The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017564	Yersinia enterocolitica subsp. palearctica Y11, complete genome	4553420	684609	756235	4553420	integrase,coat,transposase,tRNA,tail	Escherichia_phage(21.43%)	57	675880:675894	707979:707993
675880:675894	attL	CCGGTTTGAGGCGGA	NA	NA	NA	NA
WP_023161015.1|684609_685680_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	58.6	2.9e-120
WP_005163581.1|685920_686736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005163580.1|686820_687042_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	67.6	4.3e-23
WP_005163579.1|687134_688277_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	67.6	7.2e-146
WP_005163578.1|688273_688726_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	63.2	2.7e-48
WP_005179240.1|688728_689946_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	42.0	8.7e-57
WP_005163571.1|690860_691625_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_005163569.1|691828_693142_+	cytosine permease	NA	NA	NA	NA	NA
WP_005163567.1|693195_693897_+	PAS domain-containing protein	NA	Q2A088	Sodalis_phage	39.0	7.3e-16
WP_005166647.1|696177_696834_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013649992.1|696971_697493_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_005179233.1|697685_698888_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	5.8e-77
WP_005164457.1|699944_700763_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005164455.1|700943_702116_-	MFS transporter	NA	NA	NA	NA	NA
WP_005164453.1|702352_703378_-	ROK family protein	NA	NA	NA	NA	NA
WP_005164450.1|703663_704017_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_049531270.1|704205_705666_-	L-asparagine permease	NA	NA	NA	NA	NA
WP_005164444.1|706727_708086_+	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	69.9	3.9e-29
707979:707993	attR	TCCGCCTCAAACCGG	NA	NA	NA	NA
WP_005164442.1|708382_709102_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_005164439.1|709094_710771_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_005164436.1|711015_711795_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	63.9	1.7e-82
WP_005164432.1|712317_713580_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.3	1.2e-136
WP_005164429.1|714201_714981_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_005164427.1|715546_716554_+	glutaminase A	NA	NA	NA	NA	NA
WP_005179195.1|716665_718306_+	MFS transporter	NA	NA	NA	NA	NA
WP_005164420.1|718422_718941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014608895.1|719114_721052_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_004390794.1|721131_721659_+	iron transporter	NA	NA	NA	NA	NA
WP_016266150.1|721794_723198_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_172397684.1|724526_725639_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005164408.1|725642_726356_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-17
WP_005164403.1|726345_726834_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_005164402.1|726833_727148_+	cytochrome c	NA	NA	NA	NA	NA
WP_005164401.1|727304_728174_+	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_014608899.1|728224_729157_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005164398.1|729246_729873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164396.1|730030_730801_+	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_005164393.1|730851_732069_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005164391.1|735202_737227_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_005164390.1|737216_738551_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_005164389.1|738547_739015_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_005164388.1|739230_739938_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014608902.1|740466_741255_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	72.9	1.4e-87
WP_005179156.1|741396_742833_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.3	7.6e-84
WP_005164897.1|742956_744687_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	35.1	1.0e-90
WP_005164898.1|745054_745615_+	VOC family protein	NA	NA	NA	NA	NA
WP_005164899.1|745856_746621_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_072077262.1|747992_748295_-	EamA family transporter	NA	NA	NA	NA	NA
WP_005164909.1|748275_748518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164915.1|748679_749720_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_005164916.1|749964_750543_+	glutathione transferase	NA	NA	NA	NA	NA
WP_005164917.1|750611_751160_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005164919.1|751660_751894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164921.1|752616_753006_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005164922.1|753123_753366_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_005164924.1|753478_755002_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_005164926.1|755224_756235_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 2
NC_017564	Yersinia enterocolitica subsp. palearctica Y11, complete genome	4553420	809896	817728	4553420	tRNA	Tupanvirus(33.33%)	9	NA	NA
WP_005161572.1|809896_811825_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.8e-126
WP_011816226.1|811828_812380_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_004713020.1|812476_812674_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004393357.1|812711_813068_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152414234.1|813136_813184_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_005161570.1|813532_814516_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_005161568.1|814530_816918_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	1.1e-07
WP_002211830.1|816922_817219_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_005161566.1|817431_817728_-	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	68.8	6.2e-17
>prophage 3
