The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_018068	Desulfosporosinus acidiphilus SJ4, complete sequence	4926837	910737	919541	4926837		Synechococcus_phage(37.5%)	8	NA	NA
WP_014825930.1|910737_911562_+	exonuclease domain-containing protein	NA	G3MBN3	Bacillus_virus	25.0	4.4e-12
WP_014825931.1|912103_912601_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.9e-24
WP_014825932.1|912630_913926_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	30.0	6.3e-21
WP_014825933.1|914123_914843_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	40.7	5.0e-44
WP_014825934.1|914941_916342_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	36.4	9.7e-60
WP_014825935.1|916375_917389_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.4	3.6e-72
WP_014825936.1|917385_917982_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.0	1.1e-25
WP_014825937.1|917999_919541_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.3	2.5e-77
>prophage 2
NC_018068	Desulfosporosinus acidiphilus SJ4, complete sequence	4926837	1337286	1418808	4926837	terminase,protease,integrase,portal,capsid,tail,plate,head,transposase	Clostridium_phage(24.32%)	98	1327651:1327672	1418911:1418932
1327651:1327672	attL	CCAAGTTCAAGAAGCCGCCTGG	NA	NA	NA	NA
WP_041275981.1|1337286_1338369_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	28.8	1.7e-24
WP_014826282.1|1338642_1339236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826283.1|1339542_1340016_+	C-GCAxxG-C-C family protein	NA	NA	NA	NA	NA
WP_014826284.1|1340028_1341156_+	Na+/glutamate symporter	NA	NA	NA	NA	NA
WP_148271268.1|1341655_1342801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148271380.1|1343114_1343765_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_014826287.1|1343874_1345533_+	DNA methylase	NA	NA	NA	NA	NA
WP_014826288.1|1346075_1346831_+	nitroreductase	NA	NA	NA	NA	NA
WP_148271270.1|1347009_1347201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014826290.1|1347380_1348208_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	69.8	2.5e-07
WP_014826291.1|1348510_1348696_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_014826292.1|1348884_1349973_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.9	4.2e-18
WP_014826293.1|1350083_1350479_-	response regulator	NA	NA	NA	NA	NA
WP_014826294.1|1350868_1351027_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_014826296.1|1351605_1352061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014826297.1|1352658_1353441_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014826298.1|1353779_1354226_+	purine-binding chemotaxis protein CheW	NA	Q56AR1	Bacillus_thuringiensis_phage	27.6	1.2e-08
WP_014826299.1|1354238_1355381_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_041275982.1|1355772_1356678_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014826300.1|1357064_1357223_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_014826301.1|1357432_1357597_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_014826302.1|1357650_1357791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826303.1|1358014_1358254_-	CDGSH iron-sulfur domain-containing protein	NA	NA	NA	NA	NA
WP_014826305.1|1358802_1360029_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_014826306.1|1360330_1360558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148271271.1|1360660_1361104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014826308.1|1361107_1361524_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_041275984.1|1361783_1362134_+	hypothetical protein	NA	A0A2K9V2W4	Faecalibacterium_phage	45.1	1.9e-17
WP_014826309.1|1362137_1362350_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014826310.1|1362513_1363338_+	phage antirepressor Ant	NA	R9VWW9	Paenibacillus_phage	47.2	2.1e-54
WP_014826311.1|1363334_1364579_+	DEAD/DEAH box helicase	NA	A0A2H4J064	uncultured_Caudovirales_phage	63.3	5.6e-152
WP_014826312.1|1364571_1364856_+	VRR-NUC domain-containing protein	NA	A0A1B1P7M6	Bacillus_phage	56.2	7.8e-25
WP_041276319.1|1364861_1366520_+	AAA family ATPase	NA	A0A2H4J7Q2	uncultured_Caudovirales_phage	59.2	2.7e-165
WP_014826314.1|1366537_1366987_+	DUF669 domain-containing protein	NA	A0A2H4J1S8	uncultured_Caudovirales_phage	48.7	3.8e-34
WP_014826316.1|1367255_1368950_+	hypothetical protein	NA	A0A1B1P7M5	Bacillus_phage	55.9	3.4e-184
WP_014826317.1|1369136_1371011_+	DNA primase family protein	NA	A0A2H4J1M0	uncultured_Caudovirales_phage	50.5	1.1e-175
WP_014826318.1|1371523_1371904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826319.1|1372020_1372473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826321.1|1372953_1373160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826322.1|1373167_1373524_+	HNH endonuclease	NA	Q38456	Bacillus_phage	57.4	1.2e-33
WP_014826323.1|1373709_1374237_+	hypothetical protein	NA	A0A2K5B277	Erysipelothrix_phage	38.2	2.1e-31
WP_014826324.1|1374299_1375553_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	51.1	1.4e-121
WP_158310150.1|1375839_1376358_+	HNH endonuclease	NA	A0A0H3UZ74	Geobacillus_virus	43.2	1.2e-28
WP_014826326.1|1376400_1376586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826327.1|1376589_1377405_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	29.8	1.4e-21
