The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017040	Streptococcus pyogenes MGAS15252, complete sequence	1750832	30866	43179	1750832		Synechococcus_phage(28.57%)	8	NA	NA
WP_041174317.1|30866_34592_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.9	3.0e-39
WP_009880323.1|34752_36207_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
WP_014407190.1|36234_37257_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.1	1.2e-62
WP_014407191.1|37424_37979_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	6.8e-25
WP_014407192.1|38162_39710_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
WP_014407193.1|39767_40892_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_041174318.1|41144_42410_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_041174354.1|42687_43179_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NC_017040	Streptococcus pyogenes MGAS15252, complete sequence	1750832	332321	338357	1750832		Streptococcus_phage(100.0%)	9	NA	NA
WP_041174327.1|332321_332957_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
WP_002985844.1|332974_333850_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	46.6	2.1e-68
WP_014407337.1|333868_334108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002985838.1|334512_334836_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_014407339.1|334840_335704_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.0	5.5e-114
WP_002985833.1|335730_336123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407340.1|336169_336799_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_014407341.1|337099_337456_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	1.8e-39
WP_002990895.1|337529_338357_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	2.9e-128
>prophage 3
NC_017040	Streptococcus pyogenes MGAS15252, complete sequence	1750832	627933	638536	1750832		Streptococcus_phage(57.14%)	9	NA	NA
WP_014407484.1|627933_630144_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	8.5e-268
WP_002985142.1|630251_631415_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_002985140.1|631411_632098_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002992640.1|632191_633358_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	5.8e-34
WP_002992643.1|633418_633760_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	5.9e-19
WP_002992646.1|633980_635333_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	1.0e-29
WP_002990257.1|635420_636689_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014407485.1|636718_637159_-	membrane protein	NA	NA	NA	NA	NA
WP_002985123.1|637393_638536_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.0	4.1e-24
>prophage 4
NC_017040	Streptococcus pyogenes MGAS15252, complete sequence	1750832	1657958	1677343	1750832	integrase,holin	Streptococcus_phage(56.25%)	24	1661157:1661177	1674644:1674664
WP_014407934.1|1657958_1659179_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	24.3	2.7e-05
WP_014407935.1|1659189_1661172_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.9	1.9e-61
1661157:1661177	attL	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_014407936.1|1661266_1662418_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	44.9	4.7e-84
WP_011185066.1|1662739_1662883_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_011185067.1|1663754_1664435_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	47.9	1.3e-33
WP_011185068.1|1664598_1664796_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I5U5	Streptococcus_phage	63.1	1.3e-15
WP_014407937.1|1664809_1665418_+	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	47.4	2.1e-43
WP_011185070.1|1665438_1665846_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	68.7	8.5e-49
WP_014407938.1|1665859_1666477_+	Rha family transcriptional regulator	NA	A0A159B6D5	Gordonia_phage	38.8	6.3e-11
WP_014407939.1|1666721_1667054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080011075.1|1667053_1667245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206026.1|1667256_1667619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174505.1|1667615_1667945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407941.1|1667947_1668220_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	61.2	1.6e-19
WP_014407942.1|1668220_1669078_+	primase alpha helix C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	75.2	2.4e-125
WP_014407943.1|1669046_1670735_+	DNA primase	NA	A0A1X9I717	Streptococcus_phage	82.1	2.5e-259
WP_000694577.1|1671021_1671195_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	1.9e-10
WP_014407944.1|1671200_1671374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407945.1|1671375_1671885_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	63.5	1.1e-29
WP_014407946.1|1671958_1672447_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.3	2.0e-44
WP_014407947.1|1672852_1673215_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_014407948.1|1673189_1673573_+	DUF1492 domain-containing protein	NA	Q938L8	Temperate_phage	40.2	6.4e-14
WP_014407949.1|1673737_1674391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407950.1|1674787_1677343_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.4	2.3e-43
1674644:1674664	attR	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
>prophage 5
NC_017040	Streptococcus pyogenes MGAS15252, complete sequence	1750832	1703721	1713708	1750832	integrase	Streptococcus_phage(75.0%)	15	1703295:1703309	1710857:1710871
1703295:1703309	attL	AATCCTTGAAGCTGT	NA	NA	NA	NA
WP_000694580.1|1703721_1703895_-	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	1.9e-10
WP_011285313.1|1704181_1705795_-	hypothetical protein	NA	A0A1P8BMF9	Lactococcus_phage	53.1	2.4e-147
WP_011285314.1|1705784_1706306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285315.1|1706315_1706684_-	hypothetical protein	NA	A0A1X9I6M4	Streptococcus_phage	47.1	2.6e-12
WP_021340713.1|1706592_1706784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285317.1|1706783_1707116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285318.1|1707127_1707310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014407970.1|1707530_1707773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285320.1|1707829_1708396_-	hypothetical protein	NA	A0A0A7S0G2	Clostridium_phage	42.9	5.0e-23
WP_011285321.1|1708411_1708600_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I5U7	Streptococcus_phage	59.7	1.7e-12
WP_011285322.1|1708768_1709212_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	48.6	1.8e-07
WP_011285323.1|1709391_1710555_+|integrase	site-specific integrase	integrase	A0A1X9I6A9	Streptococcus_phage	70.5	2.8e-161
WP_014407971.1|1710711_1711323_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
1710857:1710871	attR	ACAGCTTCAAGGATT	NA	NA	NA	NA
WP_002991405.1|1712051_1712324_-	Veg family protein	NA	NA	NA	NA	NA
WP_080011054.1|1712340_1713708_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	63.7	7.8e-155