NC_017564	Yersinia enterocolitica subsp. palearctica Y11, complete genome	4553420	1239192	1349361	4553420	integrase,terminase,lysis,plate,transposase,tRNA,holin,tail,head,capsid	Erwinia_phage(30.51%)	121	1260573:1260589	1337043:1337059
WP_020282800.1|1239192_1240212_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005161236.1|1240868_1241861_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_005161239.1|1242922_1244404_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005161241.1|1244400_1245438_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_005161243.1|1245480_1246725_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	1.2e-24
WP_005161245.1|1247301_1248735_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005161246.1|1248919_1250368_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005161249.1|1250370_1251378_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005178681.1|1251378_1251540_+	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_005178678.1|1251604_1253386_+	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	NA	NA	NA	NA
WP_005178675.1|1253423_1254380_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_020282800.1|1254791_1255811_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005178670.1|1256306_1257473_+	MFS transporter	NA	NA	NA	NA	NA
WP_005161274.1|1257661_1258498_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_005178667.1|1258718_1259828_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_005161276.1|1260147_1261683_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
1260573:1260589	attL	CCAGTACTTTTACAATA	NA	NA	NA	NA
WP_014608989.1|1261821_1262763_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_014608990.1|1262773_1263415_-	YceH family protein	NA	NA	NA	NA	NA
WP_005161280.1|1263422_1264007_-	ribosomal protein S5-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_005161283.1|1264682_1265417_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_005161286.1|1265428_1265746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005161289.1|1266420_1267626_+	multidrug efflux MFS transporter MdtH	NA	NA	NA	NA	NA
WP_005161292.1|1267842_1268406_+	lipoprotein	NA	NA	NA	NA	NA
WP_005161295.1|1268443_1269004_-	molecular chaperone	NA	NA	NA	NA	NA
WP_005161298.1|1269067_1269805_-	phosphatase	NA	NA	NA	NA	NA
WP_005161303.1|1269953_1270895_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	NA	NA	NA	NA
WP_005161306.1|1271390_1272275_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_005161308.1|1272791_1273910_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.4	1.5e-18
WP_005161310.1|1274466_1276167_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.3	6.8e-23
WP_005161312.1|1276240_1277095_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.3	1.3e-46
WP_005161315.1|1277239_1278049_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_005161317.1|1278045_1278447_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_005161319.1|1278464_1279319_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005161322.1|1279318_1280401_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	42.1	5.6e-07
WP_005161325.1|1280432_1281695_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_005161329.1|1282000_1282624_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_005161332.1|1282625_1283507_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_004390739.1|1283704_1284652_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.2	2.7e-45
WP_005161340.1|1285138_1285411_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_005161343.1|1285742_1286336_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005161346.1|1286390_1286849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005161349.1|1287116_1288208_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_005161352.1|1288354_1289521_-	class C beta-lactamase	NA	NA	NA	NA	NA
WP_005161355.1|1289655_1290540_+	LysR family transcriptional regulator AmpR	NA	NA	NA	NA	NA
WP_005161358.1|1290646_1291303_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_005161363.1|1291604_1292489_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_005161366.1|1292861_1293344_-	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	63.8	5.5e-55
WP_005161370.1|1293345_1293522_-|holin	phage holin family protein	holin	B6SD15	Bacteriophage	60.7	2.2e-14
WP_005161372.1|1293748_1293925_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_005161376.1|1294101_1294518_-	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	63.9	1.3e-39
WP_005161394.1|1295267_1295912_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	31.3	8.0e-17
WP_005161396.1|1296312_1296732_+	helix-turn-helix domain-containing protein	NA	A0A0M4REM4	Salmonella_phage	31.1	1.3e-15
WP_005161398.1|1297337_1298255_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005161400.1|1298357_1299566_+	MFS transporter	NA	NA	NA	NA	NA
WP_071598556.1|1300492_1300795_+|capsid	P2 family phage major capsid protein	capsid	A0A077KEQ8	Ralstonia_phage	68.7	2.6e-26
WP_005161416.1|1300788_1300968_+|holin	holin	holin	NA	NA	NA	NA
WP_005161419.1|1300954_1301350_+	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.8	9.1e-48
WP_005161423.1|1301353_1301779_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	46.1	3.0e-20
WP_005161429.1|1301880_1302348_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	55.3	8.3e-40
WP_005161432.1|1302344_1302791_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	48.0	9.4e-33
WP_005161434.1|1302829_1303891_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_005161435.1|1303956_1304247_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	34.5	8.3e-06
WP_005161438.1|1304227_1304500_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_005161446.1|1304636_1305272_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	62.9	3.7e-67
WP_005161449.1|1305268_1305625_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	60.0	4.4e-33