WP_014826328.1|1377404_1377644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826329.1|1377746_1377998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014826330.1|1378173_1378383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049804036.1|1378478_1380050_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	74.2	7.9e-236
WP_014826332.1|1380175_1381339_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	40.1	1.7e-78
WP_014826333.1|1381338_1382406_+|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	49.5	2.6e-49
WP_014826334.1|1382395_1383670_+|capsid	phage major capsid protein	capsid	A0A1B1IQC5	uncultured_Mediterranean_phage	39.1	5.5e-62
WP_014826335.1|1383703_1384180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826336.1|1384254_1384848_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_014826337.1|1384863_1385193_+|head	phage head closure protein	head	A6M954	Geobacillus_virus	43.1	3.3e-19
WP_014826338.1|1385185_1385599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826339.1|1385598_1386033_+	hypothetical protein	NA	A0A0A7RTL8	Clostridium_phage	36.0	7.7e-16
WP_014826340.1|1386036_1387104_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7S0D2	Clostridium_phage	47.0	1.6e-78
WP_014826341.1|1387115_1387544_+|tail	phage tail tube protein	tail	A0A0A7RVT1	Clostridium_phage	54.3	9.3e-38
WP_014826342.1|1387598_1388000_+	hypothetical protein	NA	A0A0A7RTP2	Clostridium_phage	53.3	3.5e-31
WP_014826343.1|1388017_1388158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041275985.1|1388191_1390375_+|tail	phage tail tape measure protein	tail	Q6R868	Staphylococcus_virus	30.4	4.3e-46
WP_014826345.1|1390387_1390792_+	hypothetical protein	NA	A0A0A8WJR4	Clostridium_phage	43.9	8.2e-28
WP_014826346.1|1390788_1391781_+	hypothetical protein	NA	A0A0A7RWY4	Clostridium_phage	38.4	1.7e-58
WP_014826347.1|1391790_1392159_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_014826348.1|1392155_1392587_+	DUF2634 domain-containing protein	NA	A0A0K2SUB3	Clostridium_phage	37.9	6.3e-18
WP_014826349.1|1392579_1393653_+|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	33.5	5.0e-40
WP_014826350.1|1393645_1394167_+	DUF2313 domain-containing protein	NA	A0A0K2SUI5	Clostridium_phage	33.3	5.3e-11
WP_014826351.1|1394167_1394734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826352.1|1394733_1395069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826353.1|1395077_1396721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826354.1|1396734_1397073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826355.1|1397073_1397211_+	XkdX family protein	NA	NA	NA	NA	NA
WP_014826356.1|1397267_1397507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826357.1|1397694_1398015_+	hypothetical protein	NA	D2XR31	Bacillus_phage	39.5	6.8e-09
WP_014826358.1|1397992_1398478_+	hypothetical protein	NA	I3VYU8	Thermoanaerobacterium_phage	67.9	2.3e-61
WP_014826359.1|1398598_1399372_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	50.3	5.6e-33
WP_014826360.1|1399388_1399802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826361.1|1400474_1400795_+	response regulator	NA	NA	NA	NA	NA
WP_014826362.1|1401240_1402227_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_049804107.1|1402512_1403100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014826364.1|1403430_1403592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826366.1|1403848_1404124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826367.1|1404484_1405072_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014826368.1|1405096_1405315_+	DUF1858 domain-containing protein	NA	NA	NA	NA	NA
WP_014826369.1|1405330_1406101_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_014826371.1|1406478_1406916_+	DoxX family protein	NA	NA	NA	NA	NA
WP_014826372.1|1406928_1407321_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_014826373.1|1407961_1409581_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	41.6	3.0e-97
WP_014826374.1|1409594_1411127_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	52.5	3.1e-120
WP_169314523.1|1411275_1411623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826376.1|1411938_1412367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014826377.1|1412406_1413867_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_148271273.1|1414314_1414512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826379.1|1414840_1415422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826380.1|1415450_1416563_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014826381.1|1417005_1417314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014826382.1|1417446_1418808_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
1418911:1418932	attR	CCAAGTTCAAGAAGCCGCCTGG	NA	NA	NA	NA
>prophage 3
NC_018068	Desulfosporosinus acidiphilus SJ4, complete sequence	4926837	2689616	2769517	4926837	integrase,transposase	Paenibacillus_phage(33.33%)	59	2694083:2694098	2697444:2697459
WP_014826382.1|2689616_2690978_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_083845586.1|2691028_2691439_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	82.3	1.5e-45
WP_158310179.1|2691557_2691878_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	84.9	5.5e-43
WP_014827524.1|2692092_2692479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014827525.1|2692480_2693248_-	ATP-binding protein	NA	NA	NA	NA	NA
2694083:2694098	attL	AGATAATGTAAAGTAA	NA	NA	NA	NA
