The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015761	Salmonella bongori NCTC 12419, complete genome	4460105	848176	858832	4460105	plate,tail	Salmonella_phage(75.0%)	9	NA	NA
WP_000177407.1|848176_848536_+	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	96.6	1.8e-58
WP_000268334.1|848522_849431_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	98.0	1.5e-157
WP_001086799.1|849423_850029_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	97.0	5.0e-114
WP_001285260.1|851337_852495_+	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	29.1	1.9e-29
WP_000584703.1|852716_853181_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.0	1.0e-18
WP_162470497.1|853513_853861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280962.1|854941_855244_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|855258_855378_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_000980410.1|858346_858832_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	90.7	1.2e-73
>prophage 2
NC_015761	Salmonella bongori NCTC 12419, complete genome	4460105	1007222	1031234	4460105	holin,integrase	Salmonella_phage(50.0%)	35	1007057:1007116	1036199:1036276
1007057:1007116	attL	CCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCC	NA	NA	NA	NA
WP_015702793.1|1007222_1008242_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	8.3e-93
WP_000196400.1|1008242_1008467_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000846936.1|1009154_1009961_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000097141.1|1009957_1010806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214259.1|1010977_1011445_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	85.2	4.7e-67
WP_000145711.1|1011458_1011686_+	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_015702794.1|1011651_1012026_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	3.3e-63
WP_000024047.1|1012117_1013023_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.0	1.3e-174
WP_000788824.1|1013019_1013712_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	58.9	4.3e-77
WP_000025837.1|1013725_1013983_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	89.4	1.8e-36
WP_024134978.1|1014992_1015319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085729.1|1015605_1016037_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	55.8	9.7e-27
WP_000409416.1|1016159_1016327_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	75.5	6.6e-16
WP_015702797.1|1016400_1017228_+	phage antirepressor N-terminal domain-containing protein	NA	I6S627	Salmonella_phage	52.2	2.7e-57
WP_000128278.1|1017300_1018047_+	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	61.8	4.5e-64
WP_001217667.1|1018232_1018466_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	7.3e-37
WP_015702798.1|1018582_1018831_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	98.8	3.6e-42
WP_000929795.1|1018865_1019468_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	1.3e-109
WP_000793789.1|1019856_1020528_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	57.1	1.5e-63
WP_000211402.1|1020796_1021369_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	71.1	3.5e-40
WP_000151608.1|1021510_1022011_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000509712.1|1022021_1022201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141024934.1|1023130_1023559_+	pertussis toxin	NA	NA	NA	NA	NA
WP_141024936.1|1023629_1024331_+	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	66.0	5.0e-81
WP_001294877.1|1024568_1024958_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.8	1.4e-40
WP_000226306.1|1024944_1025226_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_000372743.1|1025225_1025840_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.6	2.7e-107
WP_001050816.1|1025836_1026379_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001109263.1|1026640_1027171_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	9.9e-90
WP_001222152.1|1027570_1027981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819054.1|1028069_1028375_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	53.1	6.2e-20
WP_001111091.1|1028477_1028828_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	74.8	8.1e-48
WP_000480907.1|1028912_1029170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015702803.1|1029171_1030284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141024939.1|1030730_1031234_+	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	45.6	1.7e-19
1036199:1036276	attR	CCGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAGATTAAACAAGGGGTTA	NA	NA	NA	NA
>prophage 3
NC_015761	Salmonella bongori NCTC 12419, complete genome	4460105	2142771	2151361	4460105	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_000195328.1|2142771_2144805_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.8e-55
WP_000703144.1|2145072_2145531_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.9	7.1e-52
WP_000950424.1|2145669_2146140_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	91.7	1.1e-76
WP_000598645.1|2146186_2146906_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272843.1|2146902_2148588_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	89.3	4.6e-274
WP_001240383.1|2148810_2149551_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	88.1	1.3e-100
WP_001234243.1|2149610_2149718_+	protein YohO	NA	NA	NA	NA	NA
WP_000824740.1|2149698_2150430_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569161.1|2150413_2151361_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.5	6.2e-10
>prophage 4
NC_015761	Salmonella bongori NCTC 12419, complete genome	4460105	3078218	3141078	4460105	terminase,integrase,tail,lysis,plate,portal,holin,head,tRNA,capsid	Salmonella_phage(53.33%)	70	3084538:3084586	3115234:3115282
WP_001264346.1|3078218_3079232_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	4.5e-107
WP_001144069.1|3079469_3079685_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918858.1|3079988_3081734_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	4.7e-72