WP_005178623.1|1305624_1306533_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	74.5	1.3e-121
WP_005161456.1|1306525_1307068_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	75.0	7.3e-80
WP_005161459.1|1307064_1307346_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	70.3	2.7e-30
WP_014608992.1|1307318_1308611_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	35.4	1.6e-48
WP_005161463.1|1309275_1309554_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_005161466.1|1309560_1309821_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_005161469.1|1309892_1310060_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	48.0	1.2e-06
WP_005161471.1|1310201_1310408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005161473.1|1310397_1310718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005161476.1|1311159_1311336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072077259.1|1311541_1312426_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	46.3	5.7e-74
WP_014608996.1|1313088_1313814_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	32.5	5.4e-30
WP_005179233.1|1314605_1315808_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	5.8e-77
WP_023161047.1|1316589_1317597_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	65.8	2.0e-115
WP_014609000.1|1317900_1318887_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_014609001.1|1318901_1319927_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	64.2	6.3e-117
WP_014609003.1|1320225_1321110_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_016266213.1|1321150_1321762_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	37.3	2.2e-24
WP_014609005.1|1321832_1322030_+	hypothetical protein	NA	Q1I116	Pasteurella_virus	39.3	2.8e-05
WP_014609006.1|1322084_1322594_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	53.0	7.1e-45
WP_014609007.1|1322603_1322789_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_014609008.1|1322800_1323112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014609009.1|1323177_1323450_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_014609010.1|1323436_1325719_+	replication endonuclease	NA	Q858T4	Yersinia_virus	57.1	3.7e-242
WP_005163732.1|1325741_1326101_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	44.3	6.2e-19
WP_005163733.1|1326308_1326491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014609011.1|1326855_1327134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014609013.1|1328281_1329046_-|terminase	terminase	terminase	O80303	Escherichia_phage	45.0	6.7e-55
WP_014609014.1|1329042_1330815_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.0	1.0e-287
WP_014609015.1|1330968_1331823_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	61.1	1.1e-90
WP_014609016.1|1331899_1333051_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	75.3	1.3e-150
WP_014609017.1|1333054_1333714_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.9	2.8e-81
WP_014609018.1|1333813_1334287_+|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	58.7	5.3e-42
WP_041161505.1|1334286_1334490_+|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	65.7	2.4e-20
WP_005163750.1|1334492_1334702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014609020.1|1334685_1335192_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	62.5	2.6e-55
WP_041161506.1|1335193_1335610_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	48.9	5.1e-25
WP_014609022.1|1335705_1336161_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	61.3	2.2e-45
WP_014609023.1|1336157_1336607_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	64.4	6.3e-45
WP_014609024.1|1336956_1337121_+	hypothetical protein	NA	NA	NA	NA	NA
1337043:1337059	attR	TATTGTAAAAGTACTGG	NA	NA	NA	NA
WP_004705545.1|1337152_1337470_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	47.0	1.6e-15
WP_014609025.1|1337444_1338377_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_014609026.1|1338477_1339119_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	63.8	3.5e-73
WP_014609027.1|1339115_1339466_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	65.5	1.9e-36
WP_005163763.1|1339470_1340379_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	79.5	4.3e-125
WP_014609028.1|1340371_1340980_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	79.1	5.1e-90
WP_014609029.1|1340976_1342416_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	71.1	1.0e-80
WP_014609030.1|1342426_1342609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014609031.1|1342763_1343933_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	80.5	6.2e-185
WP_005163776.1|1343946_1344462_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	71.9	1.1e-66
WP_014609032.1|1344514_1344826_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	65.9	1.0e-25
WP_014609033.1|1344858_1344981_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	71.1	2.0e-09
WP_014609034.1|1344973_1347403_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	46.8	1.5e-156
WP_014609035.1|1347405_1347891_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	61.6	9.2e-50
WP_014609036.1|1347887_1349054_+	phage late control D family protein	NA	S4TRX8	Salmonella_phage	68.1	1.4e-144
WP_014609037.1|1349145_1349361_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	62.5	7.4e-20
>prophage 4
NC_017564	Yersinia enterocolitica subsp. palearctica Y11, complete genome	4553420	1456635	1469298	4553420		Paramecium_bursaria_Chlorella_virus(16.67%)	9	NA	NA
WP_005164503.1|1456635_1459338_-	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.2	2.7e-42
WP_005177870.1|1459554_1460253_-	MgtC family protein	NA	G3MA03	Bacillus_virus	41.0	1.1e-14
WP_005177868.1|1460816_1461056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005177865.1|1461302_1461674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164506.1|1461921_1463661_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	8.8e-10