WP_148271405.1|2694225_2695461_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014827527.1|2695457_2696429_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A220NQQ9	Corynebacterium_phage	27.2	1.5e-06
WP_014827528.1|2696415_2697435_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.8	6.1e-11
WP_014827530.1|2698404_2698719_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	70.9	2.0e-37
2697444:2697459	attR	AGATAATGTAAAGTAA	NA	NA	NA	NA
WP_014827531.1|2699409_2700525_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_041276478.1|2700677_2701046_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_014827533.1|2701134_2701650_-	putative metal-dependent hydrolase	NA	D0R7I3	Paenibacillus_phage	51.8	4.4e-26
WP_014827534.1|2702287_2703682_-	GntP family permease	NA	NA	NA	NA	NA
WP_014827535.1|2703701_2704880_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_014827536.1|2704957_2705704_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	1.7e-23
WP_014827537.1|2705700_2707275_-	acyl CoA:acetate/3-ketoacid CoA transferase	NA	NA	NA	NA	NA
WP_158310211.1|2707605_2709111_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_014827539.1|2709546_2710206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014827540.1|2710556_2710757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041276079.1|2711325_2711544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014827542.1|2711548_2711872_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014827543.1|2711936_2712932_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014827544.1|2713182_2713995_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_014827546.1|2714258_2716688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014827547.1|2716677_2717829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014827549.1|2719203_2720163_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_014827550.1|2720284_2720488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049804121.1|2720913_2721741_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014827552.1|2721955_2723155_-	lactate utilization protein	NA	NA	NA	NA	NA
WP_014827553.1|2723154_2724141_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_014827554.1|2724462_2725626_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_014827555.1|2725878_2727120_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_014827556.1|2727144_2727987_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_014827557.1|2727986_2729000_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_014827558.1|2729009_2729960_-	4Fe-4S ferredoxin	NA	NA	NA	NA	NA
WP_049804122.1|2729952_2730429_-	hydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_014827560.1|2730470_2733503_-	CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein	NA	NA	NA	NA	NA
WP_014827561.1|2733655_2737708_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	22.3	1.0e-08
WP_014827562.1|2737700_2741330_-	helicase-exonuclease AddAB subunit AddB	NA	NA	NA	NA	NA
WP_162470962.1|2741590_2741737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014827563.1|2741699_2742425_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_014827564.1|2742425_2743841_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	34.4	2.4e-18
WP_014827565.1|2743953_2744799_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	32.8	1.7e-35
WP_014827566.1|2744967_2746392_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_014827567.1|2746651_2747569_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014827568.1|2747797_2749009_-	ammonium transporter	NA	NA	NA	NA	NA
WP_014827569.1|2749134_2749782_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014827570.1|2749771_2751703_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	33.3	4.0e-48
WP_014827571.1|2752139_2752610_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_014827574.1|2753437_2754145_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_014827575.1|2754203_2756462_-	PocR ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_158310180.1|2756526_2757549_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_014827577.1|2757868_2758735_-	response regulator	NA	NA	NA	NA	NA
WP_014827578.1|2758746_2761452_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.1	2.7e-42
WP_014827579.1|2761627_2762092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014827580.1|2762746_2763973_+	MFS transporter	NA	NA	NA	NA	NA
WP_014827581.1|2764245_2765706_+	MFS transporter	NA	NA	NA	NA	NA
WP_014827582.1|2765833_2767594_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_014827402.1|2768152_2769517_-|transposase	ISNCY-like element ISDsac1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_018068	Desulfosporosinus acidiphilus SJ4, complete sequence	4926837	3124263	3130075	4926837		Staphylococcus_phage(100.0%)	6	NA	NA
WP_014827880.1|3124263_3125121_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	39.7	9.3e-13
WP_014827881.1|3125634_3126204_+	GNAT family N-acetyltransferase	NA	A0A0N9SKF6	Staphylococcus_phage	26.4	8.6e-07
WP_014827882.1|3126493_3127666_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.5	1.2e-50
WP_014827883.1|3127647_3128301_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.2	2.0e-39
WP_014827884.1|3128374_3129577_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.8	1.0e-113
WP_014827885.1|3129613_3130075_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.4	1.5e-38
