The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017053	Streptococcus pyogenes MGAS1882, complete genome	1781029	30861	43174	1781029		Synechococcus_phage(28.57%)	8	NA	NA
WP_041174317.1|30861_34587_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.9	3.0e-39
WP_009880323.1|34747_36202_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
WP_014407190.1|36229_37252_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.1	1.2e-62
WP_014407191.1|37419_37974_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	6.8e-25
WP_014407192.1|38157_39705_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
WP_014407193.1|39762_40887_-	CHAP domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_041174318.1|41139_42405_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_041174354.1|42682_43174_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NC_017053	Streptococcus pyogenes MGAS1882, complete genome	1781029	332321	338357	1781029		Streptococcus_phage(100.0%)	9	NA	NA
WP_041174327.1|332321_332957_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
WP_002985844.1|332974_333850_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	46.6	2.1e-68
WP_014407337.1|333868_334108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002985838.1|334512_334836_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_014407339.1|334840_335704_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.0	5.5e-114
WP_002985833.1|335730_336123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407340.1|336169_336799_-	CutC domain-containing protein	NA	NA	NA	NA	NA
WP_014407341.1|337099_337456_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	1.8e-39
WP_002990895.1|337529_338357_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	2.9e-128
>prophage 3
NC_017053	Streptococcus pyogenes MGAS1882, complete genome	1781029	625358	635961	1781029		Streptococcus_phage(57.14%)	9	NA	NA
WP_014407484.1|625358_627569_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	8.5e-268
WP_002985142.1|627676_628840_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_002985140.1|628836_629523_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002992640.1|629616_630783_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	5.8e-34
WP_002992643.1|630843_631185_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	5.9e-19
WP_002992646.1|631405_632758_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	1.0e-29
WP_002990257.1|632845_634114_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014407485.1|634143_634584_-	membrane protein	NA	NA	NA	NA	NA
WP_002985123.1|634818_635961_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.0	4.1e-24
>prophage 4
NC_017053	Streptococcus pyogenes MGAS1882, complete genome	1781029	1057827	1145809	1781029	holin,terminase,integrase,tRNA,portal,protease,head,capsid,tail	Streptococcus_phage(58.46%)	98	1098923:1098942	1143194:1143213
WP_002984013.1|1057827_1058523_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014407666.1|1058541_1059303_-	DUF3169 family protein	NA	NA	NA	NA	NA
WP_011054648.1|1059299_1059515_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014407667.1|1059875_1062494_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.9	6.7e-62
WP_014407668.1|1062880_1063936_-	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_002989211.1|1063998_1064706_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	27.2	2.6e-08
WP_011054651.1|1064771_1065968_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_011054652.1|1066343_1068149_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_014407670.1|1068161_1069124_-	competence protein CoiA	NA	NA	NA	NA	NA
WP_002995774.1|1069420_1070137_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002995779.1|1070255_1070960_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002995782.1|1071161_1072190_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002983986.1|1072196_1073417_+	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_002983984.1|1073530_1074121_-	peptidase S11	NA	NA	NA	NA	NA
WP_011054656.1|1074117_1074366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054657.1|1074350_1074578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054658.1|1074744_1075350_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	53.2	1.8e-58
WP_011888795.1|1075446_1076487_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_014407671.1|1076557_1078801_-	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	59.2	1.8e-55