WP_004701013.1|1463794_1463986_-	protein DsrB	NA	NA	NA	NA	NA
WP_002210893.1|1464238_1464451_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_014609055.1|1464932_1465967_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	50.3	1.9e-84
WP_005164514.1|1466145_1469298_+	beta-galactosidase	NA	B9U1H7	Vaccinia_virus	62.8	0.0e+00
>prophage 5
NC_017564	Yersinia enterocolitica subsp. palearctica Y11, complete genome	4553420	2545828	2583103	4553420	integrase,terminase,lysis,plate,tRNA,portal,holin,tail,head,capsid	Erwinia_phage(51.43%)	46	2553088:2553137	2583175:2583224
WP_005160825.1|2545828_2546842_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.7	1.9e-105
WP_001144069.1|2547215_2547431_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005160830.1|2547567_2549316_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.0	1.1e-73
WP_005160832.1|2549473_2551312_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
2553088:2553137	attL	GACTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCAAAT	NA	NA	NA	NA
WP_005163783.1|2553300_2553519_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	72.2	7.0e-26
WP_005163782.1|2553625_2554789_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	65.9	5.1e-139
WP_014609180.1|2555274_2557707_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	46.8	3.9e-157
WP_014609033.1|2557699_2557822_-|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	71.1	2.0e-09
WP_014609032.1|2557854_2558166_-|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	65.9	1.0e-25
WP_005163776.1|2558218_2558734_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	71.9	1.1e-66
WP_014609031.1|2558747_2559917_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	80.5	6.2e-185
WP_014609030.1|2560071_2560254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014609029.1|2560264_2561704_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	71.1	1.0e-80
WP_014609028.1|2561700_2562309_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	79.1	5.1e-90
WP_005163763.1|2562301_2563210_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	79.5	4.3e-125
WP_014609027.1|2563214_2563565_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	65.5	1.9e-36
WP_014609026.1|2563561_2564203_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	63.8	3.5e-73
WP_014609025.1|2564303_2565236_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_004705545.1|2565210_2565528_-	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	47.0	1.6e-15
WP_014609024.1|2565559_2565724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014609023.1|2566073_2566523_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	64.4	6.3e-45
WP_014609022.1|2566519_2566975_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	61.3	2.2e-45
WP_071823020.1|2566913_2567111_-|holin	holin	holin	F1BUQ0	Erwinia_phage	54.2	1.5e-11
WP_041161506.1|2567070_2567487_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	48.9	5.1e-25
WP_014609020.1|2567488_2567995_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	62.5	2.6e-55
WP_005163750.1|2567978_2568188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041161505.1|2568190_2568394_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	65.7	2.4e-20
WP_014609018.1|2568393_2568867_-|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	58.7	5.3e-42
WP_014609017.1|2568966_2569626_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.9	2.8e-81
WP_014609016.1|2569629_2570781_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	75.3	1.3e-150
WP_014609015.1|2570857_2571712_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	61.1	1.1e-90
WP_014609014.1|2571865_2573638_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.0	1.0e-287
WP_014609013.1|2573634_2574399_+|terminase	terminase	terminase	O80303	Escherichia_phage	45.0	6.7e-55
WP_014609181.1|2574395_2575433_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	77.8	3.0e-159
WP_014609011.1|2575545_2575824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014609182.1|2576230_2576425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014609183.1|2576562_2576922_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	43.4	1.8e-18
WP_014609184.1|2576944_2579224_-	replication endonuclease	NA	Q858T4	Yersinia_virus	57.1	1.3e-242
WP_005163730.1|2579361_2579667_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_005163729.1|2579666_2579939_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	54.4	1.6e-06
WP_005163728.1|2580004_2580316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005163725.1|2580327_2580513_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_005163724.1|2580522_2581032_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	51.2	4.6e-44
WP_032899948.1|2581063_2581285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005163717.1|2581402_2581978_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	41.2	1.7e-31
WP_005163714.1|2582047_2583103_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	61.3	1.5e-121
2583175:2583224	attR	GACTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCAAAT	NA	NA	NA	NA
>prophage 6
NC_017564	Yersinia enterocolitica subsp. palearctica Y11, complete genome	4553420	2651265	2716449	4553420	transposase,protease	uncultured_Mediterranean_phage(15.38%)	60	NA	NA
WP_020282800.1|2651265_2652285_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005162387.1|2652679_2653405_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_005162392.1|2653401_2654055_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_005162394.1|2654295_2656632_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	32.4	5.8e-41
