964_1857278_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014309491.1|1857309_1859277_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	30.0	4.0e-67
WP_014309493.1|1859603_1860314_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	59.0	4.7e-79
WP_158308778.1|1860341_1860557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309495.1|1861722_1862067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010934530.1|1862530_1863910_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	7.9e-38
WP_014309500.1|1866465_1867749_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_003852637.1|1867855_1869550_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_014308636.1|1869911_1870898_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	77.6	1.5e-139
WP_014309501.1|1871208_1871694_+	ferritin	NA	NA	NA	NA	NA
WP_014308637.1|1871744_1873892_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.6	3.9e-209
WP_010935389.1|1873953_1874379_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	H9NCC2	Sphingomonas_phage	33.6	8.1e-10
WP_010935390.1|1874472_1874706_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	54.5	2.9e-17
WP_014309502.1|1875007_1875880_+	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_014309503.1|1875872_1877399_+	phytoene desaturase	NA	NA	NA	NA	NA
WP_003852698.1|1877467_1877590_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_014309504.1|1877743_1878577_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	56.2	2.5e-79
WP_014309505.1|1878573_1879011_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_010935395.1|1879057_1879366_-	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_014303787.1|1879369_1880758_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_014309506.1|1880747_1882040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014302274.1|1882043_1883147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014309507.1|1883244_1883910_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014309508.1|1884110_1884845_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010935400.1|1884894_1885347_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_014309509.1|1885385_1887023_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_014309510.1|1887088_1887376_+	fluoride efflux transporter family protein	NA	NA	NA	NA	NA
WP_003852727.1|1887372_1887687_+	CrcB family protein	NA	NA	NA	NA	NA
WP_014308646.1|1887683_1890248_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_010935405.1|1890248_1890998_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	7.1e-33
WP_014309234.1|1891854_1893063_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003852741.1|1899191_1900448_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_014308648.1|1900486_1901062_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_010935406.1|1901114_1901960_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_014308649.1|1902642_1903578_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	52.3	2.1e-79
WP_010935408.1|1903682_1904249_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_014309511.1|1904290_1904572_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014309512.1|1904953_1906030_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014309513.1|1906513_1909111_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_014309514.1|1909110_1910952_-	site-specific DNA-methyltransferase	NA	A0A220NUF4	Escherichia_phage	29.5	1.3e-40
WP_014309516.1|1911377_1911548_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_016788	Corynebacterium diphtheriae HC04, complete sequence	2484332	2268845	2312475	2484332	holin,integrase,transposase,tRNA	Macacine_betaherpesvirus(28.57%)	34	2258264:2258278	2315203:2315217
2258264:2258278	attL	AAGCCTATGGGTATT	NA	NA	NA	NA
WP_014307479.1|2268845_2269625_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014302497.1|2269621_2270242_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_014309663.1|2270256_2272497_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_014309664.1|2272498_2273542_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_014309665.1|2273538_2273895_+	DUF3054 domain-containing protein	NA	NA	NA	NA	NA
WP_004567314.1|2274053_2274254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014308849.1|2274420_2274672_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004567317.1|2275086_2278086_-	VaFE repeat-containing surface-anchored protein	NA	NA	NA	NA	NA
WP_014308850.1|2278503_2278938_-	endo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_014308851.1|2279090_2279507_-	endo-beta-N-acetylglucosaminidase F2	NA	NA	NA	NA	NA
WP_014309666.1|2279662_2281213_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_014309667.1|2281224_2285985_-	acyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004567325.1|2286083_2287898_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_004567333.1|2287972_2288884_-	cutinase family protein	NA	NA	NA	NA	NA
WP_004567335.1|2288889_2289405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014308854.1|2289404_2291321_-	hypothetical protein	NA	A0A2I6B2Q9	Macacine_betaherpesvirus	37.6	4.9e-38
WP_004567341.1|2291681_2292698_-	esterase family protein	NA	A0A2I6AZZ6	Macacine_betaherpesvirus	35.1	5.4e-36
WP_014309668.1|2292864_2294553_-	arabinofuranosyl transferase C	NA	NA	NA	NA	NA
WP_014309669.1|2294561_2295539_-	decaprenyl-phosphate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004567346.1|2295535_2296030_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_014309670.1|2296029_2298015_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_014309671.1|2298099_2298585_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_014309672.1|2298655_2300233_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014308860.1|2300299_2302525_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	3.3e-17
WP_014309673.1|2302796_2304590_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	28.1	2.1e-54
WP_014302517.1|2304775_2305939_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	46.1	1.3e-94
WP_014308865.1|2306746_2307589_-	type IV toxin-antitoxin system AbiEi family antitoxin	NA	NA	NA	NA	NA
WP_014308867.1|2307833_2308109_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_014309674.1|2308579_2310400_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A159B6I5	Gordonia_phage	34.8	8.9e-05
WP_004567362.1|2310639_2310873_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_014308869.1|2311182_2311305_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080564351.1|2311687_2311867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014308870.1|2311832_2312174_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	42.0	8.8e-07
WP_158308781.1|2312238_2312475_+|transposase	transposase	transposase	NA	NA	NA	NA
2315203:2315217	attR	AAGCCTATGGGTATT	NA	NA	NA	NA