WP_002983967.1|1078781_1079444_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_014407672.1|1079643_1080462_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010922438.1|1080501_1081278_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002989164.1|1081267_1081546_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	1.8e-05
WP_014407674.1|1081569_1083570_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	33.8	2.2e-65
WP_014407675.1|1083697_1085317_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.8	5.0e-60
WP_014407676.1|1085623_1087168_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	29.1	1.4e-35
WP_014407678.1|1087415_1088111_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_010922441.1|1088190_1089582_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002989146.1|1089772_1090819_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002983939.1|1090919_1091516_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_014407679.1|1091562_1091754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014407680.1|1092314_1093094_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_002989140.1|1093217_1093760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014407681.1|1093920_1094442_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002983928.1|1094550_1095246_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_014407682.1|1095484_1096420_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.1	7.9e-66
WP_014407683.1|1096719_1098582_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.7	1.6e-89
1098923:1098942	attL	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_011017964.1|1099111_1099294_-	hypothetical protein	NA	A3F673	Streptococcus_phage	76.7	1.4e-19
WP_011106694.1|1099358_1099646_-	hypothetical protein	NA	Q938I9	Temperate_phage	100.0	2.4e-29
WP_011054727.1|1099639_1100215_-	hypothetical protein	NA	Q938J0	Temperate_phage	100.0	1.7e-111
WP_011054728.1|1100690_1101470_-	streptococcal pyrogenic exotoxin SpeK	NA	Q938J1	Temperate_phage	100.0	5.4e-145
WP_011054729.1|1101774_1102641_-	DUF334 domain-containing protein	NA	Q938J2	Temperate_phage	100.0	3.7e-134
WP_011017840.1|1102628_1103153_-	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
WP_014411848.1|1103292_1104501_-	CHAP domain-containing protein	NA	Q938J4	Temperate_phage	86.8	8.6e-214
WP_003058873.1|1104616_1104844_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_002987582.1|1104840_1105116_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
WP_014411849.1|1105125_1105764_-	hypothetical protein	NA	A3F662	Streptococcus_phage	53.2	3.4e-44
WP_014411850.1|1105766_1106195_-	DUF1617 family protein	NA	A3F661	Streptococcus_phage	86.5	1.7e-63
WP_014411851.1|1106206_1108093_-	hypothetical protein	NA	Q938J9	Temperate_phage	86.5	1.3e-203
WP_014411852.1|1108105_1109128_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	91.7	1.2e-168
WP_014411853.1|1109124_1111269_-	peptidase	NA	Q938K1	Temperate_phage	93.3	0.0e+00
WP_014411854.1|1111265_1111973_-	hypothetical protein	NA	Q938K2	Temperate_phage	71.1	1.7e-92
WP_014411855.1|1111972_1115896_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.7	1.9e-238
WP_014411857.1|1116105_1116432_-	hypothetical protein	NA	J7KK85	Streptococcus_phage	73.1	6.0e-37
WP_014411858.1|1116484_1117093_-|tail	phage major tail protein	tail	J7KKC8	Streptococcus_phage	70.5	2.3e-74
WP_002985347.1|1117109_1117535_-	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	85.1	5.0e-68
WP_002985349.1|1117531_1117909_-	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	72.8	1.4e-45
WP_002985351.1|1117905_1118253_-|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	85.5	1.5e-49
WP_014411860.1|1118249_1118552_-	hypothetical protein	NA	J7KC36	Streptococcus_phage	87.0	6.1e-44
WP_014411862.1|1118687_1119890_-|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	64.4	6.0e-135
WP_014411863.1|1120563_1121784_-|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.7	2.0e-186
WP_002985363.1|1121817_1122042_-	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_014411864.1|1122201_1123956_-|terminase	terminase large subunit	terminase	J7KKD1	Streptococcus_phage	96.2	0.0e+00
WP_002985371.1|1123970_1124438_-|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_002985375.1|1124608_1124947_-	HNH endonuclease	NA	J7KH36	Streptococcus_phage	90.7	3.0e-55
WP_014411867.1|1125531_1125972_-	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	99.3	1.9e-78
WP_014411868.1|1126247_1126619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014411869.1|1126615_1127326_-	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	46.2	3.0e-25
WP_011018133.1|1127328_1127961_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	2.3e-85