WP_014609197.1|2656724_2657627_-	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_005162396.1|2658323_2662784_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_005162398.1|2662793_2664212_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005162401.1|2664665_2665151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005162408.1|2665392_2665908_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.8	9.8e-26
WP_005162411.1|2665913_2666555_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_005162424.1|2666949_2667342_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_004710905.1|2667356_2667785_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_005162426.1|2668117_2669245_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_005162428.1|2669468_2669873_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_005162432.1|2670334_2671708_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	3.0e-21
WP_005162436.1|2671796_2672885_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	33.8	1.4e-10
WP_005162439.1|2672962_2674231_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005162441.1|2674352_2674607_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_005180174.1|2674781_2675123_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_005162447.1|2675125_2675752_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_005162449.1|2675764_2676325_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_005162452.1|2676329_2677112_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_005162453.1|2677126_2677930_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	1.3e-19
WP_005162457.1|2678373_2679348_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_005162459.1|2679378_2680365_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	29.5	7.4e-38
WP_005162463.1|2680378_2680942_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	80.0	5.3e-57
WP_005162468.1|2680938_2681502_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_005162470.1|2681485_2682031_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_005162473.1|2682037_2682763_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	9.3e-22
WP_005162476.1|2682966_2684400_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_005162480.1|2684423_2684711_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_005162484.1|2684881_2685364_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_005162486.1|2685442_2686294_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.9e-05
WP_005162489.1|2686294_2686567_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_005162493.1|2687688_2688624_+	aspartate carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	40.2	2.1e-50
WP_005162495.1|2688635_2689100_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_005162498.1|2689593_2689980_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_005162500.1|2690247_2691684_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_005162503.1|2691677_2692607_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_005162507.1|2692603_2693425_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005162510.1|2693448_2694183_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_005162514.1|2694524_2696186_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_005162517.1|2696251_2697667_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_005162520.1|2697883_2698831_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_005162523.1|2699602_2702323_+	magnesium-translocating P-type ATPase	NA	M1HN09	Paramecium_bursaria_Chlorella_virus	26.5	6.1e-42
WP_005162526.1|2702402_2702681_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	77.2	6.0e-38
WP_005162529.1|2702680_2702986_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	65.3	3.3e-29
WP_005162532.1|2703057_2704986_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_005162536.1|2705058_2706300_-	lactonase family protein	NA	NA	NA	NA	NA
WP_014609202.1|2707173_2708286_-	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_005162540.1|2708269_2709439_-	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_005162541.1|2709522_2710173_-	DUF4310 family protein	NA	NA	NA	NA	NA
WP_005162542.1|2710194_2710971_-	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_005162543.1|2710983_2711280_-	DUF4312 family protein	NA	NA	NA	NA	NA
WP_004392359.1|2711279_2711645_-	glycine-rich SFCGS family protein	NA	NA	NA	NA	NA
WP_005162544.1|2711668_2712013_-	glycine dehydrogenase	NA	NA	NA	NA	NA
WP_005162545.1|2712544_2712955_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_005162547.1|2713002_2713389_-	cytochrome b562	NA	NA	NA	NA	NA
WP_020282800.1|2713697_2714717_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005163213.1|2715108_2716449_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 7
NC_017564	Yersinia enterocolitica subsp. palearctica Y11, complete genome	4553420	2854152	2923503	4553420	transposase,protease,tail,tRNA	Erwinia_phage(23.08%)	55	NA	NA
WP_014609223.1|2854152_2855256_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_005163799.1|2855521_2855962_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_005163800.1|2855984_2856617_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_005176056.1|2856834_2858235_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_005163804.1|2858217_2859150_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_005163806.1|2859297_2860029_+	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	57.9	3.8e-47
WP_005163809.1|2860321_2861770_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_005163811.1|2862051_2862744_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_005163813.1|2862929_2864261_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005163815.1|2864294_2866100_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.6	1.5e-25
WP_005163816.1|2866264_2866957_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_005163818.1|2866973_2867630_-	hemophore	NA	NA	NA	NA	NA
WP_005163826.1|2867799_2868414_-	hemophore HasA	NA	NA	NA	NA	NA
WP_005163828.1|2868592_2869213_-	hemophore HasA	NA	NA	NA	NA	NA