WP_001519776.1|3081883_3083731_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237774.1|3083875_3084382_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3084538:3084586	attL	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAAT	NA	NA	NA	NA
WP_000468307.1|3084740_3084959_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	9.5e-39
WP_000627825.1|3085025_3086195_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	97.4	1.9e-210
WP_000978861.1|3086191_3086677_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	100.0	1.0e-85
WP_000069527.1|3086691_3089133_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	94.1	0.0e+00
WP_085984508.1|3089125_3089281_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|3089277_3089613_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207675.1|3089675_3090194_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001279032.1|3090209_3091397_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.5	5.8e-223
WP_000122994.1|3091531_3092080_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	99.5	1.7e-100
WP_000104701.1|3092092_3094069_-|tail	tail fiber protein	tail	S4TP62	Salmonella_phage	98.6	0.0e+00
WP_001000071.1|3094079_3094610_-|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	98.3	7.8e-103
WP_000246675.1|3094602_3095511_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	99.0	1.3e-158
WP_000127150.1|3095517_3095865_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_001094753.1|3095861_3096503_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	98.1	3.5e-113
WP_001293103.1|3096571_3097021_-	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	99.3	2.5e-73
WP_001169076.1|3097013_3097481_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	99.4	2.5e-84
WP_001394645.1|3097443_3097617_-	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_000866102.1|3097588_3098002_-|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	100.0	2.6e-45
WP_001144116.1|3097998_3098496_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_000134659.1|3098482_3098779_-|holin	phage holin family protein	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
WP_015703020.1|3098782_3098986_-|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	98.5	4.0e-31
WP_000214255.1|3098985_3099492_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_000203474.1|3099585_3100335_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	88.0	1.8e-113
WP_001248604.1|3100338_3101406_-|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	89.5	2.3e-178
WP_001085936.1|3101481_3102336_-|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	98.6	8.9e-157
WP_000156054.1|3102501_3104271_+|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.8	0.0e+00
WP_000517958.1|3104270_3105317_+|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	4.4e-190
WP_000338485.1|3105394_3106399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000033213.1|3106778_3107327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000381894.1|3107437_3108169_-	hypothetical protein	NA	Q37850	Escherichia_phage	93.8	5.1e-129
WP_000373435.1|3108251_3108692_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	94.2	2.6e-67
WP_000503833.1|3108809_3111029_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	94.6	0.0e+00
WP_153655389.1|3111054_3111648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000752604.1|3111669_3111894_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	100.0	6.5e-35
WP_001246236.1|3111893_3112121_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.6e-31
WP_000085639.1|3112190_3112391_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	98.5	2.3e-31
WP_000920168.1|3112377_3112605_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	2.1e-36
WP_000459332.1|3112612_3113122_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	6.2e-89
WP_000135597.1|3113152_3113416_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.7	3.3e-38
WP_001217271.1|3113546_3114125_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	63.0	3.5e-64
WP_000218395.1|3114124_3115162_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	97.1	1.1e-198
WP_000716773.1|3115399_3115735_-	hypothetical protein	NA	NA	NA	NA	NA
3115234:3115282	attR	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAAT	NA	NA	NA	NA
WP_024135121.1|3115977_3116346_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_001258712.1|3116345_3116849_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000213737.1|3117159_3117927_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000983440.1|3118156_3118804_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478452.1|3118800_3120366_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
WP_000094659.1|3120710_3122231_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	39.1	8.4e-33
WP_079775117.1|3122660_3124040_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.3	3.5e-30
WP_000122474.1|3124208_3126227_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_000019978.1|3126320_3127457_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000202735.1|3127542_3128040_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000625353.1|3128191_3128884_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_024135122.1|3128971_3129970_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098831.1|3130239_3131208_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	7.2e-38
WP_000235302.1|3131461_3132706_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001199406.1|3132795_3134283_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_000187429.1|3134297_3135710_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_001226461.1|3136180_3137479_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406481.1|3137643_3138420_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_000422141.1|3138768_3139431_+	DedA family protein	NA	NA	NA	NA	NA
WP_000917519.1|3139434_3139818_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000877295.1|3139961_3140330_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000031219.1|3140371_3140677_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000785625.1|3140679_3141078_+|holin	phage holin family protein	holin	NA	NA	NA	NA