WP_014411870.1|1127962_1128247_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	89.4	1.4e-37
WP_014411871.1|1128243_1128648_-	hypothetical protein	NA	A3F627	Streptococcus_phage	65.2	1.6e-39
WP_002987593.1|1128657_1128927_-	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	100.0	3.1e-47
WP_014411872.1|1128923_1129208_-	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	96.8	2.2e-48
WP_011054576.1|1129779_1130100_-	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	94.3	7.1e-51
WP_008087509.1|1130096_1130510_-	hypothetical protein	NA	A0A2H4JHE6	uncultured_Caudovirales_phage	50.0	2.8e-15
WP_014411876.1|1130771_1132247_-	DNA primase	NA	A0A1P8VVM0	Streptococcus_phage	86.7	2.9e-248
WP_014411877.1|1132236_1133049_-	hypothetical protein	NA	A0A1P8VVM6	Streptococcus_phage	97.4	1.3e-152
WP_011054580.1|1133051_1133510_-	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	99.3	5.0e-82
WP_011528546.1|1133525_1134755_-	DEAD/DEAH box helicase	NA	A0A1P8VVM2	Streptococcus_phage	100.0	3.3e-237
WP_014411878.1|1134856_1135537_-	AAA family ATPase	NA	A0A1P8VVS4	Streptococcus_phage	99.6	6.2e-129
WP_011054820.1|1135537_1136020_-	siphovirus Gp157 family protein	NA	A0A1P8VVS5	Streptococcus_phage	99.4	4.6e-78
WP_014411879.1|1136167_1136482_-	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	94.2	1.3e-49
WP_014411880.1|1136633_1136945_-	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.6	1.4e-43
WP_011054585.1|1137022_1137208_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_011284879.1|1137374_1137614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984292.1|1137764_1137974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041174345.1|1138226_1139033_+	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	81.7	5.1e-122
WP_010922204.1|1138967_1139234_-	hypothetical protein	NA	A0A1S5SC19	Streptococcus_phage	66.3	1.1e-23
WP_014411882.1|1139244_1139484_-	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	98.7	1.4e-35
WP_011284882.1|1139577_1140177_+	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	100.0	3.1e-108
WP_011285583.1|1140206_1140365_-	hypothetical protein	NA	A0A097PAP2	Streptococcus_pyogenes_phage	100.0	4.8e-24
WP_014411883.1|1140737_1141526_+	phage repressor protein	NA	A0A1S5SD15	Streptococcus_phage	63.0	2.0e-86
WP_011106738.1|1141535_1141841_+	membrane protein	NA	NA	NA	NA	NA
WP_003051793.1|1141963_1143106_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
WP_002983920.1|1143195_1143471_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
1143194:1143213	attR	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_010922482.1|1143569_1144157_-	YpmS family protein	NA	NA	NA	NA	NA
WP_010922483.1|1144134_1144995_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002989125.1|1144969_1145809_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	7.0e-13
>prophage 5
NC_017053	Streptococcus pyogenes MGAS1882, complete genome	1781029	1706239	1719305	1781029		Streptococcus_phage(72.73%)	18	NA	NA
WP_014411911.1|1706239_1707031_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SE31	Streptococcus_phage	48.5	7.5e-09
WP_003045754.1|1707098_1707356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002992501.1|1707410_1707818_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	69.4	1.3e-49
WP_014411912.1|1707831_1708449_+	Rha family transcriptional regulator	NA	A0A159B6D5	Gordonia_phage	38.8	6.3e-11
WP_014407939.1|1708682_1709015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080011075.1|1709014_1709206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206026.1|1709217_1709580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174505.1|1709576_1709906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407941.1|1709908_1710181_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	61.2	1.6e-19
WP_014407942.1|1710181_1711039_+	hypothetical protein	NA	A0A1X9I6L2	Streptococcus_phage	75.2	2.4e-125
WP_014407943.1|1711007_1712696_+	DNA primase	NA	A0A1X9I717	Streptococcus_phage	82.1	2.5e-259
WP_000694577.1|1712982_1713156_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	1.9e-10
WP_014407945.1|1713336_1713846_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	63.5	1.1e-29
WP_014407946.1|1713919_1714408_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.3	2.0e-44
WP_014407947.1|1714814_1715177_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_014407948.1|1715151_1715535_+	DUF1492 domain-containing protein	NA	Q938L8	Temperate_phage	40.2	6.4e-14
WP_014407949.1|1715699_1716353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407950.1|1716749_1719305_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.4	2.3e-43