WP_005163841.1|2869377_2871867_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_005163844.1|2872430_2873804_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_005163846.1|2873975_2874752_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_005163847.1|2874827_2875832_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_005181036.1|2876079_2877258_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_005163850.1|2877481_2880121_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_005163851.1|2880965_2881850_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_005163854.1|2882091_2884527_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_005181034.1|2884529_2885690_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_004392248.1|2886065_2886383_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_005163858.1|2886475_2886691_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_005163861.1|2886938_2889137_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_005181031.1|2889378_2890407_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_005163865.1|2890472_2891342_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_013649010.1|2891441_2891966_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_005163871.1|2892002_2893334_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GFL6	Erwinia_phage	30.0	1.7e-45
WP_005163872.1|2893484_2894417_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004714419.1|2894547_2895033_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_005163875.1|2895169_2895409_-	cell division protein ZapB	NA	NA	NA	NA	NA
WP_005163878.1|2896003_2896852_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.4	5.8e-15
WP_005163879.1|2896928_2898452_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_005163880.1|2898633_2899644_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_023161110.1|2899836_2900856_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005165352.1|2901285_2902470_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.7	7.1e-11
WP_005165350.1|2903224_2904160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005165348.1|2904275_2909213_+	type IV secretion protein Rhs	NA	B6SD27	Bacteriophage	41.1	3.7e-287
WP_005165346.1|2909454_2910201_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_005165344.1|2910259_2910697_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_005181024.1|2910855_2911461_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_005165340.1|2911589_2912357_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_005165338.1|2912372_2913245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005165336.1|2913459_2914449_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005165334.1|2914659_2915643_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_005165332.1|2915877_2916780_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_005165328.1|2917269_2918418_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	73.9	4.1e-157
WP_005165326.1|2918414_2918867_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	61.4	1.2e-46
WP_005165324.1|2918879_2921303_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	62.3	2.2e-240
WP_014609225.1|2921292_2921427_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	76.7	2.3e-11
WP_005165320.1|2921459_2921774_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	72.4	3.7e-28
WP_005165318.1|2921800_2922319_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	77.9	3.5e-79
WP_005165316.1|2922333_2923503_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	78.1	4.3e-178
>prophage 8
NC_017564	Yersinia enterocolitica subsp. palearctica Y11, complete genome	4553420	2932473	2943669	4553420	integrase	Salmonella_phage(25.0%)	11	2930499:2930513	2941371:2941385
2930499:2930513	attL	ACGCCATGATTAACG	NA	NA	NA	NA
WP_071598579.1|2932473_2933337_+	ATP-binding protein	NA	C7BGE8	Burkholderia_phage	28.6	5.3e-08
WP_005164690.1|2933337_2933994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164692.1|2934600_2936070_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_005164693.1|2936322_2938404_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	59.1	1.5e-226
WP_005164694.1|2938442_2938943_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	61.4	1.4e-56
WP_005164697.1|2938982_2939255_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	78.9	3.2e-36
WP_005164698.1|2939388_2939664_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	65.6	3.0e-29
WP_016266554.1|2939748_2940729_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	72.2	5.8e-136
WP_005164704.1|2940912_2941410_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2941371:2941385	attR	ACGCCATGATTAACG	NA	NA	NA	NA
WP_005164706.1|2941597_2942296_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	4.0e-06
WP_005180990.1|2942292_2943669_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.1	4.5e-17
>prophage 1
NC_017565	Yersinia enterocolitica subsp. palearctica Y11 plasmid pYV03, complete sequence	72460	16907	24679	72460	transposase	uncultured_Caudovirales_phage(57.14%)	9	NA	NA
WP_014609457.1|16907_18320_+	trimeric autotransporter adhesin YadA	NA	Q9MCI8	Enterobacteria_phage	55.6	2.6e-12
WP_013749484.1|18389_19265_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010891241.1|19586_20039_-	PprA	NA	NA	NA	NA	NA
WP_010891242.1|20194_21046_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.9	1.8e-16
WP_010891243.1|21206_21788_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.5	2.6e-22
WP_014609460.1|21801_22227_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.6	1.3e-47
WP_014609461.1|22239_23529_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.7	4.9e-167
WP_013749489.1|23574_23895_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.7	1.7e-20
WP_013749490.1|23980_24679_+	arsenic resistance NADPH-dependent reductase ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.5	7.7e-90
